ABCA1 Rabbit Polyclonal Antibody

ABCA1 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

ABCA1 Polyclonal Antibody
ES11793-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ABCA1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

ABCA1 Polyclonal Antibody
ES11793-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ABCA1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

ABCA1 Rabbit pAb
A16337-100ul 100 ul
EUR 308

ABCA1 Rabbit pAb
A16337-200ul 200 ul
EUR 459

ABCA1 Rabbit pAb
A16337-20ul 20 ul
EUR 183

ABCA1 Rabbit pAb
A16337-50ul 50 ul
EUR 223

ABCA1 Rabbit pAb
A7228-100ul 100 ul
EUR 308

ABCA1 Rabbit pAb
A7228-200ul 200 ul
EUR 459

ABCA1 Rabbit pAb
A7228-20ul 20 ul
EUR 183

ABCA1 Rabbit pAb
A7228-50ul 50 ul
EUR 223

Human ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit
DLR-ABCA1-Hu-48T 48T
EUR 498
  • Should the Human ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human ATP Binding Cassette Transporter A1 (ABCA1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit
DLR-ABCA1-Hu-96T 96T
EUR 647
  • Should the Human ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human ATP Binding Cassette Transporter A1 (ABCA1) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit
DLR-ABCA1-Mu-48T 48T
EUR 508
  • Should the Mouse ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse ATP Binding Cassette Transporter A1 (ABCA1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit
DLR-ABCA1-Mu-96T 96T
EUR 661
  • Should the Mouse ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse ATP Binding Cassette Transporter A1 (ABCA1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit
RD-ABCA1-Hu-48Tests 48 Tests
EUR 500

Human ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit
RD-ABCA1-Hu-96Tests 96 Tests
EUR 692

Mouse ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit
RD-ABCA1-Mu-48Tests 48 Tests
EUR 511

Mouse ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit
RD-ABCA1-Mu-96Tests 96 Tests
EUR 709

Human ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit
RDR-ABCA1-Hu-48Tests 48 Tests
EUR 522

Human ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit
RDR-ABCA1-Hu-96Tests 96 Tests
EUR 724

Mouse ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit
RDR-ABCA1-Mu-48Tests 48 Tests
EUR 534

Mouse ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit
RDR-ABCA1-Mu-96Tests 96 Tests
EUR 742

Rabbit ABCA1 ELISA Kit
ERTA0638 96Tests
EUR 521

ABCA1 Antibody
21676-100ul 100ul
EUR 252

ABCA1 Antibody
21676-50ul 50ul
EUR 187

ABCA1 Antibody
43463-100ul 100ul
EUR 252

ABCA1 Antibody
DF8233 200ul
EUR 304
Description: ABCA1 Antibody detects endogenous levels of total ABCA1.

Abca1 antibody
70R-8568 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Abca1 antibody

ABCA1 antibody
70R-51245 100 ul
EUR 244
Description: Purified Polyclonal ABCA1 antibody

ABCA1 Antibody
ABD8233 100 ug
EUR 438

ABCA1
MO13101 100 ul
EUR 409

ABCA1 Conjugated Antibody
C21676 100ul
EUR 397

Anti-ABCA1 Antibody
PA1843 100ug/vial
EUR 294

Anti-ABCA1 Antibody
PB9467 100ug/vial
EUR 294

Anti-ABCA1 antibody
STJ118777 100 µl
EUR 277

Anti-ABCA1 antibody
STJ29308 100 µl
EUR 277
Description: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. With cholesterol as its substrate, this protein functions as a cholesteral efflux pump in the cellular lipid removal pathway. Mutations in this gene have been associated with Tangier's disease and familial high-density lipoprotein deficiency.

Anti-ABCA1 antibody
STJ192951 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ABCA1

ABCA1 siRNA
20-abx906284
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ABCA1 siRNA
20-abx906285
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Abca1 Blocking Peptide
33R-6863 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Abca1 antibody, catalog no. 70R-8568

ABCA1 Blocking Peptide
DF8233-BP 1mg
EUR 195

ABCA1 Blocking Peptide
20-abx064120
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

ABCA1 cloning plasmid
CSB-CL001033HU-10ug 10ug
EUR 339
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 819
  • Sequence: ATGGCTTGTTGGCCTCAGCTGAGGTTGCTGCTGTGGAAGAACCTCACTTTCAGAAGAAGACAAACATGTCAGCTGCTGCTGGAAGTGGCCTGGCCTCTATTTATCTTCCTGATCCTGATCTCTGTTCGGCTGAGCTACCCACCCTATGAACAACATGAATGCCATTTTCCAAATAA
  • Show more
Description: A cloning plasmid for the ABCA1 gene.

