STIP1 Rabbit Polyclonal Antibody

STIP1 Rabbit Polyclonal Antibody

To Order Now:

StIp1 Polyclonal Antibody

ES3522-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against StIp1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

StIp1 Polyclonal Antibody

ABP52523-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human StIp1 at AA range: 740-820
  • Applications tips:
Description: A polyclonal antibody for detection of StIp1 from Human. This StIp1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human StIp1 at AA range: 740-820

StIp1 Polyclonal Antibody

ABP52523-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human StIp1 at AA range: 740-820
  • Applications tips:
Description: A polyclonal antibody for detection of StIp1 from Human. This StIp1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human StIp1 at AA range: 740-820

StIp1 Polyclonal Antibody

ABP52523-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human StIp1 at AA range: 740-820
  • Applications tips:
Description: A polyclonal antibody for detection of StIp1 from Human. This StIp1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human StIp1 at AA range: 740-820

STIP1 Polyclonal Antibody

ABP60539-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human STIP1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of STIP1 from Human. This STIP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STIP1 protein

STIP1 Polyclonal Antibody

ABP60539-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human STIP1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of STIP1 from Human. This STIP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STIP1 protein

STIP1 Polyclonal Antibody

ABP60539-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human STIP1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of STIP1 from Human. This STIP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STIP1 protein

STIP1 Polyclonal Antibody

A54796 100 µg
EUR 570.55
Description: The best epigenetics products

Human Stress Induced Phosphoprotein 1 (STIP1) ELISA Kit

DLR-STIP1-Hu-48T 48T
EUR 517
  • Should the Human Stress Induced Phosphoprotein 1 (STIP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Stress Induced Phosphoprotein 1 (STIP1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Stress Induced Phosphoprotein 1 (STIP1) ELISA Kit

DLR-STIP1-Hu-96T 96T
EUR 673
  • Should the Human Stress Induced Phosphoprotein 1 (STIP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Stress Induced Phosphoprotein 1 (STIP1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Stress Induced Phosphoprotein 1 (STIP1) ELISA Kit

RD-STIP1-Hu-48Tests 48 Tests
EUR 521

Human Stress Induced Phosphoprotein 1 (STIP1) ELISA Kit

RD-STIP1-Hu-96Tests 96 Tests
EUR 723

Human Stress Induced Phosphoprotein 1 (STIP1) ELISA Kit

RDR-STIP1-Hu-48Tests 48 Tests
EUR 544

Human Stress Induced Phosphoprotein 1 (STIP1) ELISA Kit

RDR-STIP1-Hu-96Tests 96 Tests
EUR 756

STIP1 Rabbit pAb

A1219-100ul 100 ul
EUR 308

STIP1 Rabbit pAb

A1219-200ul 200 ul
EUR 459

STIP1 Rabbit pAb

A1219-20ul 20 ul
EUR 183

STIP1 Rabbit pAb

A1219-50ul 50 ul
EUR 223

STIP1 Rabbit pAb

A14106-100ul 100 ul
EUR 308

STIP1 Rabbit pAb

A14106-200ul 200 ul
EUR 459

STIP1 Rabbit pAb

A14106-20ul 20 ul
EUR 183

STIP1 Rabbit pAb

A14106-50ul 50 ul
EUR 223

Polyclonal STIP1 Antibody (Center)

APR05081G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STIP1 (Center). This antibody is tested and proven to work in the following applications:

Polyclonal STIP1 Antibody (C-term)

APR05080G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STIP1 (C-term). This antibody is tested and proven to work in the following applications:

STIP1 Polyclonal Antibody, Biotin Conjugated

A54793 100 µg
EUR 570.55
Description: Ask the seller for details

STIP1 Polyclonal Antibody, FITC Conjugated

A54794 100 µg
EUR 570.55
Description: The best epigenetics products

STIP1 Polyclonal Antibody, HRP Conjugated

A54795 100 µg
EUR 570.55
Description: kits suitable for this type of research

StIp1 Antibody

AF9204 200ul
EUR 304
Description: StIp1 Antibody detects endogenous levels of total StIp1.

