ABCA1 Rabbit Polyclonal Antibody
To Order Now: info@poweratlas.org
ABCA1 Polyclonal Antibody |
ABP57645-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human ABCA1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of ABCA1 from Human, Mouse. This ABCA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ABCA1 protein |
ABCA1 Polyclonal Antibody |
ABP57645-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human ABCA1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of ABCA1 from Human, Mouse. This ABCA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ABCA1 protein |
ABCA1 Rabbit pAb |
A7228-100ul |
Abclonal |
100 ul |
EUR 308 |
ABCA1 Rabbit pAb |
A7228-200ul |
Abclonal |
200 ul |
EUR 459 |
ABCA1 Rabbit pAb |
A7228-20ul |
Abclonal |
20 ul |
EUR 183 |
ABCA1 Rabbit pAb |
A7228-50ul |
Abclonal |
50 ul |
EUR 223 |
ABCA1 Rabbit pAb |
A16337-100ul |
Abclonal |
100 ul |
EUR 308 |
ABCA1 Rabbit pAb |
A16337-200ul |
Abclonal |
200 ul |
EUR 459 |
ABCA1 Rabbit pAb |
A16337-20ul |
Abclonal |
20 ul |
EUR 183 |
ABCA1 Rabbit pAb |
A16337-50ul |
Abclonal |
50 ul |
EUR 223 |
Human ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit |
DLR-ABCA1-Hu-48T |
DL Develop |
48T |
EUR 498 |
- Should the Human ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human ATP Binding Cassette Transporter A1 (ABCA1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit |
DLR-ABCA1-Hu-96T |
DL Develop |
96T |
EUR 647 |
- Should the Human ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human ATP Binding Cassette Transporter A1 (ABCA1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Mouse ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit |
DLR-ABCA1-Mu-48T |
DL Develop |
48T |
EUR 508 |
- Should the Mouse ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse ATP Binding Cassette Transporter A1 (ABCA1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit |
DLR-ABCA1-Mu-96T |
DL Develop |
96T |
EUR 661 |
- Should the Mouse ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse ATP Binding Cassette Transporter A1 (ABCA1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit |
RD-ABCA1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit |
RD-ABCA1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Mouse ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit |
RD-ABCA1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Mouse ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit |
RD-ABCA1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Human ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit |
RDR-ABCA1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522 |
Human ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit |
RDR-ABCA1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724 |
Mouse ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit |
RDR-ABCA1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 534 |
Mouse ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit |
RDR-ABCA1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 742 |
Rabbit ABCA1 ELISA Kit |
ERTA0638 |
Abclonal |
96Tests |
EUR 521 |
ABCA1 antibody |
70R-51245 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal ABCA1 antibody |
Abca1 antibody |
70R-8568 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal Abca1 antibody |
ABCA1 Antibody |
43463-100ul |
SAB |
100ul |
EUR 252 |
ABCA1 Antibody |
21676-100ul |
SAB |
100ul |
EUR 252 |
ABCA1 Antibody |
21676-50ul |
SAB |
50ul |
EUR 187 |
ABCA1 Antibody |
DF8233 |
Affbiotech |
200ul |
EUR 304 |
Description: ABCA1 Antibody detects endogenous levels of total ABCA1. |
ABCA1 Conjugated Antibody |
C21676 |
SAB |
100ul |
EUR 397 |
Anti-ABCA1 Antibody |
PB9467 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-ABCA1 Antibody |
PA1843 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-ABCA1 antibody |
STJ29308 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. With cholesterol as its substrate, this protein functions as a cholesteral efflux pump in the cellular lipid removal pathway. Mutations in this gene have been associated with Tangier's disease and familial high-density lipoprotein deficiency. |
Anti-ABCA1 antibody |
STJ192951 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to ABCA1 |
ABCA1 siRNA |
20-abx906284 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ABCA1 siRNA |
20-abx906285 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ABCA1 Blocking Peptide |
20-abx064120 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Abca1 Blocking Peptide |
33R-6863 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Abca1 antibody, catalog no. 70R-8568 |
ABCA1 Blocking Peptide |
DF8233-BP |
Affbiotech |
1mg |
EUR 195 |
ABCA1 cloning plasmid |
CSB-CL001033HU-10ug |
Cusabio |
10ug |
EUR 339 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 819
- Sequence: ATGGCTTGTTGGCCTCAGCTGAGGTTGCTGCTGTGGAAGAACCTCACTTTCAGAAGAAGACAAACATGTCAGCTGCTGCTGGAAGTGGCCTGGCCTCTATTTATCTTCCTGATCCTGATCTCTGTTCGGCTGAGCTACCCACCCTATGAACAACATGAATGCCATTTTCCAAATAA
- Show more
|
Description: A cloning plasmid for the ABCA1 gene. |
