GRM3 Rabbit Polyclonal Antibody

GRM3 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

GRM3 Polyclonal Antibody
ABP58720-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human GRM3 protein at amino acid sequence of 40-120 Applications tips:
Description: A polyclonal antibody for detection of GRM3 from Human, Mouse, Rat. This GRM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GRM3 protein at amino acid sequence of 40-120

GRM3 Polyclonal Antibody
ABP58720-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human GRM3 protein at amino acid sequence of 40-120 Applications tips:
Description: A polyclonal antibody for detection of GRM3 from Human, Mouse, Rat. This GRM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GRM3 protein at amino acid sequence of 40-120

GRM3 Polyclonal Antibody
ES11733-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against GRM3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

GRM3 Polyclonal Antibody
ES11733-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against GRM3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

GRM3 Rabbit pAb
A2538-100ul	Abclonal	100 ul	EUR 308

GRM3 Rabbit pAb
A2538-200ul	Abclonal	200 ul	EUR 459

GRM3 Rabbit pAb
A2538-20ul	Abclonal	20 ul	EUR 183

GRM3 Rabbit pAb
A2538-50ul	Abclonal	50 ul	EUR 223

GRM3 Antibody
32700-100ul	SAB	100ul	EUR 252

GRM3 Antibody
1-CSB-PA074225	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GRM3. Recognizes GRM3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000

GRM3 Antibody
1-CSB-PA904462	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GRM3. Recognizes GRM3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

GRM3 Antibody
DF6995	Affbiotech	200ul	EUR 304
Description: GRM3 Antibody detects endogenous levels of total GRM3.

GRM3 Antibody
1-CSB-PA449040	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GRM3. Recognizes GRM3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

GRM3 Antibody
1-CSB-PA180654	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GRM3. Recognizes GRM3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000

GRM3 Antibody
CSB-PA203777-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against GRM3. Recognizes GRM3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

GRM3 Antibody
CSB-PA203777-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against GRM3. Recognizes GRM3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

GRM3 Antibody
ABD6995	Lifescience Market	100 ug	EUR 438

Polyclonal GRM3 / MGLUR3 Antibody (N-Terminus)
APR12295G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GRM3 / MGLUR3 (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal GRM3 / MGLUR3 Antibody (N-Terminus)
APR12296G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GRM3 / MGLUR3 (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal GRM3 / MGLUR3 Antibody (N-Terminus)
APR12297G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GRM3 / MGLUR3 (N-Terminus). This antibody is tested and proven to work in the following applications:

GRM3 Conjugated Antibody
C32700	SAB	100ul	EUR 397

GRM2/GRM3 Antibody
1-CSB-PA009022	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GRM2/GRM3. Recognizes GRM2/GRM3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

GRM2 / GRM3 Antibody
20-abx328584	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Anti-GRM3 antibody
STJ192891	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to GRM3

Anti-GRM3 antibody
STJ23873	St John's Laboratory	100 µl	EUR 277
Description: L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities.

Grm3/ Rat Grm3 ELISA Kit
ELI-31362r	Lifescience Market	96 Tests	EUR 886

GRM3 siRNA
20-abx902332	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GRM3 siRNA
20-abx918729	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GRM3 siRNA
20-abx918730	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-GRM3
YF-PA23829	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to GRM3

GRM3 Blocking Peptide
DF6995-BP	Affbiotech	1mg	EUR 195

GRM3 cloning plasmid
CSB-CL622790HU-10ug	Cusabio	10ug	EUR 849
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2640 Sequence: atgaagatgttgacaagactgcaagttcttaccttagctttgttttcaaagggatttttactctctttaggggaccataactttctaaggagagagattaaaatagaaggtgaccttgttttagggggcctgtttcctattaacgaaaaaggcactggaactgaagaatgtgggc Show more
Description: A cloning plasmid for the GRM3 gene.

Rabbit Metabotropic glutamate receptor 3(GRM3) ELISA kit
E04M0095-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Metabotropic glutamate receptor 3(GRM3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Metabotropic glutamate receptor 3(GRM3) ELISA kit
E04M0095-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Metabotropic glutamate receptor 3(GRM3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Metabotropic glutamate receptor 3(GRM3) ELISA kit
E04M0095-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Metabotropic glutamate receptor 3(GRM3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Glutamate Receptor, Metabotropic 3 (GRM3) Antibody
20-abx214716	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Glutamate Receptor, Metabotropic 3 (GRM3) Antibody
20-abx214717	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Glutamate Receptor, Metabotropic 3 (GRM3) Antibody
20-abx128408	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Glutamate Receptor, Metabotropic 3 (GRM3) Antibody
20-abx241530	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Glutamate Receptor, Metabotropic 3 (GRM3) Antibody
20-abx241531	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Glutamate Receptor, Metabotropic 3 (GRM3) Antibody
abx340203-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Glutamate Receptor, Metabotropic 3 (GRM3) Antibody
abx332430-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Glutamate Receptor, Metabotropic 3 (GRM3) Antibody
20-abx001976	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Rat GRM3 shRNA Plasmid
20-abx984482	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GRM3 shRNA Plasmid
20-abx951966	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse GRM3 shRNA Plasmid
20-abx979873	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Glutamate Receptor, Metabotropic 3 (GRM3) Polyclonal Antibody (Human, Rat, Pig)
4-PAB891Hu01	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GRM3 (Asp568~Phe819) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Glutamate Receptor, Metabotropic 3 (GRM3)

Glutamate Receptor, Metabotropic 3 (GRM3) Polyclonal Antibody (Human, Rat, Pig), APC
4-PAB891Hu01-APC	Cloud-Clone	EUR 333.00 EUR 3113.00 EUR 872.00 EUR 423.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GRM3 (Asp568~Phe819) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Glutamate Receptor, Metabotropic 3 (GRM3). This antibody is labeled with APC.

Glutamate Receptor, Metabotropic 3 (GRM3) Polyclonal Antibody (Human, Rat, Pig), Biotinylated
4-PAB891Hu01-Biotin	Cloud-Clone	EUR 303.00 EUR 2341.00 EUR 697.00 EUR 369.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GRM3 (Asp568~Phe819) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Glutamate Receptor, Metabotropic 3 (GRM3). This antibody is labeled with Biotin.

Glutamate Receptor, Metabotropic 3 (GRM3) Polyclonal Antibody (Human, Rat, Pig), Cy3
4-PAB891Hu01-Cy3	Cloud-Clone	EUR 403.00 EUR 4109.00 EUR 1121.00 EUR 523.00 EUR 245.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GRM3 (Asp568~Phe819) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Glutamate Receptor, Metabotropic 3 (GRM3). This antibody is labeled with Cy3.

GRM3 Rabbit Polyclonal Antibody