GSTM1 Rabbit Polyclonal Antibody

GSTM1 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

GSTM1 Polyclonal Antibody

ABP58729-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human GSTM1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of GSTM1 from Human, Mouse, Rat. This GSTM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GSTM1 protein

GSTM1 Polyclonal Antibody

ABP58729-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human GSTM1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of GSTM1 from Human, Mouse, Rat. This GSTM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GSTM1 protein

GSTM1 Polyclonal Antibody

ABP58729-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human GSTM1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of GSTM1 from Human, Mouse, Rat. This GSTM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GSTM1 protein

GSTM1 Polyclonal Antibody

30053-100ul 100ul
EUR 252

GSTM1 Polyclonal Antibody

30053-50ul 50ul
EUR 187

GSTM1 Rabbit pAb

A17492-100ul 100 ul
EUR 308

GSTM1 Rabbit pAb

A17492-200ul 200 ul
EUR 459

GSTM1 Rabbit pAb

A17492-20ul 20 ul
EUR 183

GSTM1 Rabbit pAb

A17492-50ul 50 ul
EUR 223

GSTM1 Rabbit pAb

A8819-100ul 100 ul
EUR 308

GSTM1 Rabbit pAb

A8819-200ul 200 ul
EUR 459

GSTM1 Rabbit pAb

A8819-20ul 20 ul Ask for price

GSTM1 Rabbit pAb

A8819-50ul 50 ul Ask for price

Polyclonal GSTM1 / MU Antibody

AMM05244G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GSTM1 / MU . This antibody is tested and proven to work in the following applications:

GSTM1 Polyclonal Conjugated Antibody

C30053 100ul
EUR 397

Human Glutathione S Transferase Mu 1 (GSTm1) ELISA Kit

DLR-GSTm1-Hu-48T 48T
EUR 479
  • Should the Human Glutathione S Transferase Mu 1 (GSTm1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glutathione S Transferase Mu 1 (GSTm1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Glutathione S Transferase Mu 1 (GSTm1) ELISA Kit

DLR-GSTm1-Hu-96T 96T
EUR 621
  • Should the Human Glutathione S Transferase Mu 1 (GSTm1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glutathione S Transferase Mu 1 (GSTm1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Glutathione S Transferase Mu 1 (GSTm1) ELISA Kit

RD-GSTm1-Hu-48Tests 48 Tests
EUR 478

Human Glutathione S Transferase Mu 1 (GSTm1) ELISA Kit

RD-GSTm1-Hu-96Tests 96 Tests
EUR 662

Human Glutathione S Transferase Mu 1 (GSTm1) ELISA Kit

RDR-GSTm1-Hu-48Tests 48 Tests
EUR 500

Human Glutathione S Transferase Mu 1 (GSTm1) ELISA Kit

RDR-GSTm1-Hu-96Tests 96 Tests
EUR 692

Polyclonal GSTM1 Antibody (C-term)

AMM05246G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GSTM1 (C-term). This antibody is tested and proven to work in the following applications:

GSTM1 Antibody

BF0243 200ul
EUR 376
Description: GSTM1 antibody detects endogenous levels of total GSTM1.

GSTM1 antibody

70R-49833 100 ul
EUR 244
Description: Purified Polyclonal GSTM1 antibody

GSTM1 antibody

70R-5348 50 ug
EUR 467
Description: Rabbit polyclonal GSTM1 antibody raised against the N terminal of GSTM1

GSTM1 antibody

70R-8515 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal GSTM1 antibody

GSTM1 antibody

10R-10423 100 ug
EUR 435
Description: Mouse monoclonal GSTM1 antibody

GSTM1 antibody

23009-100ul 100ul
EUR 390

GSTM1 antibody

70R-17626 50 ul
EUR 435
Description: Rabbit polyclonal GSTM1 antibody

GSTM1 antibody

70R-13538 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal GSTM1 antibody

GSTM1 Antibody

1-CSB-PA009979GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GSTM1. Recognizes GSTM1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

GSTM1 Antibody

1-CSB-PA009979LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GSTM1. Recognizes GSTM1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