Anti-ABCA1 (1H4) |
YF-MA11791 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to ABCA1 |
ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Human) |
4-PAB242Hu01 |
Cloud-Clone |
-
EUR 239.00
-
EUR 2391.00
-
EUR 598.00
-
EUR 299.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ABCA1 (Asn1385~Phe1663)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A1 (ABCA1) |
ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Mouse) |
4-PAB242Mu01 |
Cloud-Clone |
-
EUR 243.00
-
EUR 2457.00
-
EUR 613.00
-
EUR 305.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ABCA1 (Leu1404~Phe1663)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A1 (ABCA1) |
ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Human), APC |
4-PAB242Hu01-APC |
Cloud-Clone |
-
EUR 333.00
-
EUR 3113.00
-
EUR 872.00
-
EUR 423.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ABCA1 (Asn1385~Phe1663)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with APC. |
ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Human), Biotinylated |
4-PAB242Hu01-Biotin |
Cloud-Clone |
-
EUR 303.00
-
EUR 2341.00
-
EUR 697.00
-
EUR 369.00
-
EUR 216.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ABCA1 (Asn1385~Phe1663)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with Biotin. |
ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Human), Cy3 |
4-PAB242Hu01-Cy3 |
Cloud-Clone |
-
EUR 403.00
-
EUR 4109.00
-
EUR 1121.00
-
EUR 523.00
-
EUR 245.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ABCA1 (Asn1385~Phe1663)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with Cy3. |
ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Human), FITC |
4-PAB242Hu01-FITC |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ABCA1 (Asn1385~Phe1663)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with FITC. |
ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Human), HRP |
4-PAB242Hu01-HRP |
Cloud-Clone |
-
EUR 305.00
-
EUR 2714.00
-
EUR 772.00
-
EUR 383.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ABCA1 (Asn1385~Phe1663)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with HRP. |
ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Human), PE |
4-PAB242Hu01-PE |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ABCA1 (Asn1385~Phe1663)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with PE. |
ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Mouse), APC |
4-PAB242Mu01-APC |
Cloud-Clone |
-
EUR 340.00
-
EUR 3203.00
-
EUR 894.00
-
EUR 432.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ABCA1 (Leu1404~Phe1663)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with APC. |
ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Mouse), Biotinylated |
4-PAB242Mu01-Biotin |
Cloud-Clone |
-
EUR 307.00
-
EUR 2407.00
-
EUR 714.00
-
EUR 375.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ABCA1 (Leu1404~Phe1663)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with Biotin. |
ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Mouse), Cy3 |
4-PAB242Mu01-Cy3 |
Cloud-Clone |
-
EUR 411.00
-
EUR 4229.00
-
EUR 1151.00
-
EUR 535.00
-
EUR 248.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ABCA1 (Leu1404~Phe1663)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with Cy3. |
ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Mouse), FITC |
4-PAB242Mu01-FITC |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ABCA1 (Leu1404~Phe1663)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with FITC. |
ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Mouse), HRP |
4-PAB242Mu01-HRP |
Cloud-Clone |
-
EUR 311.00
-
EUR 2792.00
-
EUR 791.00
-
EUR 391.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ABCA1 (Leu1404~Phe1663)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with HRP. |
ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Mouse), PE |
4-PAB242Mu01-PE |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ABCA1 (Leu1404~Phe1663)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with PE. |
Human ABCA1 ELISA Kit |
EHA0638 |
Abclonal |
96Tests |
EUR 521 |
Goat ABCA1 ELISA Kit |
EGTA0638 |
Abclonal |
96Tests |
EUR 521 |
Canine ABCA1 ELISA Kit |
ECA0638 |
Abclonal |
96Tests |
EUR 521 |
Chicken ABCA1 ELISA Kit |
ECKA0638 |
Abclonal |
96Tests |
EUR 521 |
Bovine ABCA1 ELISA Kit |
EBA0638 |
Abclonal |
96Tests |
EUR 521 |
Anserini ABCA1 ELISA Kit |
EAA0638 |
Abclonal |
96Tests |
EUR 521 |
Rat ABCA1 ELISA Kit |
ERA0638 |
Abclonal |
96Tests |
EUR 521 |
Sheep ABCA1 ELISA Kit |
ESA0638 |
Abclonal |
96Tests |
EUR 521 |
Porcine ABCA1 ELISA Kit |
EPA0638 |
Abclonal |
96Tests |
EUR 521 |
Mouse ABCA1 ELISA Kit |
EMA0638 |
Abclonal |
96Tests |
EUR 521 |
Monkey ABCA1 ELISA Kit |
EMKA0638 |
Abclonal |
96Tests |
EUR 521 |
Human ABCA1 shRNA Plasmid |
20-abx950011 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse ABCA1 shRNA Plasmid |
20-abx968978 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rabbit ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit |
abx363663-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Human), APC-Cy7 |