StIp1 Antibody

ABF9204 100 ug
EUR 438

STIP1 Antibody

ABD6351 100 ug
EUR 438

STIP1 Antibody

49844-100ul 100ul
EUR 333

STIP1 Antibody

49844-50ul 50ul
EUR 239

STIP1 Antibody

32236-100ul 100ul
EUR 252

STIP1 antibody

22582-100ul 100ul
EUR 390

STIP1 antibody

70R-20588 50 ul
EUR 435
Description: Rabbit polyclonal STIP1 antibody

STIP1 antibody

70R-12703 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal STIP1 antibody

STIP1 antibody

70R-1288 100 ug
EUR 377
Description: Rabbit polyclonal STIP1 antibody

STIP1 antibody

70R-1289 100 ug
EUR 377
Description: Rabbit polyclonal STIP1 antibody

STIP1 Antibody

DF6351 200ul
EUR 304
Description: STIP1 Antibody detects endogenous levels of total STIP1.

STIP1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against STIP1. Recognizes STIP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

STIP1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STIP1. Recognizes STIP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200

STIP1 Conjugated Antibody

C49844 100ul
EUR 397

STIP1 Conjugated Antibody

C32236 100ul
EUR 397

anti- STIP1 antibody

FNab08323 100µg
EUR 548.75
  • Immunogen: stress-induced-phosphoprotein 1
  • Uniprot ID: P31948
  • Gene ID: 10963
  • Research Area: Cardiovascular
Description: Antibody raised against STIP1

Anti-StIp1 Antibody

A07823 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for StIp1 Antibody (ELP2) detection. Tested with WB in Human.

Anti-STIP1 Antibody

PB9896 100ug/vial
EUR 294

Anti-STIP1 antibody

PAab08323 100 ug
EUR 386

Anti-StIp1 antibody

STJ95824 200 µl
EUR 197
Description: Rabbit polyclonal to StIp1.

Anti-STIP1 antibody

STJ25731 100 µl
EUR 277

Anti-STIP1 antibody

STJ192914 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to STIP1

Anti-STIP1 antibody

STJ116041 100 µl
EUR 277


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA21419 50 ul
EUR 363
Description: Mouse polyclonal to STIP1


YF-PA17333 50 ul
EUR 363
Description: Mouse polyclonal to STIP1


YF-PA17334 50 ug
EUR 363
Description: Mouse polyclonal to STIP1


YF-PA26731 50 ul
EUR 334
Description: Mouse polyclonal to STIP1


YF-PA25702 50 ul
EUR 334
Description: Mouse polyclonal to STIP1

STIP1 recombinant monoclonal antibody

A5499 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human STIP1 for WB, IF,ELISA

STIP1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STIP1. Recognizes STIP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

STIP1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STIP1. Recognizes STIP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

STIP1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STIP1. Recognizes STIP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-STIP1 Monoclonal Antibody

M02683 100ug
EUR 397
Description: Rabbit Monoclonal STIP1 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

StIp1 Blocking Peptide

AF9204-BP 1mg
EUR 195

STIP1 cloning plasmid

CSB-CL022831HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1632
  • Sequence: atggagcaggtcaatgagctgaaggagaaaggcaacaaggccctgagcgtgggtaacatcgatgatgccttacagtgctactccgaagctattaagctggatccccacaaccacgtgctgtacagcaaccgttctgctgcctatgccaagaaaggagactaccagaaggcttatg
  • Show more
Description: A cloning plasmid for the STIP1 gene.

STIP1 Blocking Peptide

33R-10212 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of STIP1 antibody, catalog no. 70R-1289

STIP1 Blocking Peptide

33R-1327 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LIG1 antibody, catalog no. 70R-5621

STIP1 Blocking Peptide

DF6351-BP 1mg
EUR 195

Anti-STIP1 (2E1)

YF-MA17542 100 ug
EUR 363
Description: Mouse monoclonal to STIP1

Anti-STIP1 (2E11)

YF-MA17543 100 ug
EUR 363
Description: Mouse monoclonal to STIP1

Anti-STIP1 (4B6)

YF-MA11328 100 ug
EUR 363
Description: Mouse monoclonal to STIP1

Anti-STIP1 (1E3)

YF-MA11329 100 ug
EUR 363
Description: Mouse monoclonal to STIP1

STIP1 Rabbit Polyclonal Antibody