Anti-ABCA1 (1H4)
YF-MA11791 200 ul
EUR 363
Description: Mouse monoclonal to ABCA1

ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Human)
4-PAB242Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA1 (Asn1385~Phe1663)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A1 (ABCA1)

ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Mouse)
4-PAB242Mu01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA1 (Leu1404~Phe1663)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A1 (ABCA1)

ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Human), APC
4-PAB242Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA1 (Asn1385~Phe1663)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with APC.

ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Human), Biotinylated
4-PAB242Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA1 (Asn1385~Phe1663)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with Biotin.

ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Human), Cy3
4-PAB242Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA1 (Asn1385~Phe1663)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with Cy3.

ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Human), FITC
4-PAB242Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA1 (Asn1385~Phe1663)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with FITC.

ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Human), HRP
4-PAB242Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA1 (Asn1385~Phe1663)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with HRP.

ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Human), PE
4-PAB242Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA1 (Asn1385~Phe1663)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with PE.

ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Mouse), APC
4-PAB242Mu01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA1 (Leu1404~Phe1663)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with APC.

ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Mouse), Biotinylated
4-PAB242Mu01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA1 (Leu1404~Phe1663)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with Biotin.

ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Mouse), Cy3
4-PAB242Mu01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA1 (Leu1404~Phe1663)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with Cy3.

ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Mouse), FITC
4-PAB242Mu01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA1 (Leu1404~Phe1663)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with FITC.

ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Mouse), HRP
4-PAB242Mu01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA1 (Leu1404~Phe1663)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with HRP.

ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Mouse), PE
4-PAB242Mu01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA1 (Leu1404~Phe1663)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with PE.

Rat Anti Mouse Abca1 Monoclonal Antibody
CABT-50918RM 0.25 mg
EUR 580

Human ABCA1 ELISA Kit
EHA0638 96Tests
EUR 521

Human ABCA1 ELISA Kit
ELA-E1242h 96 Tests
EUR 824

Goat ABCA1 ELISA Kit
EGTA0638 96Tests
EUR 521

Canine ABCA1 ELISA Kit
ECA0638 96Tests
EUR 521

Chicken ABCA1 ELISA Kit
ECKA0638 96Tests
EUR 521

Anserini ABCA1 ELISA Kit
EAA0638 96Tests
EUR 521

Bovine ABCA1 ELISA Kit
EBA0638 96Tests
EUR 521

Human ABCA1 ELISA KIT
ELI-04120h 96 Tests
EUR 824

Mouse Abca1 ELISA KIT
ELI-04121m 96 Tests
EUR 865

ABCA1 ELISA KIT|Human
EF004761 96 Tests
EUR 689

Human ABCA1 shRNA Plasmid
20-abx950011
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ABCA1 shRNA Plasmid
20-abx968978
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ABCA1 ELISA Kit
EMA0638 96Tests
EUR 521

Rat ABCA1 ELISA Kit
ERA0638 96Tests
EUR 521

Sheep ABCA1 ELISA Kit
ESA0638 96Tests
EUR 521

Monkey ABCA1 ELISA Kit
EMKA0638 96Tests
EUR 521

Porcine ABCA1 ELISA Kit
EPA0638 96Tests
EUR 521

Rabbit ATP Binding Cassette Transporter A1 (ABCA1) ELISA Kit
abx363663-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Human), APC-Cy7
4-PAB242Hu01-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA1 (Asn1385~Phe1663)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with APC-Cy7.

ATP Binding Cassette Transporter A1 (ABCA1) Polyclonal Antibody (Mouse), APC-Cy7
4-PAB242Mu01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA1 (Leu1404~Phe1663)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A1 (ABCA1). This antibody is labeled with APC-Cy7.

