GRM3 Rabbit Polyclonal Antibody

GRM3 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

GRM3 Polyclonal Antibody
ABP58720-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human GRM3 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of GRM3 from Human, Mouse, Rat. This GRM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GRM3 protein at amino acid sequence of 40-120
GRM3 Polyclonal Antibody
ABP58720-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human GRM3 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of GRM3 from Human, Mouse, Rat. This GRM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GRM3 protein at amino acid sequence of 40-120
GRM3 Polyclonal Antibody
ES11733-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GRM3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
GRM3 Polyclonal Antibody
ES11733-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GRM3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
GRM3 Rabbit pAb
A2538-100ul 100 ul
EUR 308
GRM3 Rabbit pAb
A2538-200ul 200 ul
EUR 459
GRM3 Rabbit pAb
A2538-20ul 20 ul
EUR 183
GRM3 Rabbit pAb
A2538-50ul 50 ul
EUR 223
GRM3 Antibody
32700-100ul 100ul
EUR 252
GRM3 Antibody
1-CSB-PA074225
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GRM3. Recognizes GRM3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000
GRM3 Antibody
1-CSB-PA904462
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GRM3. Recognizes GRM3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200
GRM3 Antibody
DF6995 200ul
EUR 304
Description: GRM3 Antibody detects endogenous levels of total GRM3.
GRM3 Antibody
1-CSB-PA449040
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GRM3. Recognizes GRM3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200
GRM3 Antibody
1-CSB-PA180654
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GRM3. Recognizes GRM3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000
GRM3 Antibody
CSB-PA203777-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against GRM3. Recognizes GRM3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100
GRM3 Antibody
CSB-PA203777-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against GRM3. Recognizes GRM3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100
GRM3 Antibody
ABD6995 100 ug
EUR 438
Polyclonal GRM3 / MGLUR3 Antibody (N-Terminus)
APR12295G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GRM3 / MGLUR3 (N-Terminus). This antibody is tested and proven to work in the following applications:
Polyclonal GRM3 / MGLUR3 Antibody (N-Terminus)
APR12296G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GRM3 / MGLUR3 (N-Terminus). This antibody is tested and proven to work in the following applications:
Polyclonal GRM3 / MGLUR3 Antibody (N-Terminus)
APR12297G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GRM3 / MGLUR3 (N-Terminus). This antibody is tested and proven to work in the following applications:
GRM3 Conjugated Antibody
C32700 100ul
EUR 397
GRM2/GRM3 Antibody
1-CSB-PA009022
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GRM2/GRM3. Recognizes GRM2/GRM3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000
GRM2 / GRM3 Antibody
20-abx328584
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Anti-GRM3 antibody
STJ192891 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GRM3
Anti-GRM3 antibody
STJ23873 100 µl
EUR 277
Description: L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities.
Grm3/ Rat Grm3 ELISA Kit
ELI-31362r 96 Tests
EUR 886
GRM3 siRNA
20-abx902332
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
GRM3 siRNA
20-abx918729
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
GRM3 siRNA
20-abx918730
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-GRM3
YF-PA23829 50 ul
EUR 334
Description: Mouse polyclonal to GRM3
GRM3 Blocking Peptide
DF6995-BP 1mg
EUR 195
GRM3 cloning plasmid
CSB-CL622790HU-10ug 10ug
EUR 849
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2640
  • Sequence: atgaagatgttgacaagactgcaagttcttaccttagctttgttttcaaagggatttttactctctttaggggaccataactttctaaggagagagattaaaatagaaggtgaccttgttttagggggcctgtttcctattaacgaaaaaggcactggaactgaagaatgtgggc
  • Show more
Description: A cloning plasmid for the GRM3 gene.
Rabbit Metabotropic glutamate receptor 3(GRM3) ELISA kit
E04M0095-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Metabotropic glutamate receptor 3(GRM3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Metabotropic glutamate receptor 3(GRM3) ELISA kit
E04M0095-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Metabotropic glutamate receptor 3(GRM3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Metabotropic glutamate receptor 3(GRM3) ELISA kit
E04M0095-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Metabotropic glutamate receptor 3(GRM3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat GRM3 shRNA Plasmid
20-abx984482
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human GRM3 shRNA Plasmid
20-abx951966
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse GRM3 shRNA Plasmid
20-abx979873
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Glutamate Receptor, Metabotropic 3 (GRM3) Antibody
20-abx214716
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Glutamate Receptor, Metabotropic 3 (GRM3) Antibody
20-abx214717
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Glutamate Receptor, Metabotropic 3 (GRM3) Antibody
20-abx128408
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Glutamate Receptor, Metabotropic 3 (GRM3) Antibody
20-abx241530
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Glutamate Receptor, Metabotropic 3 (GRM3) Antibody
20-abx241531
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Glutamate Receptor, Metabotropic 3 (GRM3) Antibody
abx340203-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Glutamate Receptor, Metabotropic 3 (GRM3) Antibody
abx332430-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
Glutamate Receptor, Metabotropic 3 (GRM3) Antibody
20-abx001976
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Glutamate Receptor, Metabotropic 3 (GRM3) Polyclonal Antibody (Human, Rat, Pig)
4-PAB891Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRM3 (Asp568~Phe819)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Glutamate Receptor, Metabotropic 3 (GRM3)
Glutamate Receptor, Metabotropic 3 (GRM3) Polyclonal Antibody (Human, Rat, Pig), APC
4-PAB891Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRM3 (Asp568~Phe819)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Glutamate Receptor, Metabotropic 3 (GRM3). This antibody is labeled with APC.
Glutamate Receptor, Metabotropic 3 (GRM3) Polyclonal Antibody (Human, Rat, Pig), Biotinylated
4-PAB891Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRM3 (Asp568~Phe819)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Glutamate Receptor, Metabotropic 3 (GRM3). This antibody is labeled with Biotin.
Glutamate Receptor, Metabotropic 3 (GRM3) Polyclonal Antibody (Human, Rat, Pig), Cy3
4-PAB891Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRM3 (Asp568~Phe819)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Glutamate Receptor, Metabotropic 3 (GRM3). This antibody is labeled with Cy3.

GRM3 Rabbit Polyclonal Antibody