GRM3 Rabbit Polyclonal Antibody
To Order Now: info@poweratlas.org
GRM3 Polyclonal Antibody |
ABP58720-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human GRM3 protein at amino acid sequence of 40-120
- Applications tips:
|
Description: A polyclonal antibody for detection of GRM3 from Human, Mouse, Rat. This GRM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GRM3 protein at amino acid sequence of 40-120 |
GRM3 Polyclonal Antibody |
ABP58720-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human GRM3 protein at amino acid sequence of 40-120
- Applications tips:
|
Description: A polyclonal antibody for detection of GRM3 from Human, Mouse, Rat. This GRM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GRM3 protein at amino acid sequence of 40-120 |
GRM3 Polyclonal Antibody |
ES11733-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against GRM3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
GRM3 Polyclonal Antibody |
ES11733-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against GRM3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
GRM3 Rabbit pAb |
A2538-100ul |
Abclonal |
100 ul |
EUR 308 |
GRM3 Rabbit pAb |
A2538-200ul |
Abclonal |
200 ul |
EUR 459 |
GRM3 Rabbit pAb |
A2538-20ul |
Abclonal |
20 ul |
EUR 183 |
GRM3 Rabbit pAb |
A2538-50ul |
Abclonal |
50 ul |
EUR 223 |
GRM3 Antibody |
32700-100ul |
SAB |
100ul |
EUR 252 |
GRM3 Antibody |
1-CSB-PA074225 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against GRM3. Recognizes GRM3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000 |
GRM3 Antibody |
1-CSB-PA904462 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against GRM3. Recognizes GRM3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
GRM3 Antibody |
DF6995 |
Affbiotech |
200ul |
EUR 304 |
Description: GRM3 Antibody detects endogenous levels of total GRM3. |
GRM3 Antibody |
1-CSB-PA449040 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against GRM3. Recognizes GRM3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
GRM3 Antibody |
1-CSB-PA180654 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against GRM3. Recognizes GRM3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000 |
GRM3 Antibody |
CSB-PA203777- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against GRM3. Recognizes GRM3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100 |
GRM3 Antibody |
CSB-PA203777-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against GRM3. Recognizes GRM3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100 |
Polyclonal GRM3 / MGLUR3 Antibody (N-Terminus) |
APR12295G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GRM3 / MGLUR3 (N-Terminus). This antibody is tested and proven to work in the following applications: |
Polyclonal GRM3 / MGLUR3 Antibody (N-Terminus) |
APR12296G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GRM3 / MGLUR3 (N-Terminus). This antibody is tested and proven to work in the following applications: |
Polyclonal GRM3 / MGLUR3 Antibody (N-Terminus) |
APR12297G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GRM3 / MGLUR3 (N-Terminus). This antibody is tested and proven to work in the following applications: |
GRM3 Conjugated Antibody |
C32700 |
SAB |
100ul |
EUR 397 |
GRM2/GRM3 Antibody |
1-CSB-PA009022 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against GRM2/GRM3. Recognizes GRM2/GRM3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000 |
GRM2 / GRM3 Antibody |
20-abx328584 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Anti-GRM3 antibody |
STJ192891 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to GRM3 |
Anti-GRM3 antibody |
STJ23873 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. |
GRM3 siRNA |
20-abx902332 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GRM3 siRNA |
20-abx918729 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GRM3 siRNA |
20-abx918730 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-GRM3 |
YF-PA23829 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to GRM3 |
GRM3 Blocking Peptide |
DF6995-BP |
Affbiotech |
1mg |
EUR 195 |
GRM3 cloning plasmid |
CSB-CL622790HU-10ug |
Cusabio |
10ug |
EUR 849 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2640
- Sequence: atgaagatgttgacaagactgcaagttcttaccttagctttgttttcaaagggatttttactctctttaggggaccataactttctaaggagagagattaaaatagaaggtgaccttgttttagggggcctgtttcctattaacgaaaaaggcactggaactgaagaatgtgggc
- Show more
|
Description: A cloning plasmid for the GRM3 gene. |
Rabbit Metabotropic glutamate receptor 3(GRM3) ELISA kit |
E04M0095-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Metabotropic glutamate receptor 3(GRM3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Metabotropic glutamate receptor 3(GRM3) ELISA kit |
E04M0095-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Metabotropic glutamate receptor 3(GRM3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Metabotropic glutamate receptor 3(GRM3) ELISA kit |
E04M0095-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Metabotropic glutamate receptor 3(GRM3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Glutamate Receptor, Metabotropic 3 (GRM3) Antibody |
20-abx214716 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Glutamate Receptor, Metabotropic 3 (GRM3) Antibody |
20-abx214717 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Glutamate Receptor, Metabotropic 3 (GRM3) Antibody |
20-abx128408 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1149.00
-
EUR 565.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Glutamate Receptor, Metabotropic 3 (GRM3) Antibody |
20-abx241530 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Glutamate Receptor, Metabotropic 3 (GRM3) Antibody |
20-abx241531 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Glutamate Receptor, Metabotropic 3 (GRM3) Antibody |
abx340203-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Glutamate Receptor, Metabotropic 3 (GRM3) Antibody |
abx332430-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Glutamate Receptor, Metabotropic 3 (GRM3) Antibody |
20-abx001976 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Rat GRM3 shRNA Plasmid |
20-abx984482 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human GRM3 shRNA Plasmid |
20-abx951966 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse GRM3 shRNA Plasmid |
20-abx979873 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Glutamate Receptor, Metabotropic 3 (GRM3) Polyclonal Antibody (Human, Rat, Pig) |
4-PAB891Hu01 |
Cloud-Clone |
-
EUR 239.00
-
EUR 2391.00
-
EUR 598.00
-
EUR 299.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GRM3 (Asp568~Phe819)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Glutamate Receptor, Metabotropic 3 (GRM3) |
Glutamate Receptor, Metabotropic 3 (GRM3) Polyclonal Antibody (Human, Rat, Pig), APC |
4-PAB891Hu01-APC |
Cloud-Clone |
-
EUR 333.00
-
EUR 3113.00
-
EUR 872.00
-
EUR 423.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GRM3 (Asp568~Phe819)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Glutamate Receptor, Metabotropic 3 (GRM3). This antibody is labeled with APC. |
Glutamate Receptor, Metabotropic 3 (GRM3) Polyclonal Antibody (Human, Rat, Pig), Biotinylated |
4-PAB891Hu01-Biotin |
Cloud-Clone |
-
EUR 303.00
-
EUR 2341.00
-
EUR 697.00
-
EUR 369.00
-
EUR 216.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GRM3 (Asp568~Phe819)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Glutamate Receptor, Metabotropic 3 (GRM3). This antibody is labeled with Biotin. |
Glutamate Receptor, Metabotropic 3 (GRM3) Polyclonal Antibody (Human, Rat, Pig), Cy3 |
4-PAB891Hu01-Cy3 |
Cloud-Clone |
-
EUR 403.00
-
EUR 4109.00
-
EUR 1121.00
-
EUR 523.00
-
EUR 245.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GRM3 (Asp568~Phe819)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Glutamate Receptor, Metabotropic 3 (GRM3). This antibody is labeled with Cy3. |
GRM3 Rabbit Polyclonal Antibody