GSTM1 Rabbit Polyclonal Antibody
To Order Now: info@poweratlas.org
GSTM1 Polyclonal Antibody |
ABP58729-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human GSTM1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of GSTM1 from Human, Mouse, Rat. This GSTM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GSTM1 protein |
GSTM1 Polyclonal Antibody |
ABP58729-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human GSTM1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of GSTM1 from Human, Mouse, Rat. This GSTM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GSTM1 protein |
GSTM1 Polyclonal Antibody |
ABP58729-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human GSTM1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of GSTM1 from Human, Mouse, Rat. This GSTM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GSTM1 protein |
GSTM1 Polyclonal Antibody |
ES11905-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against GSTM1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
GSTM1 Polyclonal Antibody |
ES11905-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against GSTM1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
GSTM1 Rabbit pAb |
A8819-100ul |
Abclonal |
100 ul |
EUR 308 |
GSTM1 Rabbit pAb |
A8819-200ul |
Abclonal |
200 ul |
EUR 459 |
GSTM1 Rabbit pAb |
A8819-20ul |
Abclonal |
20 ul |
Ask for price |
GSTM1 Rabbit pAb |
A8819-50ul |
Abclonal |
50 ul |
Ask for price |
GSTM1 Rabbit pAb |
A17492-100ul |
Abclonal |
100 ul |
EUR 308 |
GSTM1 Rabbit pAb |
A17492-200ul |
Abclonal |
200 ul |
EUR 459 |
GSTM1 Rabbit pAb |
A17492-20ul |
Abclonal |
20 ul |
EUR 183 |
GSTM1 Rabbit pAb |
A17492-50ul |
Abclonal |
50 ul |
EUR 223 |
GSTM1 Polyclonal Conjugated Antibody |
C30053 |
SAB |
100ul |
EUR 397 |
Polyclonal GSTM1 / MU Antibody |
AMM05244G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GSTM1 / MU . This antibody is tested and proven to work in the following applications: |
Human Glutathione S Transferase Mu 1 (GSTm1) ELISA Kit |
DLR-GSTm1-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Glutathione S Transferase Mu 1 (GSTm1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Glutathione S Transferase Mu 1 (GSTm1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Glutathione S Transferase Mu 1 (GSTm1) ELISA Kit |
DLR-GSTm1-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Glutathione S Transferase Mu 1 (GSTm1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Glutathione S Transferase Mu 1 (GSTm1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Glutathione S Transferase Mu 1 (GSTm1) ELISA Kit |
RDR-GSTm1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Glutathione S Transferase Mu 1 (GSTm1) ELISA Kit |
RDR-GSTm1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Human Glutathione S Transferase Mu 1 (GSTm1) ELISA Kit |
RD-GSTm1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Glutathione S Transferase Mu 1 (GSTm1) ELISA Kit |
RD-GSTm1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Polyclonal GSTM1 Antibody (C-term) |
AMM05246G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GSTM1 (C-term). This antibody is tested and proven to work in the following applications: |
GSTM1 antibody |
23009-100ul |
SAB |
100ul |
EUR 390 |
GSTM1 antibody |
70R-17626 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal GSTM1 antibody |
GSTM1 antibody |
70R-13538 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal GSTM1 antibody |
GSTM1 antibody |
10R-10423 |
Fitzgerald |
100 ug |
EUR 435 |
Description: Mouse monoclonal GSTM1 antibody |
GSTM1 antibody |
70R-49833 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal GSTM1 antibody |
GSTM1 antibody |
70R-8515 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal GSTM1 antibody |
GSTM1 antibody |
70R-5348 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal GSTM1 antibody raised against the N terminal of GSTM1 |
GSTM1 Antibody |
BF0243 |
Affbiotech |
200ul |
EUR 376 |
Description: GSTM1 antibody detects endogenous levels of total GSTM1. |
GSTM1 Antibody |
1-CSB-PA009979GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against GSTM1. Recognizes GSTM1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC |
GSTM1 Antibody |
1-CSB-PA009979LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GSTM1. Recognizes GSTM1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
Polyclonal Goat Anti-GSTM1 / GSTM2 Antibody |
