BRD2 Rabbit Polyclonal Antibody
To Order Now: info@poweratlas.org
BRD2 Polyclonal Antibody |
ES11774-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against BRD2. This antibody is tested and validated for WB, ELISA, WB, ELISA |
BRD2 Polyclonal Antibody |
ABP57923-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human BRD2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of BRD2 from Human. This BRD2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BRD2 protein |
BRD2 Polyclonal Antibody |
ABP57923-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human BRD2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of BRD2 from Human. This BRD2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BRD2 protein |
BRD2 Polyclonal Antibody |
ABP57923-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human BRD2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of BRD2 from Human. This BRD2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BRD2 protein |
BRD2 polyclonal antibody |
6839-50 |
Biovision |
|
EUR 251 |
Polyclonal BRD2 polyclonal antibody |
APR00374G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BRD2 polyclonal . This antibody is tested and proven to work in the following applications: |
Polyclonal BRD2 polyclonal antibody |
APR00447G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BRD2 polyclonal . This antibody is tested and proven to work in the following applications: |
BRD2 Rabbit pAb |
A18229-100ul |
Abclonal |
100 ul |
EUR 308 |
BRD2 Rabbit pAb |
A18229-200ul |
Abclonal |
200 ul |
EUR 459 |
BRD2 Rabbit pAb |
A18229-20ul |
Abclonal |
20 ul |
EUR 183 |
BRD2 Rabbit pAb |
A18229-50ul |
Abclonal |
50 ul |
EUR 223 |
BRD2 Rabbit pAb |
A16241-100ul |
Abclonal |
100 ul |
EUR 308 |
BRD2 Rabbit pAb |
A16241-200ul |
Abclonal |
200 ul |
EUR 459 |
BRD2 Rabbit pAb |
A16241-20ul |
Abclonal |
20 ul |
EUR 183 |
BRD2 Rabbit pAb |
A16241-50ul |
Abclonal |
50 ul |
EUR 223 |
BRD2 Rabbit pAb |
A2233-100ul |
Abclonal |
100 ul |
EUR 308 |
BRD2 Rabbit pAb |
A2233-200ul |
Abclonal |
200 ul |
EUR 459 |
BRD2 Rabbit pAb |
A2233-20ul |
Abclonal |
20 ul |
Ask for price |
BRD2 Rabbit pAb |
A2233-50ul |
Abclonal |
50 ul |
Ask for price |
Polyclonal BRD2 Antibody (Center) |
APR06057G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BRD2 (Center). This antibody is tested and proven to work in the following applications: |
BRD2 Antibody |
49970-100ul |
SAB |
100ul |
EUR 333 |
BRD2 Antibody |
49970-50ul |
SAB |
50ul |
EUR 239 |
BRD2 Antibody |
DF12857 |
Affbiotech |
200ul |
EUR 304 |
Description: BRD2 Antibody detects endogenous levels of BRD2. |
Polyclonal BRD2 antibody - C-terminal region |
APR00570G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BRD2 - C-terminal region. This antibody is tested and proven to work in the following applications: |
BRD2 Conjugated Antibody |
C49970 |
SAB |
100ul |
EUR 397 |
anti- BRD2 antibody |
FNab00946 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500-1:1000
- IP: 1:200-1:1000
- Immunogen: bromodomain containing 2
- Uniprot ID: P25440
- Gene ID: 6046
- Research Area: Metabolism, Developmental biology
|
Description: Antibody raised against BRD2 |
Anti-BRD2 antibody |
STJ29878 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a transcriptional regulator that belongs to the BET (bromodomains and extra terminal domain) family of proteins. This protein associates with transcription complexes and with acetylated chromatin during mitosis, and it selectively binds to the acetylated lysine-12 residue of histone H4 via its two bromodomains. The gene maps to the major histocompatability complex (MHC) class II region on chromosome 6p21.3, but sequence comparison suggests that the protein is not involved in the immune response. This gene has been implicated in juvenile myoclonic epilepsy, a common form of epilepsy that becomes apparent in adolescence. Multiple alternatively spliced variants have been described for this gene. |
Anti-BRD2 antibody |
STJ11100186 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a transcriptional regulator that belongs to the BET (bromodomains and extra terminal domain) family of proteins. This protein associates with transcription complexes and with acetylated chromatin during mitosis, and it selectively binds to the acetylated lysine-12 residue of histone H4 via its two bromodomains. The gene maps to the major histocompatability complex (MHC) class II region on chromosome 6p21.3, but sequence comparison suggests that the protein is not involved in the immune response. This gene has been implicated in juvenile myoclonic epilepsy, a common form of epilepsy that becomes apparent in adolescence. Multiple alternatively spliced variants have been described for this gene. |
