GNAI1 Rabbit Polyclonal Antibody

GNAI1 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

GNAI1 Polyclonal Antibody

ABP58653-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human GNAI1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of GNAI1 from Human, Mouse, Rat. This GNAI1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GNAI1 protein

GNAI1 Polyclonal Antibody

31642-100ul 100ul
EUR 252

GNAI1 Polyclonal Antibody

31642-50ul 50ul
EUR 187

GNAI1 Rabbit pAb

A17388-100ul 100 ul Ask for price

GNAI1 Rabbit pAb

A17388-200ul 200 ul Ask for price

GNAI1 Rabbit pAb

A17388-20ul 20 ul Ask for price

GNAI1 Rabbit pAb

A17388-50ul 50 ul
EUR 384

GNAI1 Rabbit pAb

A8844-100ul 100 ul
EUR 308

GNAI1 Rabbit pAb

A8844-200ul 200 ul
EUR 459

GNAI1 Rabbit pAb

A8844-20ul 20 ul
EUR 183

GNAI1 Rabbit pAb

A8844-50ul 50 ul
EUR 223

GNAI1 Polyclonal Conjugated Antibody

C31642 100ul
EUR 397

GNAI1 Polyclonal Conjugated Antibody

C31909 100ul
EUR 397

GNAI1 antibody

70R-49798 100 ul
EUR 244
Description: Purified Polyclonal GNAI1 antibody

GNAI1 antibody

31909-100ul 100ul
EUR 252

GNAI1 antibody

31909-50ul 50ul
EUR 187

GNAI1 antibody

70R-17519 50 ul
EUR 435
Description: Rabbit polyclonal GNAI1 antibody

GNAI1 antibody

70R-2047 50 ug
EUR 467
Description: Rabbit polyclonal GNAI1 antibody

GNAI1 Antibody

1-CSB-PA009588GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GNAI1. Recognizes GNAI1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Gnai1/ Rat Gnai1 ELISA Kit

ELI-27929r 96 Tests
EUR 886

anti- GNAI1 antibody

FNab03531 100µg
EUR 505.25
  • Immunogen: guanine nucleotide binding protein(G protein), alpha inhibiting activity polypeptide 1
  • Uniprot ID: P63096
  • Gene ID: 2770
  • Research Area: Signal Transduction
Description: Antibody raised against GNAI1

Anti-GNAI1 antibody

PAab03531 100 ug
EUR 355

Anti-GNAI1 antibody

STJ119511 50 µl
EUR 393
Description: Guanine nucleotide binding proteins are heterotrimeric signal-transducing molecules consisting of alpha, beta, and gamma subunits. The alpha subunit binds guanine nucleotide, can hydrolyze GTP, and can interact with other proteins. The protein encoded by this gene represents the alpha subunit of an inhibitory complex. The encoded protein is part of a complex that responds to beta-adrenergic signals by inhibiting adenylate cyclase. Two transcript variants encoding different isoforms have been found for this gene.

Anti-GNAI1 antibody

STJ116332 100 µl
EUR 277
Description: Guanine nucleotide binding proteins are heterotrimeric signal-transducing molecules consisting of alpha, beta, and gamma subunits. The alpha subunit binds guanine nucleotide, can hydrolyze GTP, and can interact with other proteins. The protein encoded by this gene represents the alpha subunit of an inhibitory complex. The encoded protein is part of a complex that responds to beta-adrenergic signals by inhibiting adenylate cyclase. Two transcript variants encoding different isoforms have been found for this gene.

Anti-GNAI1 antibody

STJ193040 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GNAI1

GNAI1 siRNA

20-abx902212
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNAI1 Protein

20-abx262917
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

GNAI1 siRNA

20-abx918142
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNAI1 siRNA

20-abx918143
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNAI1 cloning plasmid

CSB-CL009588HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1065
  • Sequence: atgggctgcacgctgagcgccgaggacaaggcggcggtggagcggagtaagatgatcgaccgcaacctccgtgaggacggcgagaaggcggcgcgcgaggtcaagctgctgctgctcggtgctggtgaatctggtaaaagtacaattgtgaagcagatgaaaattatccatgaag
  • Show more
Description: A cloning plasmid for the GNAI1 gene.

GNAI1 Blocking Peptide

20-abx062673
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

GNAI1 Blocking Peptide

33R-10215 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAI1 antibody, catalog no. 70R-2047

pBluescriptR-GNAI1 Plasmid

PVT17029 2 ug
EUR 325

Rat GNAI1 shRNA Plasmid

20-abx985222
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Chicken GNAI1 ELISA KIT

ELI-08736c 96 Tests
EUR 928

Bovine GNAI1 ELISA KIT

ELI-27342b 96 Tests
EUR 928

GNAI1 ELISA KIT|Human

EF009906 96 Tests
EUR 689

Mouse Gnai1 ELISA KIT

ELI-43677m 96 Tests
EUR 865

Human GNAI1 ELISA KIT

ELI-38025h 96 Tests
EUR 824

GNAI1 protein (His tag)

80R-1980 50 ug
EUR 322
Description: Recombinant human GNAI1 protein (His tag)

Mouse GNAI1 shRNA Plasmid

20-abx970574
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GNAI1 shRNA Plasmid

20-abx951841
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GNAI1 Recombinant Protein (Human)

RP013462 100 ug Ask for price

GNAI1 Recombinant Protein (Rat)

RP202943 100 ug Ask for price

GNAI1 Recombinant Protein (Mouse)

RP138896 100 ug Ask for price

GNAI1 ORF Vector (Human) (pORF)