GSTM1 antibody

PAab09906 100 ug
EUR 386

GSTM1 antibody

PAab09966 100 ug
EUR 386

Polyclonal Goat Anti-GSTM1 / GSTM2 Antibody

AMM05005G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-GSTM1 / GSTM2 . This antibody is tested and proven to work in the following applications:

Polyclonal GSTM1 antibody - N-terminal region

AMM05248G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GSTM1 - N-terminal region. This antibody is tested and proven to work in the following applications:

anti- GSTM1 antibody

FNab09906 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:50-1:200
  • Immunogen: glutathione S-transferase mu 1
  • Uniprot ID: P09488
  • Gene ID: 2944
  • Research Area: Metabolism
Description: Antibody raised against GSTM1

anti- GSTM1 antibody

FNab09966 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • Immunogen: glutathione S-transferase mu 1
  • Uniprot ID: P09488
  • Gene ID: 2944
  • Research Area: Metabolism
Description: Antibody raised against GSTM1

anti- GSTM1 antibody

FNab03692 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:50-1:500
  • IF: 1:50-1:500
  • Immunogen: glutathione S-transferase mu 1
  • Uniprot ID: P09488
  • Gene ID: 2944
  • Research Area: Metabolism
Description: Antibody raised against GSTM1

Anti-GSTM1 Antibody

A00569-1 100ug/vial
EUR 294

Mouse GSTM1 Antibody

32935-05111 150 ug
EUR 261

Anti-GSTM1 antibody

PAab03692 100 ug
EUR 386

anti- GSTM1 antibody

LSMab09906 100 ug
EUR 386

anti- GSTM1 antibody

LSMab09966 100 ug
EUR 386

Anti-GSTM1 antibody

STJ111433 100 µl
EUR 277
Description: Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. Null mutations of this class mu gene have been linked with an increase in a number of cancers, likely due to an increased susceptibility to environmental toxins and carcinogens. Multiple protein isoforms are encoded by transcript variants of this gene.

Anti-GSTM1 antibody

STJ119590 100 µl
EUR 277
Description: Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. Null mutations of this class mu gene have been linked with an increase in a number of cancers, likely due to an increased susceptibility to environmental toxins and carcinogens. Multiple protein isoforms are encoded by transcript variants of this gene. [provided by RefSeq, Jul 2008]

Anti-GSTM1 antibody

STJ193063 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GSTM1

Gstm1/ Rat Gstm1 ELISA Kit

ELI-48471r 96 Tests
EUR 886

GSTM1 siRNA

20-abx902353
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GSTM1 siRNA

20-abx918818
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GSTM1 siRNA

20-abx918819
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GSTM1 protein

30R-1261 100 ug
EUR 300
Description: Purified recombinant Mouse GSTM1 protein

GSTM1 Antibody, HRP conjugated

1-CSB-PA009979LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GSTM1. Recognizes GSTM1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GSTM1 Antibody, FITC conjugated

1-CSB-PA009979LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GSTM1. Recognizes GSTM1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GSTM1 Antibody, Biotin conjugated

1-CSB-PA009979LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GSTM1. Recognizes GSTM1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-GSTM1 / GSTM2 antibody

STJ70642 100 µg
EUR 359

GSTM1 Blocking Peptide

BF0243-BP 1mg
EUR 195

GSTM1 cloning plasmid

CSB-CL009979HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 546
  • Sequence: atgcccatgatactggggtactgggacatccgcgggctggcccacgccatccgcctgctcctggaatacacagactcaagctatgaggaaaagaagtacacgatgggggacgctcctgattatgacagaagccagtggctgaatgaaaaattcaagctgggcctggactttcccaa
  • Show more
Description: A cloning plasmid for the GSTM1 gene.

