GNAI1 Rabbit Polyclonal Antibody

GNAI1 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

GNAI1 Polyclonal Antibody

ABP58653-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human GNAI1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of GNAI1 from Human, Mouse, Rat. This GNAI1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GNAI1 protein

GNAI1 Polyclonal Antibody

ES11882-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GNAI1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

GNAI1 Polyclonal Antibody

ES11882-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GNAI1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

GNAI1 Rabbit pAb

A8844-100ul 100 ul
EUR 308

GNAI1 Rabbit pAb

A8844-200ul 200 ul
EUR 459

GNAI1 Rabbit pAb

A8844-20ul 20 ul
EUR 183

GNAI1 Rabbit pAb

A8844-50ul 50 ul
EUR 223

GNAI1 Rabbit pAb

A17388-100ul 100 ul Ask for price

GNAI1 Rabbit pAb

A17388-200ul 200 ul Ask for price

GNAI1 Rabbit pAb

A17388-20ul 20 ul Ask for price

GNAI1 Rabbit pAb

A17388-50ul 50 ul
EUR 384

GNAI1 Polyclonal Conjugated Antibody

C31642 100ul
EUR 397

GNAI1 Polyclonal Conjugated Antibody

C31909 100ul
EUR 397

GNAI1 antibody

70R-17519 50 ul
EUR 435
Description: Rabbit polyclonal GNAI1 antibody

GNAI1 antibody

70R-2047 50 ug
EUR 467
Description: Rabbit polyclonal GNAI1 antibody

GNAI1 antibody

31909-100ul 100ul
EUR 252

GNAI1 antibody

31909-50ul 50ul
EUR 187

GNAI1 antibody

70R-49798 100 ul
EUR 244
Description: Purified Polyclonal GNAI1 antibody

GNAI1 Antibody

1-CSB-PA009588GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GNAI1. Recognizes GNAI1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Gnai1/ Rat Gnai1 ELISA Kit

ELI-27929r 96 Tests
EUR 886

anti- GNAI1 antibody

FNab03531 100µg
EUR 505.25
  • Immunogen: guanine nucleotide binding protein(G protein), alpha inhibiting activity polypeptide 1
  • Uniprot ID: P63096
  • Gene ID: 2770
  • Research Area: Signal Transduction
Description: Antibody raised against GNAI1

Anti-GNAI1 antibody

PAab03531 100 ug
EUR 355

Anti-GNAI1 antibody

STJ116332 100 µl
EUR 277
Description: Guanine nucleotide binding proteins are heterotrimeric signal-transducing molecules consisting of alpha, beta, and gamma subunits. The alpha subunit binds guanine nucleotide, can hydrolyze GTP, and can interact with other proteins. The protein encoded by this gene represents the alpha subunit of an inhibitory complex. The encoded protein is part of a complex that responds to beta-adrenergic signals by inhibiting adenylate cyclase. Two transcript variants encoding different isoforms have been found for this gene.

Anti-GNAI1 antibody

STJ119511 50 µl
EUR 393
Description: Guanine nucleotide binding proteins are heterotrimeric signal-transducing molecules consisting of alpha, beta, and gamma subunits. The alpha subunit binds guanine nucleotide, can hydrolyze GTP, and can interact with other proteins. The protein encoded by this gene represents the alpha subunit of an inhibitory complex. The encoded protein is part of a complex that responds to beta-adrenergic signals by inhibiting adenylate cyclase. Two transcript variants encoding different isoforms have been found for this gene.

Anti-GNAI1 antibody

STJ193040 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GNAI1

GNAI1 siRNA

20-abx902212
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNAI1 Protein

20-abx262917
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

GNAI1 siRNA

20-abx918142
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNAI1 siRNA

20-abx918143
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNAI1 Blocking Peptide

33R-10215 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAI1 antibody, catalog no. 70R-2047

GNAI1 Blocking Peptide

20-abx062673
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

GNAI1 cloning plasmid

CSB-CL009588HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1065
  • Sequence: atgggctgcacgctgagcgccgaggacaaggcggcggtggagcggagtaagatgatcgaccgcaacctccgtgaggacggcgagaaggcggcgcgcgaggtcaagctgctgctgctcggtgctggtgaatctggtaaaagtacaattgtgaagcagatgaaaattatccatgaag
  • Show more
Description: A cloning plasmid for the GNAI1 gene.

pBluescriptR-GNAI1 Plasmid

PVT17029 2 ug
EUR 325

GNAI1 protein (His tag)

80R-1980 50 ug
EUR 322
Description: Recombinant human GNAI1 protein (His tag)

Chicken GNAI1 ELISA KIT

ELI-08736c 96 Tests
EUR 928

Bovine GNAI1 ELISA KIT

ELI-27342b 96 Tests
EUR 928

GNAI1 ELISA KIT|Human

EF009906 96 Tests
EUR 689

Mouse Gnai1 ELISA KIT

ELI-43677m 96 Tests
EUR 865

Rat GNAI1 shRNA Plasmid

20-abx985222
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GNAI1 shRNA Plasmid

20-abx951841
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GNAI1 shRNA Plasmid

20-abx970574
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GNAI1 ELISA KIT