Anti-BRD2 antibody |
STJ192932 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to BRD2 |
BRD2 siRNA |
20-abx900667 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
BRD2 siRNA |
20-abx909274 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
BRD2 siRNA |
20-abx909275 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-BRD2 |
YF-PA14402 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to BRD2 |
anti-BRD2 |
YF-PA14403 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to BRD2 |
anti-BRD2 |
YF-PA24585 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to BRD2 |
BRD2 cloning plasmid |
CSB-CL002800HU-10ug |
Cusabio |
10ug |
EUR 812 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2511
- Sequence: atgctgcaaaacgtgactccccacaataagctccctggggaagggaatgcagggttgctggggctgggcccagaagcagcagcaccagggaaaaggattcgaaaaccctctctcttgtatgagggctttgagagccccacaatggcttcggtgcctgctttgcaacttacccctg
- Show more
|
Description: A cloning plasmid for the BRD2 gene. |
BRD2 Blocking Peptide |
6281BP-50 |
Biovision |
|
EUR 153 |
BRD2 Blocking Peptide |
DF12857-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-BRD2 (3D10) |
YF-MA10786 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to BRD2 |
Antibody for Human BRD2 (pSer37) |
SPC-925D |
Stressmarq |
0.1ml |
EUR 354 |
- The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
|
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is unconjugated. |
Antibody for Human BRD2 (pSer37) |
SPC-925D-A390 |
Stressmarq |
0.1ml |
EUR 401 |
- The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
|
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to ATTO 390. |
Antibody for Human BRD2 (pSer37) |
SPC-925D-A488 |
Stressmarq |
0.1ml |
EUR 400 |
- The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
|
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to ATTO 488. |
Antibody for Human BRD2 (pSer37) |
SPC-925D-A565 |
Stressmarq |
0.1ml |
EUR 400 |
- The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
|
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to ATTO 565. |
Antibody for Human BRD2 (pSer37) |
SPC-925D-A594 |
Stressmarq |
0.1ml |
EUR 400 |
- The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
|
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to ATTO 594. |
Antibody for Human BRD2 (pSer37) |
SPC-925D-A633 |
Stressmarq |
0.1ml |
EUR 400 |
- The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
|
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to ATTO 633. |
Antibody for Human BRD2 (pSer37) |
SPC-925D-A655 |
Stressmarq |
0.1ml |
EUR 400 |
- The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
|
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to ATTO 655. |
Antibody for Human BRD2 (pSer37) |
SPC-925D-A680 |
Stressmarq |
0.1ml |
EUR 400 |
- The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
|
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to ATTO 680. |
Antibody for Human BRD2 (pSer37) |
SPC-925D-A700 |
Stressmarq |
0.1ml |
EUR 400 |
- The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
|
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to ATTO 700. |
Antibody for Human BRD2 (pSer37) |
SPC-925D-ALP |
Stressmarq |
0.1ml |
EUR 394 |
- The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
|
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to Alkaline Phosphatase. |
Antibody for Human BRD2 (pSer37) |
SPC-925D-APC |
Stressmarq |
0.1ml |
EUR 399 |
- The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
|
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to APC . |
Antibody for Human BRD2 (pSer37) |
SPC-925D-APCCY7 |
Stressmarq |
0.1ml |
EUR 471 |
- The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
|
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to APC/Cy7. |
Antibody for Human BRD2 (pSer37) |
SPC-925D-BI |
Stressmarq |
0.1ml |
EUR 396 |
- The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
|
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to Biotin. |
Antibody for Human BRD2 (pSer37) |
SPC-925D-DY350 |
Stressmarq |
0.1ml |
EUR 475 |
- The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
|
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to Dylight 350. |
Antibody for Human BRD2 (pSer37) |
SPC-925D-DY405 |
Stressmarq |
0.1ml |
EUR 452 |
- The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
|