GSTM1 Blocking Peptide

20-abx062708
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

GSTM1 Blocking Peptide

33R-4498 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GSTM1 antibody, catalog no. 70R-5348

GSTM1 Blocking Peptide

33R-7049 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GSTM1 antibody, catalog no. 70R-8515

anti-GSTM1 (1H4A4)

LF-MA30658 100 ul
EUR 527
Description: Mouse Monoclonal to GSTM1

anti-GSTM1 (1H4F2)

LF-MA30659 100 ul
EUR 527
Description: Mouse Monoclonal to GSTM1

Anti-GSTM1 (3B10)

YF-MA13347 100 ug
EUR 363
Description: Mouse monoclonal to GSTM1

Monoclonal GSTM1 Antibody, Clone: 1H4F2

APR16645G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human GSTM1. The antibodies are raised in Mouse and are from clone 1H4F2. This antibody is applicable in WB and IHC, FC, E

Mouse GSTM1 Antibody (Biotin Conjugate)

32935-05121 150 ug
EUR 369

Anti-GSTM1 Antibody (monoclonal, 11F2)

M00569 100ug/vial
EUR 334

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Chicken)

4-PAA658Ga01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Glu220)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Glutathione S Transferase Mu 1 (GSTm1)

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Mouse)

4-PAA658Mu01
  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Lys218)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 1 (GSTm1)

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Rat)

4-PAA658Ra01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Ly218)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 1 (GSTm1)

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Chicken), APC

4-PAA658Ga01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Glu220)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with APC.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Chicken), Biotinylated

4-PAA658Ga01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Glu220)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with Biotin.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Chicken), Cy3

4-PAA658Ga01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Glu220)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with Cy3.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Chicken), FITC

4-PAA658Ga01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Glu220)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with FITC.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Chicken), HRP

4-PAA658Ga01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Glu220)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with HRP.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Chicken), PE

4-PAA658Ga01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Glu220)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with PE.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Mouse), APC

4-PAA658Mu01-APC
  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Lys218)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with APC.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Mouse), Biotinylated

4-PAA658Mu01-Biotin
  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Lys218)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with Biotin.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Mouse), Cy3

4-PAA658Mu01-Cy3
  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Lys218)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with Cy3.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Mouse), FITC

4-PAA658Mu01-FITC
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Lys218)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with FITC.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Mouse), HRP

4-PAA658Mu01-HRP
  • EUR 302.00
  • EUR 2652.00
  • EUR 756.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Lys218)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with HRP.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Mouse), PE

4-PAA658Mu01-PE
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Lys218)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with PE.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Rat), APC

4-PAA658Ra01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Ly218)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with APC.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Rat), Biotinylated

4-PAA658Ra01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Ly218)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with Biotin.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Rat), Cy3

4-PAA658Ra01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Ly218)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with Cy3.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Rat), FITC

4-PAA658Ra01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Ly218)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with FITC.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Rat), HRP

4-PAA658Ra01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Ly218)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with HRP.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Rat), PE

4-PAA658Ra01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Ly218)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with PE.

Mouse GSTM1 AssayLite Antibody (FITC Conjugate)

32935-05141 150 ug
EUR 428

Mouse GSTM1 AssayLite Antibody (APC Conjugate)

32935-05151 150 ug
EUR 428

Mouse GSTM1 AssayLite Antibody (RPE Conjugate)

32935-05161 150 ug
EUR 428

Mouse GSTM1 AssayLite Antibody (PerCP Conjugate)

32935-05171 150 ug
EUR 471

Rat GSTM1 shRNA Plasmid

20-abx984488
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GSTM1 ELISA KIT|Human

EF010014 96 Tests
EUR 689

GSTM1 protein (His tag)

80R-3744 50 ug
EUR 327
Description: Purified recombinant GSTM1 protein (His tag)

Mouse GSTM1 shRNA Plasmid

20-abx970689
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GSTM1 shRNA Plasmid

20-abx951990
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GSTM1 Recombinant Protein (Human)

RP014125 100 ug Ask for price

GSTM1 Recombinant Protein (Rat)

RP203849 100 ug Ask for price

GSTM1 Recombinant Protein (Mouse)

RP140252 100 ug Ask for price

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Chicken), APC-Cy7

4-PAA658Ga01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Glu220)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with APC-Cy7.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Human, Mouse, Rat)

4-PAA658Hu01
  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Lys218)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Glutathione S Transferase Mu 1 (GSTm1)

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Mouse), APC-Cy7

4-PAA658Mu01-APC-Cy7
  • EUR 538.00
  • EUR 5962.00
  • EUR 1588.00
  • EUR 713.00
  • EUR 304.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Lys218)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with APC-Cy7.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Rat), APC-Cy7

4-PAA658Ra01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Ly218)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with APC-Cy7.