ORF004488 1.0 ug DNA
EUR 95

Gnai1 ORF Vector (Rat) (pORF)

ORF067649 1.0 ug DNA
EUR 506

Gnai1 ORF Vector (Mouse) (pORF)

ORF046300 1.0 ug DNA
EUR 506

guanine nucleotide binding protein alpha inhibiting activity polypeptide 1 (GNAI1) polyclonal antibody

ABP-PAB-11315 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:

Monoclonal GNAI1 / Gi Antibody (clone R4.5), Clone: R4.5

APR16182G 0.05ml
EUR 484
Description: A Monoclonal antibody against Human GNAI1 / Gi (clone R4.5). The antibodies are raised in Mouse and are from clone R4.5. This antibody is applicable in WB and IHC-P

Monoclonal GNAI1 Antibody (monoclonal) (M01), Clone: 2B8-2A5

APR16183G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human GNAI1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2B8-2A5. This antibody is applicable in WB and IHC, E

GNAI1 sgRNA CRISPR Lentivector set (Human)

K0874501 3 x 1.0 ug
EUR 339

Gnai1 sgRNA CRISPR Lentivector set (Mouse)

K3829301 3 x 1.0 ug
EUR 339

Gnai1 sgRNA CRISPR Lentivector set (Rat)

K6775801 3 x 1.0 ug
EUR 339

GNAI1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0874502 1.0 ug DNA
EUR 154

GNAI1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0874503 1.0 ug DNA
EUR 154

GNAI1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0874504 1.0 ug DNA
EUR 154

Gnai1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3829302 1.0 ug DNA
EUR 154

Gnai1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3829303 1.0 ug DNA
EUR 154

Gnai1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3829304 1.0 ug DNA
EUR 154

Gnai1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6775802 1.0 ug DNA
EUR 154

Gnai1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6775803 1.0 ug DNA
EUR 154

Gnai1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6775804 1.0 ug DNA
EUR 154

Recombinant Human GNAI1 Protein, His, E.coli-10ug

QP12009-10ug 10ug
EUR 201

Recombinant Human GNAI1 Protein, His, E.coli-1mg

QP12009-1mg 1mg
EUR 5251

Recombinant Human GNAI1 Protein, His, E.coli-2ug

QP12009-2ug 2ug
EUR 155

GNAI1 Protein Vector (Rat) (pPB-C-His)

PV270594 500 ng
EUR 603

GNAI1 Protein Vector (Rat) (pPB-N-His)

PV270595 500 ng
EUR 603

GNAI1 Protein Vector (Rat) (pPM-C-HA)

PV270596 500 ng
EUR 603

GNAI1 Protein Vector (Rat) (pPM-C-His)

PV270597 500 ng
EUR 603

GNAI1 Protein Vector (Mouse) (pPB-C-His)

PV185198 500 ng
EUR 603

GNAI1 Protein Vector (Mouse) (pPB-N-His)

PV185199 500 ng
EUR 603

GNAI1 Protein Vector (Mouse) (pPM-C-HA)

PV185200 500 ng
EUR 603

GNAI1 Protein Vector (Mouse) (pPM-C-His)

PV185201 500 ng
EUR 603

GNAI1 Protein Vector (Human) (pPB-C-His)

PV017949 500 ng
EUR 329

GNAI1 Protein Vector (Human) (pPB-N-His)

PV017950 500 ng
EUR 329

GNAI1 Protein Vector (Human) (pPM-C-HA)

PV017951 500 ng
EUR 329

GNAI1 Protein Vector (Human) (pPM-C-His)

PV017952 500 ng
EUR 329

Gnai1 3'UTR Luciferase Stable Cell Line

TU205205 1.0 ml Ask for price

Gnai1 3'UTR GFP Stable Cell Line

TU158846 1.0 ml Ask for price

GNAI1 3'UTR Luciferase Stable Cell Line

TU008969 1.0 ml
EUR 2333

Gnai1 3'UTR Luciferase Stable Cell Line

TU108846 1.0 ml Ask for price

GNAI1 3'UTR GFP Stable Cell Line

TU058969 1.0 ml
EUR 2333

Gnai1 3'UTR GFP Stable Cell Line

TU255205 1.0 ml Ask for price

Monoclonal GNAI1 / Gi Antibody (clone 2B8-2A5), Clone: 2B8-2A5

APR16181G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human GNAI1 / Gi (clone 2B8-2A5). The antibodies are raised in Mouse and are from clone 2B8-2A5. This antibody is applicable in WB and IHC-P, E

GNAI1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV671119 1.0 ug DNA
EUR 682

GNAI1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV671123 1.0 ug DNA
EUR 682

GNAI1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV671124 1.0 ug DNA
EUR 682

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody

ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody

ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody

ABP57570-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody

ABP57570-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody

ABP57570-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK3 Rabbit Polyclonal Antibody

ABP57572-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody

ABP57572-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody

ABP57572-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

MEK2 Rabbit Polyclonal Antibody

ABP57573-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody

ABP57573-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody

ABP57573-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK3 Rabbit Polyclonal Antibody

ABP57574-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody

ABP57574-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody

ABP57574-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

Nrf2 Rabbit Polyclonal Antibody

ABP57575-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody

ABP57575-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody

ABP57575-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

ATG4a Rabbit Polyclonal Antibody

ABP57576-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG4a
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody

ABP57576-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG4a
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody

ABP57576-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG4a
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4b Rabbit Polyclonal Antibody

ABP57577-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG4b
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4b Rabbit Polyclonal Antibody

ABP57577-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG4b
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

GNAI1 Rabbit Polyclonal Antibody