BRD2 Rabbit Polyclonal Antibody

BRD2 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

BRD2 Polyclonal Antibody
ES11774-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against BRD2. This antibody is tested and validated for WB, ELISA, WB, ELISA

BRD2 Polyclonal Antibody
ABP57923-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human BRD2 protein Applications tips:
Description: A polyclonal antibody for detection of BRD2 from Human. This BRD2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BRD2 protein

BRD2 Polyclonal Antibody
ABP57923-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human BRD2 protein Applications tips:
Description: A polyclonal antibody for detection of BRD2 from Human. This BRD2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BRD2 protein

BRD2 Polyclonal Antibody
ABP57923-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human BRD2 protein Applications tips:
Description: A polyclonal antibody for detection of BRD2 from Human. This BRD2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BRD2 protein

BRD2 polyclonal antibody
6839-50	Biovision		EUR 251

Polyclonal BRD2 polyclonal antibody
APR00374G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BRD2 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal BRD2 polyclonal antibody
APR00447G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BRD2 polyclonal . This antibody is tested and proven to work in the following applications:

BRD2 Rabbit pAb
A18229-100ul	Abclonal	100 ul	EUR 308

BRD2 Rabbit pAb
A18229-200ul	Abclonal	200 ul	EUR 459

BRD2 Rabbit pAb
A18229-20ul	Abclonal	20 ul	EUR 183

BRD2 Rabbit pAb
A18229-50ul	Abclonal	50 ul	EUR 223

BRD2 Rabbit pAb
A16241-100ul	Abclonal	100 ul	EUR 308

BRD2 Rabbit pAb
A16241-200ul	Abclonal	200 ul	EUR 459

BRD2 Rabbit pAb
A16241-20ul	Abclonal	20 ul	EUR 183

BRD2 Rabbit pAb
A16241-50ul	Abclonal	50 ul	EUR 223

BRD2 Rabbit pAb
A2233-100ul	Abclonal	100 ul	EUR 308

BRD2 Rabbit pAb
A2233-200ul	Abclonal	200 ul	EUR 459

BRD2 Rabbit pAb
A2233-20ul	Abclonal	20 ul	Ask for price

BRD2 Rabbit pAb
A2233-50ul	Abclonal	50 ul	Ask for price

Polyclonal BRD2 Antibody (Center)
APR06057G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BRD2 (Center). This antibody is tested and proven to work in the following applications:

BRD2 Antibody
49970-100ul	SAB	100ul	EUR 333

BRD2 Antibody
49970-50ul	SAB	50ul	EUR 239

BRD2 Antibody
6281-100	Biovision		EUR 349

BRD2 Antibody
6281-30T	Biovision		EUR 146

BRD2 Antibody
DF12857	Affbiotech	200ul	EUR 304
Description: BRD2 Antibody detects endogenous levels of BRD2.

Polyclonal BRD2 antibody - C-terminal region
APR00570G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BRD2 - C-terminal region. This antibody is tested and proven to work in the following applications:

BRD2 Conjugated Antibody
C49970	SAB	100ul	EUR 397

anti- BRD2 antibody
FNab00946	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:1000 IP: 1:200-1:1000 Immunogen: bromodomain containing 2 Uniprot ID: P25440 Gene ID: 6046 Research Area: Metabolism, Developmental biology
Description: Antibody raised against BRD2

Anti-BRD2 antibody
PAab00946	Lifescience Market	100 ug	EUR 355

Anti-BRD2 antibody
STJ29878	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a transcriptional regulator that belongs to the BET (bromodomains and extra terminal domain) family of proteins. This protein associates with transcription complexes and with acetylated chromatin during mitosis, and it selectively binds to the acetylated lysine-12 residue of histone H4 via its two bromodomains. The gene maps to the major histocompatability complex (MHC) class II region on chromosome 6p21.3, but sequence comparison suggests that the protein is not involved in the immune response. This gene has been implicated in juvenile myoclonic epilepsy, a common form of epilepsy that becomes apparent in adolescence. Multiple alternatively spliced variants have been described for this gene.