Monoclonal GSTM1 Antibody (monoclonal) (M01), Clone: 3B10

AMM05247G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human GSTM1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3B10. This antibody is applicable in E

Glutathione S Transferase Mu 1 (GSTM1) Antibody

20-abx123550
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Glutathione S Transferase Mu 1 (GSTM1) Antibody

20-abx112776
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glutathione S Transferase Mu 1 (GSTm1) Antibody

20-abx103252
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Glutathione S Transferase Mu 1 (GSTm1) Antibody

20-abx103253
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Glutathione S Transferase Mu 1 (GSTm1) Antibody

20-abx103254
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Glutathione S Transferase Mu 1 (GSTm1) Antibody

20-abx103255
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Glutathione S Transferase Mu 1 (GSTM1) Antibody

abx033049-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Glutathione S Transferase Mu 1 (GSTM1) Antibody

abx033049-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Glutathione S Transferase Mu 1 (GSTM1) Antibody

20-abx009184
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Glutathione S Transferase Mu 1 (GSTM1) Antibody

abx010622-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Glutathione S Transferase Mu 1 (GSTM1) Antibody

abx025456-100ul 100 ul
EUR 523
  • Shipped within 5-10 working days.

Glutathione S Transferase Mu 1 (GSTM1) Antibody

abx015879-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Glutathione S Transferase Mu 1 (GSTM1) Antibody

abx018209-100ug 100 ug
EUR 342
  • Shipped within 5-10 working days.

Glutathione S Transferase Mu 1 (GSTm1) Antibody

20-abx172616
  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Glutathione S Transferase Mu 1 (GSTM1) Antibody

abx430539-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Glutathione S Transferase Mu 1 (GSTM1) Antibody

abx233692-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Glutathione S Transferase Mu 1 (GSTM1) Antibody

20-abx302095
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GSTM1 ORF Vector (Human) (pORF)

ORF004709 1.0 ug DNA
EUR 95

Gstm1 ORF Vector (Rat) (pORF)

ORF067951 1.0 ug DNA
EUR 506

Gstm1 ORF Vector (Mouse) (pORF)

ORF046752 1.0 ug DNA
EUR 506

GSTM1 ELISA Kit (Human) (OKCD01111)

OKCD01111 96 Wells
EUR 792
Description: Description of target: Conjugation of reduced glutathione to a wide number of exogenous and endogenous hydrophobic electrophiles.1 Publication <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.19"Transition state model and mechanism of nucleophilic aromatic substitution reactions catalyzed by human glutathione S-transferase M1a-1a."_x005F_x005F_x000D_Patskovsky Y., Patskovska L., Almo S.C., Listowsky I._x005F_x005F_x000D_Biochemistry 45:3852-3862(2006) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (1.9 ANGSTROMS) IN COMPLEXES WITH GLUTAHIONE ANALOGS, CATALYTIC ACTIVITY, FUNCTION, MUTAGENESIS OF TYR-7; HIS-108; MET-109 AND TYR-116. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 1.16 ng/mL

GSTM1 ELISA Kit (Rat) (OKCD01172)

OKCD01172 96 Wells
EUR 818
Description: Description of target: Conjugation of reduced glutathione to a wide number of exogenous and endogenous hydrophobic electrophiles. The olfactory GST may be crucial for the acuity of the olfactory process. ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 2.88 ng/mL

GSTM1 ELISA Kit (Mouse) (OKCD06632)

OKCD06632 96 Wells
EUR 818
Description: Description of target: Recombinant Mouse Glutathione S-Transferase M1;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.58ng/mL

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Human, Mouse, Rat), APC

4-PAA658Hu01-APC
  • EUR 323.00
  • EUR 2969.00
  • EUR 836.00
  • EUR 409.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Lys218)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with APC.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Human, Mouse, Rat), Biotinylated