AMM05005G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-GSTM1 / GSTM2 . This antibody is tested and proven to work in the following applications: |
Polyclonal GSTM1 antibody - N-terminal region |
AMM05248G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GSTM1 - N-terminal region. This antibody is tested and proven to work in the following applications: |
Mouse GSTM1 Antibody |
32935-05111 |
AssayPro |
150 ug |
EUR 261 |
Anti-GSTM1 Antibody |
A00569-1 |
BosterBio |
100ug/vial |
EUR 294 |
anti- GSTM1 antibody |
FNab03692 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:1000
- IHC: 1:50-1:500
- IF: 1:50-1:500
- Immunogen: glutathione S-transferase mu 1
- Uniprot ID: P09488
- Gene ID: 2944
- Research Area: Metabolism
|
Description: Antibody raised against GSTM1 |
anti- GSTM1 antibody |
FNab09906 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:2000
- IHC: 1:50-1:200
- Immunogen: glutathione S-transferase mu 1
- Uniprot ID: P09488
- Gene ID: 2944
- Research Area: Metabolism
|
Description: Antibody raised against GSTM1 |
anti- GSTM1 antibody |
FNab09966 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:2000
- IHC: 1:20-1:200
- Immunogen: glutathione S-transferase mu 1
- Uniprot ID: P09488
- Gene ID: 2944
- Research Area: Metabolism
|
Description: Antibody raised against GSTM1 |
Anti-GSTM1 antibody |
STJ111433 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. Null mutations of this class mu gene have been linked with an increase in a number of cancers, likely due to an increased susceptibility to environmental toxins and carcinogens. Multiple protein isoforms are encoded by transcript variants of this gene. |
Anti-GSTM1 antibody |
STJ119590 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. Null mutations of this class mu gene have been linked with an increase in a number of cancers, likely due to an increased susceptibility to environmental toxins and carcinogens. Multiple protein isoforms are encoded by transcript variants of this gene. [provided by RefSeq, Jul 2008] |
Anti-GSTM1 antibody |
STJ193063 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to GSTM1 |
GSTM1 protein |
30R-1261 |
Fitzgerald |
100 ug |
EUR 300 |
Description: Purified recombinant Mouse GSTM1 protein |
GSTM1 siRNA |
20-abx902353 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GSTM1 siRNA |
20-abx918818 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GSTM1 siRNA |
20-abx918819 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GSTM1 Antibody, HRP conjugated |
1-CSB-PA009979LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GSTM1. Recognizes GSTM1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
GSTM1 Antibody, FITC conjugated |
1-CSB-PA009979LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GSTM1. Recognizes GSTM1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
GSTM1 Antibody, Biotin conjugated |
1-CSB-PA009979LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GSTM1. Recognizes GSTM1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
GSTM1 Blocking Peptide |
33R-4498 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GSTM1 antibody, catalog no. 70R-5348 |
GSTM1 Blocking Peptide |
33R-7049 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GSTM1 antibody, catalog no. 70R-8515 |
GSTM1 Blocking Peptide |
20-abx062708 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GSTM1 Blocking Peptide |
BF0243-BP |
Affbiotech |
1mg |
EUR 195 |
GSTM1 cloning plasmid |
CSB-CL009979HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 546
- Sequence: atgcccatgatactggggtactgggacatccgcgggctggcccacgccatccgcctgctcctggaatacacagactcaagctatgaggaaaagaagtacacgatgggggacgctcctgattatgacagaagccagtggctgaatgaaaaattcaagctgggcctggactttcccaa
- Show more
|
Description: A cloning plasmid for the GSTM1 gene. |
anti-GSTM1 (1H4A4) |
LF-MA30658 |
Abfrontier |
100 ul |
EUR 527 |
Description: Mouse Monoclonal to GSTM1 |
anti-GSTM1 (1H4F2) |
LF-MA30659 |
Abfrontier |
100 ul |
EUR 527 |
Description: Mouse Monoclonal to GSTM1 |
Anti-GSTM1 (3B10) |
YF-MA13347 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to GSTM1 |
Mouse GSTM1 Antibody (Biotin Conjugate) |
32935-05121 |
AssayPro |
150 ug |
EUR 369 |
Monoclonal GSTM1 Antibody, Clone: 1H4F2 |
APR16645G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A Monoclonal antibody against Human GSTM1. The antibodies are raised in Mouse and are from clone 1H4F2. This antibody is applicable in WB and IHC, FC, E |
Anti-GSTM1 Antibody (monoclonal, 11F2) |