Anti-BRD2 antibody
STJ11100186	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a transcriptional regulator that belongs to the BET (bromodomains and extra terminal domain) family of proteins. This protein associates with transcription complexes and with acetylated chromatin during mitosis, and it selectively binds to the acetylated lysine-12 residue of histone H4 via its two bromodomains. The gene maps to the major histocompatability complex (MHC) class II region on chromosome 6p21.3, but sequence comparison suggests that the protein is not involved in the immune response. This gene has been implicated in juvenile myoclonic epilepsy, a common form of epilepsy that becomes apparent in adolescence. Multiple alternatively spliced variants have been described for this gene.

Anti-BRD2 antibody
STJ118693	St John's Laboratory	100 µl	EUR 277

Anti-BRD2 antibody
STJ192932	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to BRD2

BRD2 siRNA
20-abx900667	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

BRD2 siRNA
20-abx909274	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

BRD2 siRNA
20-abx909275	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-BRD2
YF-PA14402	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to BRD2

anti-BRD2
YF-PA14403	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to BRD2

anti-BRD2
YF-PA24585	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to BRD2

BRD2 cloning plasmid
CSB-CL002800HU-10ug	Cusabio	10ug	EUR 812
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2511 Sequence: atgctgcaaaacgtgactccccacaataagctccctggggaagggaatgcagggttgctggggctgggcccagaagcagcagcaccagggaaaaggattcgaaaaccctctctcttgtatgagggctttgagagccccacaatggcttcggtgcctgctttgcaacttacccctg Show more
Description: A cloning plasmid for the BRD2 gene.

BRD2 Blocking Peptide
6281BP-50	Biovision		EUR 153

BRD2 Blocking Peptide
DF12857-BP	Affbiotech	1mg	EUR 195

Anti-BRD2 (3D10)
YF-MA10786	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to BRD2

Antibody for Human BRD2 (pSer37)
SPC-925D	Stressmarq	0.1ml	EUR 354
The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is unconjugated.

Antibody for Human BRD2 (pSer37)
SPC-925D-A390	Stressmarq	0.1ml	EUR 401
The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to ATTO 390.

Antibody for Human BRD2 (pSer37)
SPC-925D-A488	Stressmarq	0.1ml	EUR 400
The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to ATTO 488.

Antibody for Human BRD2 (pSer37)
SPC-925D-A565	Stressmarq	0.1ml	EUR 400
The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to ATTO 565.

Antibody for Human BRD2 (pSer37)
SPC-925D-A594	Stressmarq	0.1ml	EUR 400
The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to ATTO 594.

Antibody for Human BRD2 (pSer37)
SPC-925D-A633	Stressmarq	0.1ml	EUR 400
The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to ATTO 633.

Antibody for Human BRD2 (pSer37)
SPC-925D-A655	Stressmarq	0.1ml	EUR 400
The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to ATTO 655.

Antibody for Human BRD2 (pSer37)
SPC-925D-A680	Stressmarq	0.1ml	EUR 400
The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to ATTO 680.

Antibody for Human BRD2 (pSer37)
SPC-925D-A700	Stressmarq	0.1ml	EUR 400
The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to ATTO 700.

Antibody for Human BRD2 (pSer37)
SPC-925D-ALP	Stressmarq	0.1ml	EUR 394
The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to Alkaline Phosphatase.

Antibody for Human BRD2 (pSer37)
SPC-925D-APC	Stressmarq	0.1ml	EUR 399
The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to APC .

Antibody for Human BRD2 (pSer37)
SPC-925D-APCCY7	Stressmarq	0.1ml	EUR 471
The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to APC/Cy7.

Antibody for Human BRD2 (pSer37)
SPC-925D-BI	Stressmarq	0.1ml	EUR 396
The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to Biotin.

Antibody for Human BRD2 (pSer37)
SPC-925D-DY350	Stressmarq	0.1ml	EUR 475
The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to Dylight 350.

Antibody for Human BRD2 (pSer37)
SPC-925D-DY405	Stressmarq	0.1ml	EUR 452
The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to Dylight 405.