4-PAA658Hu01-Biotin
  • EUR 295.00
  • EUR 2235.00
  • EUR 671.00
  • EUR 358.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Lys218)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with Biotin.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Human, Mouse, Rat), Cy3

4-PAA658Hu01-Cy3
  • EUR 390.00
  • EUR 3917.00
  • EUR 1073.00
  • EUR 504.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Lys218)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with Cy3.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Human, Mouse, Rat), FITC

4-PAA658Hu01-FITC
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Lys218)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with FITC.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Human, Mouse, Rat), HRP

4-PAA658Hu01-HRP
  • EUR 297.00
  • EUR 2589.00
  • EUR 741.00
  • EUR 371.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Lys218)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with HRP.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Human, Mouse, Rat), PE

4-PAA658Hu01-PE
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Lys218)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with PE.

Glutathione S Transferase Mu 1 (GSTm1) Antibody (FITC)

20-abx273539
  • EUR 509.00
  • EUR 258.00
  • EUR 1525.00
  • EUR 704.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Glutathione S Transferase Mu 1 (GSTm1) Antibody (FITC)

20-abx273985
  • EUR 495.00
  • EUR 258.00
  • EUR 1455.00
  • EUR 676.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Glutathione S Transferase Mu 1 (GSTM1) Antibody (HRP)

20-abx314152
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Glutathione S Transferase Mu 1 (GSTM1) Antibody (FITC)

20-abx314153
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Glutathione S Transferase Mu 1 (GSTM1) Antibody (Biotin)

20-abx314154
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Glutathione S Transferase Mu 1 (GSTm1) Antibody Pair

20-abx370708
  • EUR 1455.00
  • EUR 940.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Glutathione S Transferase Mu 1 (GSTm1) Antibody (Biotin)

20-abx271710
  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Glutathione S Transferase Mu 1 (GSTm1) Antibody (Biotin)

20-abx272868
  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Glutathione S Transferase Mu 1 (GSTm1) Antibody (Biotin)

20-abx273315
  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Human, Mouse, Rat), APC-Cy7

4-PAA658Hu01-APC-Cy7
  • EUR 527.00
  • EUR 5818.00
  • EUR 1552.00
  • EUR 698.00
  • EUR 301.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GSTm1 (Met1~Lys218)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with APC-Cy7.

GSTM1 sgRNA CRISPR Lentivector set (Human)

K0913501 3 x 1.0 ug
EUR 339

Gstm1 sgRNA CRISPR Lentivector set (Mouse)

K3426101 3 x 1.0 ug
EUR 339

Gstm1 sgRNA CRISPR Lentivector set (Rat)

K7608301 3 x 1.0 ug
EUR 339

Active Glutathione S Transferase Mu 1 (GSTm1)

4-APA658Ra01
  • EUR 942.24
  • EUR 355.00
  • EUR 3258.40
  • EUR 1152.80
  • EUR 2205.60
  • EUR 694.00
  • EUR 7996.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P04905
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.2kDa
  • Isoelectric Point: 8.3
Description: Recombinant Rat Glutathione S Transferase Mu 1 expressed in: E.coli

GSTM1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0913502 1.0 ug DNA
EUR 154

GSTM1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0913503 1.0 ug DNA
EUR 154

GSTM1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0913504 1.0 ug DNA
EUR 154

Gstm1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3426102 1.0 ug DNA
EUR 154

Gstm1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3426103 1.0 ug DNA
EUR 154

Gstm1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3426104 1.0 ug DNA
EUR 154

Gstm1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7608302 1.0 ug DNA
EUR 154

Gstm1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7608303 1.0 ug DNA
EUR 154

Gstm1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7608304 1.0 ug DNA
EUR 154

GSTM1 Glutathione S-Transferase M1Human Recombinant Protein

PROTP09488 Regular: 10ug
EUR 317
Description: GSTM1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 203 amino acids (1-181 a.a) and having a molecular mass of 23.6kDa.GSTM1 is fused to a 22 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Recombinant Glutathione S Transferase Mu 1 (GSTm1)

4-RPA658Ga01
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P20136
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Chicken Glutathione S Transferase Mu 1 expressed in: E.coli