M00569 |
BosterBio |
100ug/vial |
EUR 334 |
Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Chicken) |
4-PAA658Ga01 |
Cloud-Clone |
-
EUR 243.00
-
EUR 2457.00
-
EUR 613.00
-
EUR 305.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTm1 (Met1~Glu220)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Chicken Glutathione S Transferase Mu 1 (GSTm1) |
Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Mouse) |
4-PAA658Mu01 |
Cloud-Clone |
-
EUR 236.00
-
EUR 2338.00
-
EUR 586.00
-
EUR 294.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTm1 (Met1~Lys218)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 1 (GSTm1) |
Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Rat) |
4-PAA658Ra01 |
Cloud-Clone |
-
EUR 243.00
-
EUR 2457.00
-
EUR 613.00
-
EUR 305.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTm1 (Met1~Ly218)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 1 (GSTm1) |
Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Chicken), APC |
4-PAA658Ga01-APC |
Cloud-Clone |
-
EUR 340.00
-
EUR 3203.00
-
EUR 894.00
-
EUR 432.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTm1 (Met1~Glu220)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Chicken Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with APC. |
Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Chicken), Biotinylated |
4-PAA658Ga01-Biotin |
Cloud-Clone |
-
EUR 307.00
-
EUR 2407.00
-
EUR 714.00
-
EUR 375.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTm1 (Met1~Glu220)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Chicken Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with Biotin. |
Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Chicken), Cy3 |
4-PAA658Ga01-Cy3 |
Cloud-Clone |
-
EUR 411.00
-
EUR 4229.00
-
EUR 1151.00
-
EUR 535.00
-
EUR 248.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTm1 (Met1~Glu220)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Chicken Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with Cy3. |
Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Chicken), FITC |
4-PAA658Ga01-FITC |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTm1 (Met1~Glu220)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Chicken Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with FITC. |
Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Chicken), HRP |
4-PAA658Ga01-HRP |
Cloud-Clone |
-
EUR 311.00
-
EUR 2792.00
-
EUR 791.00
-
EUR 391.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTm1 (Met1~Glu220)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Chicken Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with HRP. |
Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Chicken), PE |
4-PAA658Ga01-PE |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTm1 (Met1~Glu220)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Chicken Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with PE. |
Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Mouse), APC |
4-PAA658Mu01-APC |
Cloud-Clone |
-
EUR 329.00
-
EUR 3041.00
-
EUR 854.00
-
EUR 416.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTm1 (Met1~Lys218)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with APC. |
Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Mouse), Biotinylated |
4-PAA658Mu01-Biotin |
Cloud-Clone |
-
EUR 299.00
-
EUR 2288.00
-
EUR 684.00
-
EUR 363.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTm1 (Met1~Lys218)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with Biotin. |
Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Mouse), Cy3 |
4-PAA658Mu01-Cy3 |
Cloud-Clone |
-
EUR 397.00
-
EUR 4013.00
-
EUR 1097.00
-
EUR 513.00
-
EUR 241.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTm1 (Met1~Lys218)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with Cy3. |
Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Mouse), FITC |
4-PAA658Mu01-FITC |
Cloud-Clone |
-
EUR 283.00
-
EUR 2452.00
-
EUR 703.00
-
EUR 353.00
-
EUR 189.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTm1 (Met1~Lys218)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with FITC. |
Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Mouse), HRP |
4-PAA658Mu01-HRP |
Cloud-Clone |
-
EUR 302.00
-
EUR 2652.00
-
EUR 756.00
-
EUR 377.00
-
EUR 200.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTm1 (Met1~Lys218)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with HRP. |
Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Mouse), PE |