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to Dylight 405. |
Antibody for Human BRD2 (pSer37) |
SPC-925D-DY488 |
Stressmarq |
0.1ml |
EUR 432 |
- The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
|
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to Dylight 488. |
Antibody for Human BRD2 (pSer37) |
SPC-925D-DY594 |
Stressmarq |
0.1ml |
EUR 436 |
- The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
|
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to Dylight 594. |
Antibody for Human BRD2 (pSer37) |
SPC-925D-DY633 |
Stressmarq |
0.1ml |
EUR 426 |
- The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
|
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to Dylight 633. |
Antibody for Human BRD2 (pSer37) |
SPC-925D-FITC |
Stressmarq |
0.1ml |
EUR 392 |
- The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
|
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to FITC. |
Antibody for Human BRD2 (pSer37) |
SPC-925D-HRP |
Stressmarq |
0.1ml |
EUR 388 |
- The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
|
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to HRP. |
Antibody for Human BRD2 (pSer37) |
SPC-925D-P594 |
Stressmarq |
0.1ml |
EUR 407 |
- The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
|
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to PE/ATTO 594. |
Antibody for Human BRD2 (pSer37) |
SPC-925D-PCP |
Stressmarq |
0.1ml |
EUR 399 |
- The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
|
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to PerCP. |
Antibody for Human BRD2 (pSer37) |
SPC-925D-RPE |
Stressmarq |
0.1ml |
EUR 397 |
- The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
|
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to RPE . |
Antibody for Human BRD2 (pSer37) |
SPC-925D-STR |
Stressmarq |
0.1ml |
EUR 398 |
- The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
|
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to Streptavidin. |
Rabbit Bromodomain containing protein 2(BRD2) ELISA kit |
E04B0834-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Bromodomain containing protein 2(BRD2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Bromodomain containing protein 2(BRD2) ELISA kit |
E04B0834-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Bromodomain containing protein 2(BRD2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Bromodomain containing protein 2(BRD2) ELISA kit |
E04B0834-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Bromodomain containing protein 2(BRD2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Bromodomain-Containing Protein 2 (BRD2) Antibody |
20-abx123434 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Bromodomain-Containing Protein 2 (BRD2) Antibody |
abx145199-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Bromodomain-Containing Protein 2 (BRD2) Antibody |
abx033841-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Bromodomain-Containing Protein 2 (BRD2) Antibody |
abx033841-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Bromodomain-Containing Protein 2 (BRD2) Antibody |
abx224363-100ug |
Abbexa |
100 ug |
EUR 411 |
- Shipped within 5-10 working days.
|
Bromodomain-Containing Protein 2 (BRD2) Antibody |
abx224465-100ug |
Abbexa |
100 ug |
EUR 411 |
- Shipped within 5-10 working days.
|
Bromodomain-Containing Protein 2 (BRD2) Antibody |
abx230946-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Rat BRD2 shRNA Plasmid |
20-abx988691 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human BRD2 shRNA Plasmid |
20-abx954093 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
BRD2 protein (His tag) |
80R-4011 |
Fitzgerald |
100 ug |
EUR 349 |
Description: Recombinant Human BRD2 protein |
Mouse BRD2 shRNA Plasmid |
20-abx970402 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
BRD2 ORF Vector (Human) (pORF) |
ORF001061 |
ABM |
1.0 ug DNA |
EUR 95 |
Brd2 ORF Vector (Mouse) (pORF) |
ORF039956 |
ABM |
1.0 ug DNA |
EUR 506 |
Brd2 ORF Vector (Mouse) (pORF) |
ORF039957 |
ABM |
1.0 ug DNA |
EUR 506 |
Brd2 ORF Vector (Rat) (pORF) |
ORF064136 |
ABM |
1.0 ug DNA |
EUR 506 |
BRD2 sgRNA CRISPR Lentivector set (Human) |
K0194001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Brd2 sgRNA CRISPR Lentivector set (Mouse) |
K4674101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Brd2 sgRNA CRISPR Lentivector set (Rat) |
K7291101 |
ABM |
3 x 1.0 ug |
EUR 339 |
BRD2-IT1 ORF Vector (Human) (pORF) |
ORF016242 |
ABM |
1.0 ug DNA |
Ask for price |
BRD2 Rabbit Polyclonal Antibody