Recombinant Glutathione S Transferase Mu 1 (GSTm1)

4-RPA658Hu01
  • EUR 470.94
  • EUR 229.00
  • EUR 1491.04
  • EUR 563.68
  • EUR 1027.36
  • EUR 378.00
  • EUR 3577.60
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P09488
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Glutathione S Transferase Mu 1 expressed in: E.coli

Recombinant Glutathione S Transferase Mu 1 (GSTm1)

4-RPA658Mu01
  • EUR 332.96
  • EUR 192.00
  • EUR 973.60
  • EUR 391.20
  • EUR 682.40
  • EUR 286.00
  • EUR 2284.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P10649
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Glutathione S Transferase Mu 1 expressed in: E.coli

Recombinant Glutathione S Transferase Mu 1 (GSTm1)

4-RPA658Ra01
  • EUR 350.88
  • EUR 197.00
  • EUR 1040.80
  • EUR 413.60
  • EUR 727.20
  • EUR 298.00
  • EUR 2452.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P04905
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Glutathione S Transferase Mu 1 expressed in: E.coli

Recombinant Human GSTM1 Protein, His, E.coli-10ug

QP12057-10ug 10ug
EUR 201

Recombinant Human GSTM1 Protein, His, E.coli-1mg

QP12057-1mg 1mg
EUR 5251

Recombinant Human GSTM1 Protein, His, E.coli-2ug

QP12057-2ug 2ug
EUR 155

GSTM1 Protein Vector (Rat) (pPB-C-His)

PV271802 500 ng
EUR 603

GSTM1 Protein Vector (Rat) (pPB-N-His)

PV271803 500 ng
EUR 603

GSTM1 Protein Vector (Rat) (pPM-C-HA)

PV271804 500 ng
EUR 603

GSTM1 Protein Vector (Rat) (pPM-C-His)

PV271805 500 ng
EUR 603

Recombinant Mouse GSTM1 Protein, Untagged, E.coli-10ug

QP10658-10ug 10ug
EUR 155

Recombinant Mouse GSTM1 Protein, Untagged, E.coli-1mg

QP10658-1mg 1mg
EUR 1859

Recombinant Mouse GSTM1 Protein, Untagged, E.coli-50ug

QP10658-50ug 50ug
EUR 201

Recombinant Mouse GSTM1 Protein, His, E.coli-25ug

QP10658-HIS-25ug 25ug
EUR 201

Recombinant Mouse GSTM1 Protein, His, E.coli-5ug

QP10658-HIS-5ug 5ug
EUR 155

GSTM1 Protein Vector (Human) (pPB-C-His)

PV018833 500 ng
EUR 329

GSTM1 Protein Vector (Human) (pPB-N-His)

PV018834 500 ng
EUR 329

GSTM1 Protein Vector (Human) (pPM-C-HA)

PV018835 500 ng
EUR 329

GSTM1 Protein Vector (Human) (pPM-C-His)

PV018836 500 ng
EUR 329

GSTM1 Protein Vector (Mouse) (pPB-C-His)

PV187006 500 ng
EUR 603

GSTM1 Protein Vector (Mouse) (pPB-N-His)

PV187007 500 ng
EUR 603

GSTM1 Protein Vector (Mouse) (pPM-C-HA)

PV187008 500 ng
EUR 603

GSTM1 Protein Vector (Mouse) (pPM-C-His)

PV187009 500 ng
EUR 603

Gstm1 3'UTR Luciferase Stable Cell Line

TU205516 1.0 ml Ask for price

Gstm1 3'UTR GFP Stable Cell Line

TU159177 1.0 ml Ask for price

GSTM1 3'UTR Luciferase Stable Cell Line

TU009387 1.0 ml
EUR 1394

Gstm1 3'UTR Luciferase Stable Cell Line

TU109177 1.0 ml Ask for price

GSTM1 3'UTR GFP Stable Cell Line

TU059387 1.0 ml
EUR 1394

Gstm1 3'UTR GFP Stable Cell Line

TU255516 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

GSTM1 Rabbit Polyclonal Antibody