4-PAA658Mu01-PE |
Cloud-Clone |
-
EUR 283.00
-
EUR 2452.00
-
EUR 703.00
-
EUR 353.00
-
EUR 189.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTm1 (Met1~Lys218)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with PE. |
Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Rat), APC |
4-PAA658Ra01-APC |
Cloud-Clone |
-
EUR 340.00
-
EUR 3203.00
-
EUR 894.00
-
EUR 432.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTm1 (Met1~Ly218)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with APC. |
Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Rat), Biotinylated |
4-PAA658Ra01-Biotin |
Cloud-Clone |
-
EUR 307.00
-
EUR 2407.00
-
EUR 714.00
-
EUR 375.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTm1 (Met1~Ly218)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with Biotin. |
Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Rat), Cy3 |
4-PAA658Ra01-Cy3 |
Cloud-Clone |
-
EUR 411.00
-
EUR 4229.00
-
EUR 1151.00
-
EUR 535.00
-
EUR 248.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTm1 (Met1~Ly218)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with Cy3. |
Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Rat), FITC |
4-PAA658Ra01-FITC |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTm1 (Met1~Ly218)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with FITC. |
Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Rat), HRP |
4-PAA658Ra01-HRP |
Cloud-Clone |
-
EUR 311.00
-
EUR 2792.00
-
EUR 791.00
-
EUR 391.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTm1 (Met1~Ly218)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with HRP. |
Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Rat), PE |
4-PAA658Ra01-PE |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTm1 (Met1~Ly218)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with PE. |
Mouse GSTM1 AssayLite Antibody (FITC Conjugate) |
32935-05141 |
AssayPro |
150 ug |
EUR 428 |
Mouse GSTM1 AssayLite Antibody (APC Conjugate) |
32935-05151 |
AssayPro |
150 ug |
EUR 428 |
Mouse GSTM1 AssayLite Antibody (RPE Conjugate) |
32935-05161 |
AssayPro |
150 ug |
EUR 428 |
Mouse GSTM1 AssayLite Antibody (PerCP Conjugate) |
32935-05171 |
AssayPro |
150 ug |
EUR 471 |
GSTM1 protein (His tag) |
80R-3744 |
Fitzgerald |
50 ug |
EUR 327 |
Description: Purified recombinant GSTM1 protein (His tag) |
Rat GSTM1 shRNA Plasmid |
20-abx984488 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human GSTM1 shRNA Plasmid |
20-abx951990 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse GSTM1 shRNA Plasmid |
20-abx970689 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
GSTM1 Recombinant Protein (Human) |
RP014125 |
ABM |
100 ug |
Ask for price |
GSTM1 Recombinant Protein (Rat) |
RP203849 |
ABM |
100 ug |
Ask for price |
GSTM1 Recombinant Protein (Mouse) |
RP140252 |
ABM |
100 ug |
Ask for price |
Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Chicken), APC-Cy7 |
4-PAA658Ga01-APC-Cy7 |
Cloud-Clone |
-
EUR 560.00
-
EUR 6286.00
-
EUR 1669.00
-
EUR 745.00
-
EUR 315.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTm1 (Met1~Glu220)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Chicken Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with APC-Cy7. |
Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Human, Mouse, Rat) |
4-PAA658Hu01 |
Cloud-Clone |
-
EUR 232.00
-
EUR 2285.00
-
EUR 574.00
-
EUR 289.00
-
EUR 208.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTm1 (Met1~Lys218)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Glutathione S Transferase Mu 1 (GSTm1) |
Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAA658Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 538.00
-
EUR 5962.00
-
EUR 1588.00
-
EUR 713.00
-
EUR 304.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTm1 (Met1~Lys218)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with APC-Cy7. |
Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAA658Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 560.00
-
EUR 6286.00
-
EUR 1669.00
-
EUR 745.00
-
EUR 315.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTm1 (Met1~Ly218)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with APC-Cy7. |
Glutathione S Transferase Mu 1 (GSTM1) Antibody |
20-abx009184 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Glutathione S Transferase Mu 1 (GSTM1) Antibody |
abx010622-100ul |
Abbexa |
100 ul |
EUR 411 |
- Shipped within 5-10 working days.