Antibody for Human BRD2 (pSer37)
SPC-925D-DY488	Stressmarq	0.1ml	EUR 432
The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to Dylight 488.

Antibody for Human BRD2 (pSer37)
SPC-925D-DY594	Stressmarq	0.1ml	EUR 436
The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to Dylight 594.

Antibody for Human BRD2 (pSer37)
SPC-925D-DY633	Stressmarq	0.1ml	EUR 426
The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to Dylight 633.

Antibody for Human BRD2 (pSer37)
SPC-925D-FITC	Stressmarq	0.1ml	EUR 392
The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to FITC.

Antibody for Human BRD2 (pSer37)
SPC-925D-HRP	Stressmarq	0.1ml	EUR 388
The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to HRP.

Antibody for Human BRD2 (pSer37)
SPC-925D-P594	Stressmarq	0.1ml	EUR 407
The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to PE/ATTO 594.

Antibody for Human BRD2 (pSer37)
SPC-925D-PCP	Stressmarq	0.1ml	EUR 399
The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to PerCP.

Antibody for Human BRD2 (pSer37)
SPC-925D-RPE	Stressmarq	0.1ml	EUR 397
The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to RPE .

Antibody for Human BRD2 (pSer37)
SPC-925D-STR	Stressmarq	0.1ml	EUR 398
The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to Streptavidin.

Rabbit Bromodomain containing protein 2(BRD2) ELISA kit
E04B0834-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Bromodomain containing protein 2(BRD2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Bromodomain containing protein 2(BRD2) ELISA kit
E04B0834-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Bromodomain containing protein 2(BRD2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Bromodomain containing protein 2(BRD2) ELISA kit
E04B0834-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Bromodomain containing protein 2(BRD2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bromodomain-Containing Protein 2 (BRD2) Antibody
20-abx123434	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Bromodomain-Containing Protein 2 (BRD2) Antibody
abx145199-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Bromodomain-Containing Protein 2 (BRD2) Antibody
abx033841-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Bromodomain-Containing Protein 2 (BRD2) Antibody
abx033841-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Bromodomain-Containing Protein 2 (BRD2) Antibody
abx224363-100ug	Abbexa	100 ug	EUR 411
Shipped within 5-10 working days.

Bromodomain-Containing Protein 2 (BRD2) Antibody
abx224465-100ug	Abbexa	100 ug	EUR 411
Shipped within 5-10 working days.

Bromodomain-Containing Protein 2 (BRD2) Antibody
abx230946-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Rat BRD2 shRNA Plasmid
20-abx988691	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

BRD2 ELISA KIT|Human
EF008143	Lifescience Market	96 Tests	EUR 689

Human BRD2 shRNA Plasmid
20-abx954093	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

BRD2 protein (His tag)
80R-4011	Fitzgerald	100 ug	EUR 349
Description: Recombinant Human BRD2 protein

Mouse BRD2 shRNA Plasmid
20-abx970402	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

pCMV-SPORT6-BRD2 Plasmid
PVTB00811	Lifescience Market	2 ug	EUR 356

BRD2 ORF Vector (Human) (pORF)
ORF001061	ABM	1.0 ug DNA	EUR 95

Brd2 ORF Vector (Mouse) (pORF)
ORF039956	ABM	1.0 ug DNA	EUR 506

Brd2 ORF Vector (Mouse) (pORF)
ORF039957	ABM	1.0 ug DNA	EUR 506

Brd2 ORF Vector (Rat) (pORF)
ORF064136	ABM	1.0 ug DNA	EUR 506

BRD2 sgRNA CRISPR Lentivector set (Human)
K0194001	ABM	3 x 1.0 ug	EUR 339

Brd2 sgRNA CRISPR Lentivector set (Mouse)
K4674101	ABM	3 x 1.0 ug	EUR 339

Brd2 sgRNA CRISPR Lentivector set (Rat)
K7291101	ABM	3 x 1.0 ug	EUR 339

BRD2-IT1 ORF Vector (Human) (pORF)
ORF016242	ABM	1.0 ug DNA	Ask for price

BRD2 Rabbit Polyclonal Antibody