ATP Binding Cassette Transporter A1 (ABCA1) Antibody
20-abx007896
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

ATP Binding Cassette Transporter A1 (ABCA1) Antibody
20-abx005455
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

ATP Binding Cassette Transporter A1 (ABCA1) Antibody
20-abx175490
  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

ATP Binding Cassette Transporter A1 (ABCA1) Antibody
20-abx103801
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ATP Binding Cassette Transporter A1 (ABCA1) Antibody
20-abx128016
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ATP Binding Cassette Transporter A1 (ABCA1) Antibody
abx038220-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

ATP Binding Cassette Transporter A1 (ABCA1) Antibody
20-abx171344
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Rat Anti Mouse Abca1 Monoclonal Antibody,RPE
CABT-50919RM 100 TEST
EUR 533

Rat Anti Mouse Abca1 Monoclonal Antibody,FITC
CABT-50920RM 0.1 mg
EUR 429

Guinea Pig ABCA1 ELISA Kit
EGA0638 96Tests
EUR 521

Abca1 ORF Vector (Rat) (pORF)
ORF062836 1.0 ug DNA
EUR 2396

ABCA1 ORF Vector (Human) (pORF)
ORF012121 1.0 ug DNA
EUR 354

Abca1 ORF Vector (Mouse) (pORF)
ORF037750 1.0 ug DNA
EUR 95

pGreenFire1-LXRE in ABCA1(plasmid)
TR106PA-P 10 ug
EUR 786
  • Category: Lentiviral Technology

pGreenFire1-LXRE in ABCA1(virus)
TR106VA-P >2 x 10^6 IFUs
EUR 786
  • Category: Lentiviral Technology

ABCA1 ELISA Kit (Human) (OKCD07241)
OKCD07241 96 Wells
EUR 936
Description: Description of target: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. With cholesterol as its substrate, this protein functions as a cholesteral efflux pump in the cellular lipid removal pathway. Mutations in this gene have been associated with Tangier's disease and familial high-density lipoprotein deficiency.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL

ABCA1 ELISA Kit (Mouse) (OKCD07242)
OKCD07242 96 Wells
EUR 818
Description: Description of target: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. In humans, this protein functions as a cholesterol efflux pump in the cellular lipid removal pathway. Mutations in the human gene have been associated with Tangier's disease and familial high-density lipoprotein deficiency.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.060ng/mL

Abca1 ELISA Kit (Mouse) (OKEH04671)
OKEH04671 96 Wells
EUR 662
Description: Description of target: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. In humans, this protein functions as a cholesterol efflux pump in the cellular lipid removal pathway. Mutations in the human gene have been associated with Tangier's disease and familial high-density lipoprotein deficiency.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.089 ng/mL

ABCA1 ELISA Kit (Rat) (OKEI00688)
OKEI00688 96 Wells
EUR 767
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL

ATP Binding Cassette Transporter A1 (ABCA1) Antibody (FITC)
abx414469-01mg 0.1 mg
EUR 509
  • Shipped within 1 week.

ATP Binding Cassette Transporter A1 (ABCA1) Antibody (RPE)
abx414470-100tests 100 tests
EUR 592
  • Shipped within 1 week.

ATP Binding Cassette Transporter A1 (ABCA1) Antibody (FITC)
abx414659-01mg 0.1 mg
EUR 509
  • Shipped within 1 week.

Abca1 sgRNA CRISPR Lentivector set (Rat)
K6716301 3 x 1.0 ug
EUR 339

Abca1 sgRNA CRISPR Lentivector set (Mouse)
K4382601 3 x 1.0 ug
EUR 339

ABCA1 sgRNA CRISPR Lentivector set (Human)
K0016601 3 x 1.0 ug
EUR 339

Monoclonal ABCA1 Antibody (aa1800-2260, clone A00121.01), Clone: A00121.01
APG01394G 0.05mg
EUR 484
Description: A Monoclonal antibody against Human ABCA1 (aa1800-2260, clone A00121.01). The antibodies are raised in Mouse and are from clone A00121.01. This antibody is applicable in WB and IHC-P, E

Abca1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6716302 1.0 ug DNA
EUR 154

Abca1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6716303 1.0 ug DNA
EUR 154

Abca1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6716304 1.0 ug DNA
EUR 154

Abca1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4382602 1.0 ug DNA
EUR 154

Abca1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4382603 1.0 ug DNA
EUR 154

ABCA1 Rabbit Polyclonal Antibody