4-PAB242Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 547.00
-
EUR 6106.00
-
EUR 1624.00
-
EUR 727.00
-
EUR 310.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ABCA1 (Asn1385~Phe1663)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with APC-Cy7. |
ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAB242Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 560.00
-
EUR 6286.00
-
EUR 1669.00
-
EUR 745.00
-
EUR 315.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ABCA1 (Leu1404~Phe1663)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with APC-Cy7. |
ATP Binding Cassette Transporter A1 (ABCA1) Antibody |
20-abx128016 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1149.00
-
EUR 565.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
ATP Binding Cassette Transporter A1 (ABCA1) Antibody |
20-abx103801 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1177.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
ATP Binding Cassette Transporter A1 (ABCA1) Antibody |
abx038220-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
ATP Binding Cassette Transporter A1 (ABCA1) Antibody |
20-abx007896 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
ATP Binding Cassette Transporter A1 (ABCA1) Antibody |
20-abx005455 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
ATP Binding Cassette Transporter A1 (ABCA1) Antibody |
20-abx175490 |
Abbexa |
|
|
|
ATP Binding Cassette Transporter A1 (ABCA1) Antibody |
20-abx171344 |
Abbexa |
|
|
|
Guinea Pig ABCA1 ELISA Kit |
EGA0638 |
Abclonal |
96Tests |
EUR 521 |
Abca1 ORF Vector (Mouse) (pORF) |
ORF037750 |
ABM |
1.0 ug DNA |
EUR 95 |
ABCA1 ORF Vector (Human) (pORF) |
ORF012121 |
ABM |
1.0 ug DNA |
EUR 354 |
Abca1 ORF Vector (Rat) (pORF) |
ORF062836 |
ABM |
1.0 ug DNA |
EUR 2396 |
pGreenFire1-LXRE in ABCA1(plasmid) |
TR106PA-P |
SBI |
10 ug |
EUR 786 |
- Category: Lentiviral Technology
|
pGreenFire1-LXRE in ABCA1(virus) |
TR106VA-P |
SBI |
>2 x 10^6 IFUs |
EUR 786 |
- Category: Lentiviral Technology
|
ABCA1 ELISA Kit (Human) (OKCD07241) |
OKCD07241 |
Aviva Systems Biology |
96 Wells |
EUR 936 |
Description: Description of target: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. With cholesterol as its substrate, this protein functions as a cholesteral efflux pump in the cellular lipid removal pathway. Mutations in this gene have been associated with Tangier's disease and familial high-density lipoprotein deficiency.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL |
ABCA1 ELISA Kit (Mouse) (OKCD07242) |
OKCD07242 |
Aviva Systems Biology |
96 Wells |
EUR 818 |
Description: Description of target: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. In humans, this protein functions as a cholesterol efflux pump in the cellular lipid removal pathway. Mutations in the human gene have been associated with Tangier's disease and familial high-density lipoprotein deficiency.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.060ng/mL |
Abca1 ELISA Kit (Mouse) (OKEH04671) |
OKEH04671 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. In humans, this protein functions as a cholesterol efflux pump in the cellular lipid removal pathway. Mutations in the human gene have been associated with Tangier's disease and familial high-density lipoprotein deficiency.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.089 ng/mL |
ABCA1 ELISA Kit (Rat) (OKEI00688) |
OKEI00688 |
Aviva Systems Biology |
96 Wells |
EUR 767 |
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL |
ATP Binding Cassette Transporter A1 (ABCA1) Antibody (FITC) |
abx414469-01mg |
Abbexa |
0.1 mg |
EUR 509 |
|
ATP Binding Cassette Transporter A1 (ABCA1) Antibody (RPE) |
abx414470-100tests |
Abbexa |
100 tests |
EUR 592 |
|
ATP Binding Cassette Transporter A1 (ABCA1) Antibody (FITC) |
abx414659-01mg |
Abbexa |
0.1 mg |
EUR 509 |
|
ABCA1 sgRNA CRISPR Lentivector set (Human) |
K0016601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Abca1 sgRNA CRISPR Lentivector set (Mouse) |
K4382601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Abca1 sgRNA CRISPR Lentivector set (Rat) |
K6716301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Monoclonal ABCA1 Antibody (aa1800-2260, clone A00121.01), Clone: A00121.01 |
APG01394G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A Monoclonal antibody against Human ABCA1 (aa1800-2260, clone A00121.01). The antibodies are raised in Mouse and are from clone A00121.01. This antibody is applicable in WB and IHC-P, E |
ABCA1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0016602 |
ABM |
1.0 ug DNA |
EUR 154 |
ABCA1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0016603 |
ABM |
1.0 ug DNA |
EUR 154 |
ABCA1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0016604 |
ABM |
1.0 ug DNA |
EUR 154 |
Abca1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4382602 |
ABM |
1.0 ug DNA |
EUR 154 |
Abca1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4382603 |
ABM |
1.0 ug DNA |
EUR 154 |
ABCA1 Rabbit Polyclonal Antibody