|
Glutathione S Transferase Mu 1 (GSTM1) Antibody |
abx025456-100ul |
Abbexa |
100 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Glutathione S Transferase Mu 1 (GSTM1) Antibody |
abx018209-100ug |
Abbexa |
100 ug |
EUR 342 |
- Shipped within 5-10 working days.
|
Glutathione S Transferase Mu 1 (GSTM1) Antibody |
abx015879-100ul |
Abbexa |
100 ul |
EUR 411 |
- Shipped within 5-10 working days.
|
Glutathione S Transferase Mu 1 (GSTm1) Antibody |
20-abx103252 |
Abbexa |
-
EUR 398.00
-
EUR 133.00
-
EUR 1107.00
-
EUR 537.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Glutathione S Transferase Mu 1 (GSTm1) Antibody |
20-abx103253 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1135.00
-
EUR 551.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Glutathione S Transferase Mu 1 (GSTm1) Antibody |
20-abx103254 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1177.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Glutathione S Transferase Mu 1 (GSTm1) Antibody |
20-abx103255 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1177.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Glutathione S Transferase Mu 1 (GSTM1) Antibody |
20-abx112776 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Glutathione S Transferase Mu 1 (GSTM1) Antibody |
20-abx123550 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Glutathione S Transferase Mu 1 (GSTm1) Antibody |
20-abx172616 |
Abbexa |
|
|
|
Glutathione S Transferase Mu 1 (GSTM1) Antibody |
abx033049-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Glutathione S Transferase Mu 1 (GSTM1) Antibody |
abx033049-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Glutathione S Transferase Mu 1 (GSTM1) Antibody |
abx233692-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Glutathione S Transferase Mu 1 (GSTM1) Antibody |
abx430539-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Glutathione S Transferase Mu 1 (GSTM1) Antibody |
20-abx302095 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Monoclonal GSTM1 Antibody (monoclonal) (M01), Clone: 3B10 |
AMM05247G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human GSTM1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3B10. This antibody is applicable in E |
Gstm1 ORF Vector (Rat) (pORF) |
ORF067951 |
ABM |
1.0 ug DNA |
EUR 506 |
GSTM1 ORF Vector (Human) (pORF) |
ORF004709 |
ABM |
1.0 ug DNA |
EUR 95 |
Gstm1 ORF Vector (Mouse) (pORF) |
ORF046752 |
ABM |
1.0 ug DNA |
EUR 506 |
GSTM1 ELISA Kit (Human) (OKCD01111) |
OKCD01111 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: Conjugation of reduced glutathione to a wide number of exogenous and endogenous hydrophobic electrophiles.1 Publication
<p>Manually curated information for which there is published experimental evidence.</p>
<p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.19"Transition state model and mechanism of nucleophilic aromatic substitution reactions catalyzed by human glutathione S-transferase M1a-1a."_x005F_x005F_x000D_Patskovsky Y., Patskovska L., Almo S.C., Listowsky I._x005F_x005F_x000D_Biochemistry 45:3852-3862(2006) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (1.9 ANGSTROMS) IN COMPLEXES WITH GLUTAHIONE ANALOGS, CATALYTIC ACTIVITY, FUNCTION, MUTAGENESIS OF TYR-7; HIS-108; MET-109 AND TYR-116. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 1.16 ng/mL |