ELI-38025h 96 Tests
EUR 824

GNAI1 Recombinant Protein (Human)

RP013462 100 ug Ask for price

GNAI1 Recombinant Protein (Rat)

RP202943 100 ug Ask for price

GNAI1 Recombinant Protein (Mouse)

RP138896 100 ug Ask for price

Gnai1 ORF Vector (Rat) (pORF)

ORF067649 1.0 ug DNA
EUR 506

GNAI1 ORF Vector (Human) (pORF)

ORF004488 1.0 ug DNA
EUR 95

Gnai1 ORF Vector (Mouse) (pORF)

ORF046300 1.0 ug DNA
EUR 506

guanine nucleotide binding protein alpha inhibiting activity polypeptide 1 (GNAI1) polyclonal antibody

ABP-PAB-11315 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:

Monoclonal GNAI1 / Gi Antibody (clone R4.5), Clone: R4.5

APR16182G 0.05ml
EUR 484
Description: A Monoclonal antibody against Human GNAI1 / Gi (clone R4.5). The antibodies are raised in Mouse and are from clone R4.5. This antibody is applicable in WB and IHC-P

Monoclonal GNAI1 Antibody (monoclonal) (M01), Clone: 2B8-2A5

APR16183G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human GNAI1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2B8-2A5. This antibody is applicable in WB and IHC, E

Gnai1 sgRNA CRISPR Lentivector set (Rat)

K6775801 3 x 1.0 ug
EUR 339

Gnai1 sgRNA CRISPR Lentivector set (Mouse)

K3829301 3 x 1.0 ug
EUR 339

GNAI1 sgRNA CRISPR Lentivector set (Human)

K0874501 3 x 1.0 ug
EUR 339

Gnai1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6775802 1.0 ug DNA
EUR 154

Gnai1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6775803 1.0 ug DNA
EUR 154

Gnai1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6775804 1.0 ug DNA
EUR 154

Gnai1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3829302 1.0 ug DNA
EUR 154

Gnai1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3829303 1.0 ug DNA
EUR 154

Gnai1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3829304 1.0 ug DNA
EUR 154

GNAI1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0874502 1.0 ug DNA
EUR 154

GNAI1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0874503 1.0 ug DNA
EUR 154

GNAI1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0874504 1.0 ug DNA
EUR 154

GNAI1 Protein Vector (Rat) (pPB-C-His)

PV270594 500 ng
EUR 603

GNAI1 Protein Vector (Rat) (pPB-N-His)

PV270595 500 ng
EUR 603

GNAI1 Protein Vector (Rat) (pPM-C-HA)

PV270596 500 ng
EUR 603

GNAI1 Protein Vector (Rat) (pPM-C-His)

PV270597 500 ng
EUR 603

GNAI1 Protein Vector (Mouse) (pPB-C-His)

PV185198 500 ng
EUR 603

GNAI1 Protein Vector (Mouse) (pPB-N-His)

PV185199 500 ng
EUR 603

GNAI1 Protein Vector (Mouse) (pPM-C-HA)

PV185200 500 ng
EUR 603

GNAI1 Protein Vector (Mouse) (pPM-C-His)

PV185201 500 ng
EUR 603

GNAI1 Protein Vector (Human) (pPB-C-His)

PV017949 500 ng
EUR 329

GNAI1 Protein Vector (Human) (pPB-N-His)

PV017950 500 ng
EUR 329

GNAI1 Protein Vector (Human) (pPM-C-HA)

PV017951 500 ng
EUR 329

GNAI1 Protein Vector (Human) (pPM-C-His)

PV017952 500 ng
EUR 329

Recombinant Human GNAI1 Protein, His, E.coli-10ug

QP12009-10ug 10ug
EUR 201

Recombinant Human GNAI1 Protein, His, E.coli-1mg

QP12009-1mg 1mg
EUR 5251

Recombinant Human GNAI1 Protein, His, E.coli-2ug

QP12009-2ug 2ug
EUR 155

Gnai1 3'UTR Luciferase Stable Cell Line

TU108846 1.0 ml Ask for price

Gnai1 3'UTR Luciferase Stable Cell Line

TU205205 1.0 ml Ask for price

Gnai1 3'UTR GFP Stable Cell Line

TU158846 1.0 ml Ask for price

Gnai1 3'UTR GFP Stable Cell Line

TU255205 1.0 ml Ask for price

GNAI1 3'UTR GFP Stable Cell Line

TU058969 1.0 ml
EUR 2333

GNAI1 3'UTR Luciferase Stable Cell Line

TU008969 1.0 ml
EUR 2333

Monoclonal GNAI1 / Gi Antibody (clone 2B8-2A5), Clone: 2B8-2A5

APR16181G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human GNAI1 / Gi (clone 2B8-2A5). The antibodies are raised in Mouse and are from clone 2B8-2A5. This antibody is applicable in WB and IHC-P, E

GNAI1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV671119 1.0 ug DNA
EUR 682

GNAI1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV671123 1.0 ug DNA
EUR 682

GNAI1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV671124 1.0 ug DNA
EUR 682

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

GNAI1 Rabbit Polyclonal Antibody