GSTM1 ELISA Kit (Rat) (OKCD01172) |
OKCD01172 |
Aviva Systems Biology |
96 Wells |
EUR 818 |
Description: Description of target: Conjugation of reduced glutathione to a wide number of exogenous and endogenous hydrophobic electrophiles. The olfactory GST may be crucial for the acuity of the olfactory process. ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 2.88 ng/mL |
GSTM1 ELISA Kit (Mouse) (OKCD06632) |
OKCD06632 |
Aviva Systems Biology |
96 Wells |
EUR 818 |
Description: Description of target: Recombinant Mouse Glutathione S-Transferase M1;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.58ng/mL |
Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Human, Mouse, Rat), APC |
4-PAA658Hu01-APC |
Cloud-Clone |
-
EUR 323.00
-
EUR 2969.00
-
EUR 836.00
-
EUR 409.00
-
EUR 210.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTm1 (Met1~Lys218)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with APC. |
Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Human, Mouse, Rat), Biotinylated |
4-PAA658Hu01-Biotin |
Cloud-Clone |
-
EUR 295.00
-
EUR 2235.00
-
EUR 671.00
-
EUR 358.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTm1 (Met1~Lys218)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with Biotin. |
Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Human, Mouse, Rat), Cy3 |
4-PAA658Hu01-Cy3 |
Cloud-Clone |
-
EUR 390.00
-
EUR 3917.00
-
EUR 1073.00
-
EUR 504.00
-
EUR 239.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTm1 (Met1~Lys218)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with Cy3. |
Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Human, Mouse, Rat), FITC |
4-PAA658Hu01-FITC |
Cloud-Clone |
-
EUR 279.00
-
EUR 2395.00
-
EUR 688.00
-
EUR 347.00
-
EUR 188.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTm1 (Met1~Lys218)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with FITC. |
Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Human, Mouse, Rat), HRP |
4-PAA658Hu01-HRP |
Cloud-Clone |
-
EUR 297.00
-
EUR 2589.00
-
EUR 741.00
-
EUR 371.00
-
EUR 199.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTm1 (Met1~Lys218)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with HRP. |
Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Human, Mouse, Rat), PE |
4-PAA658Hu01-PE |
Cloud-Clone |
-
EUR 279.00
-
EUR 2395.00
-
EUR 688.00
-
EUR 347.00
-
EUR 188.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTm1 (Met1~Lys218)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with PE. |
Glutathione S Transferase Mu 1 (GSTm1) Antibody (Biotin) |
20-abx271710 |
Abbexa |
-
EUR 481.00
-
EUR 244.00
-
EUR 1414.00
-
EUR 662.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Glutathione S Transferase Mu 1 (GSTm1) Antibody (Biotin) |
20-abx272868 |
Abbexa |
-
EUR 467.00
-
EUR 244.00
-
EUR 1344.00
-
EUR 634.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Glutathione S Transferase Mu 1 (GSTm1) Antibody (Biotin) |
20-abx273315 |
Abbexa |
-
EUR 481.00
-
EUR 244.00
-
EUR 1414.00
-
EUR 662.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Glutathione S Transferase Mu 1 (GSTm1) Antibody Pair |
20-abx370708 |
Abbexa |
|
-
10 × 96 tests
-
5 × 96 tests
|
- Shipped within 5-15 working days.
|
Glutathione S Transferase Mu 1 (GSTm1) Antibody (FITC) |
20-abx273539 |
Abbexa |
-
EUR 509.00
-
EUR 258.00
-
EUR 1525.00
-
EUR 704.00
-
EUR 411.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Glutathione S Transferase Mu 1 (GSTm1) Antibody (FITC) |
20-abx273985 |
Abbexa |
-
EUR 495.00
-
EUR 258.00
-
EUR 1455.00
-
EUR 676.00
-
EUR 398.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Glutathione S Transferase Mu 1 (GSTM1) Antibody (HRP) |
20-abx314152 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Glutathione S Transferase Mu 1 (GSTM1) Antibody (FITC) |
20-abx314153 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Glutathione S Transferase Mu 1 (GSTM1) Antibody (Biotin) |
20-abx314154 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Glutathione S Transferase Mu 1 (GSTm1) Polyclonal Antibody (Human, Mouse, Rat), APC-Cy7 |
4-PAA658Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 527.00
-
EUR 5818.00
-
EUR 1552.00
-
EUR 698.00
-
EUR 301.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTm1 (Met1~Lys218)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Glutathione S Transferase Mu 1 (GSTm1). This antibody is labeled with APC-Cy7. |
Gstm1 sgRNA CRISPR Lentivector set (Rat) |
K7608301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Gstm1 sgRNA CRISPR Lentivector set (Mouse) |
K3426101 |
ABM |
3 x 1.0 ug |
EUR 339 |
GSTM1 sgRNA CRISPR Lentivector set (Human) |
K0913501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Active Glutathione S Transferase Mu 1 (GSTm1) |
4-APA658Ra01 |
Cloud-Clone |
-
EUR 942.24
-
EUR 355.00
-
EUR 3258.40
-
EUR 1152.80
-
EUR 2205.60
-
EUR 694.00
-
EUR 7996.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P04905
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 27.2kDa
- Isoelectric Point: 8.3
|
Description: Recombinant Rat Glutathione S Transferase Mu 1 expressed in: E.coli |
Gstm1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7608302 |
ABM |
1.0 ug DNA |
EUR 154 |
Gstm1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7608303 |
ABM |
1.0 ug DNA |
EUR 154 |
Gstm1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7608304 |
ABM |
1.0 ug DNA |
EUR 154 |
Gstm1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3426102 |
ABM |
1.0 ug DNA |
EUR 154 |
Gstm1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3426103 |
ABM |
1.0 ug DNA |
EUR 154 |
Gstm1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3426104 |
ABM |
1.0 ug DNA |
EUR 154 |
GSTM1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0913502 |
ABM |
1.0 ug DNA |
EUR 154 |
GSTM1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0913503 |
ABM |
1.0 ug DNA |
EUR 154 |
GSTM1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0913504 |
ABM |
1.0 ug DNA |
EUR 154 |
GSTM1 Glutathione S-Transferase M1Human Recombinant Protein |
PROTP09488 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: GSTM1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 203 amino acids (1-181 a.a) and having a molecular mass of 23.6kDa.GSTM1 is fused to a 22 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
GSTM1 Protein Vector (Rat) (pPB-C-His) |
PV271802 |
ABM |
500 ng |
EUR 603 |
GSTM1 Protein Vector (Rat) (pPB-N-His) |
PV271803 |
ABM |
500 ng |
EUR 603 |
GSTM1 Protein Vector (Rat) (pPM-C-HA) |
PV271804 |
ABM |
500 ng |
EUR 603 |
GSTM1 Protein Vector (Rat) (pPM-C-His) |
PV271805 |
ABM |
500 ng |
EUR 603 |
GSTM1 Protein Vector (Mouse) (pPB-C-His) |
PV187006 |
ABM |
500 ng |
EUR 603 |
GSTM1 Protein Vector (Mouse) (pPB-N-His) |
PV187007 |
ABM |
500 ng |
EUR 603 |
GSTM1 Protein Vector (Mouse) (pPM-C-HA) |
PV187008 |
ABM |
500 ng |
EUR 603 |
GSTM1 Protein Vector (Mouse) (pPM-C-His) |
PV187009 |
ABM |
500 ng |
EUR 603 |
GSTM1 Protein Vector (Human) (pPB-C-His) |
PV018833 |
ABM |
500 ng |
EUR 329 |
GSTM1 Protein Vector (Human) (pPB-N-His) |
PV018834 |
ABM |
500 ng |
EUR 329 |
GSTM1 Protein Vector (Human) (pPM-C-HA) |
PV018835 |
ABM |
500 ng |
EUR 329 |
GSTM1 Protein Vector (Human) (pPM-C-His) |
PV018836 |
ABM |
500 ng |
EUR 329 |
Recombinant Glutathione S Transferase Mu 1 (GSTm1) |
4-RPA658Ga01 |
Cloud-Clone |
-
EUR 413.60
-
EUR 214.00
-
EUR 1276.00
-
EUR 492.00
-
EUR 884.00
-
EUR 340.00
-
EUR 3040.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P20136
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 27.1kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Chicken Glutathione S Transferase Mu 1 expressed in: E.coli |
Recombinant Glutathione S Transferase Mu 1 (GSTm1) |
4-RPA658Hu01 |
Cloud-Clone |
-
EUR 470.94
-
EUR 229.00
-
EUR 1491.04
-
EUR 563.68
-
EUR 1027.36
-
EUR 378.00
-
EUR 3577.60
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P09488
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 27.0kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Glutathione S Transferase Mu 1 expressed in: E.coli |
Recombinant Glutathione S Transferase Mu 1 (GSTm1) |
4-RPA658Mu01 |
Cloud-Clone |
-
EUR 332.96
-
EUR 192.00
-
EUR 973.60
-
EUR 391.20
-
EUR 682.40
-
EUR 286.00
-
EUR 2284.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P10649
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 27.2kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Glutathione S Transferase Mu 1 expressed in: E.coli |
Recombinant Glutathione S Transferase Mu 1 (GSTm1) |
4-RPA658Ra01 |
Cloud-Clone |
-
EUR 350.88
-
EUR 197.00
-
EUR 1040.80
-
EUR 413.60
-
EUR 727.20
-
EUR 298.00
-
EUR 2452.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P04905
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 27.2kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Rat Glutathione S Transferase Mu 1 expressed in: E.coli |
Recombinant Human GSTM1 Protein, His, E.coli-10ug |
QP12057-10ug |
EnQuireBio |
10ug |
EUR 201 |
Recombinant Human GSTM1 Protein, His, E.coli-1mg |
QP12057-1mg |
EnQuireBio |
1mg |
EUR 5251 |
Recombinant Human GSTM1 Protein, His, E.coli-2ug |
QP12057-2ug |
EnQuireBio |
2ug |
EUR 155 |
Recombinant Mouse GSTM1 Protein, Untagged, E.coli-10ug |
QP10658-10ug |
EnQuireBio |
10ug |
EUR 155 |
Recombinant Mouse GSTM1 Protein, Untagged, E.coli-1mg |
QP10658-1mg |
EnQuireBio |
1mg |
EUR 1859 |
Recombinant Mouse GSTM1 Protein, Untagged, E.coli-50ug |
QP10658-50ug |
EnQuireBio |
50ug |
EUR 201 |
Recombinant Mouse GSTM1 Protein, His, E.coli-25ug |
QP10658-HIS-25ug |
EnQuireBio |
25ug |
EUR 201 |
Recombinant Mouse GSTM1 Protein, His, E.coli-5ug |
QP10658-HIS-5ug |
EnQuireBio |
5ug |
EUR 155 |
Gstm1 3'UTR Luciferase Stable Cell Line |
TU109177 |
ABM |
1.0 ml |
Ask for price |
Gstm1 3'UTR Luciferase Stable Cell Line |
TU205516 |
ABM |
1.0 ml |
Ask for price |
Gstm1 3'UTR GFP Stable Cell Line |
TU159177 |
ABM |
1.0 ml |
Ask for price |
Gstm1 3'UTR GFP Stable Cell Line |
TU255516 |
ABM |
1.0 ml |
Ask for price |
GSTM1 3'UTR GFP Stable Cell Line |
TU059387 |
ABM |
1.0 ml |
EUR 1394 |
GSTM1 3'UTR Luciferase Stable Cell Line |
TU009387 |
ABM |
1.0 ml |
EUR 1394 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
GSTM1 Rabbit Polyclonal Antibody