BRD2 Rabbit Polyclonal Antibody

BRD2 Rabbit Polyclonal Antibody

To Order Now:

BRD2 Polyclonal Antibody
ES11774-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against BRD2. This antibody is tested and validated for WB, ELISA, WB, ELISA
BRD2 Polyclonal Antibody
ABP57923-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human BRD2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of BRD2 from Human. This BRD2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BRD2 protein
BRD2 Polyclonal Antibody
ABP57923-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human BRD2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of BRD2 from Human. This BRD2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BRD2 protein
BRD2 Polyclonal Antibody
ABP57923-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human BRD2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of BRD2 from Human. This BRD2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BRD2 protein
BRD2 polyclonal antibody
EUR 251
Polyclonal BRD2 polyclonal antibody
APR00374G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BRD2 polyclonal . This antibody is tested and proven to work in the following applications:
Polyclonal BRD2 polyclonal antibody
APR00447G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BRD2 polyclonal . This antibody is tested and proven to work in the following applications:
BRD2 Rabbit pAb
A18229-100ul 100 ul
EUR 308
BRD2 Rabbit pAb
A18229-200ul 200 ul
EUR 459
BRD2 Rabbit pAb
A18229-20ul 20 ul
EUR 183
BRD2 Rabbit pAb
A18229-50ul 50 ul
EUR 223
BRD2 Rabbit pAb
A16241-100ul 100 ul
EUR 308
BRD2 Rabbit pAb
A16241-200ul 200 ul
EUR 459
BRD2 Rabbit pAb
A16241-20ul 20 ul
EUR 183
BRD2 Rabbit pAb
A16241-50ul 50 ul
EUR 223
BRD2 Rabbit pAb
A2233-100ul 100 ul
EUR 308
BRD2 Rabbit pAb
A2233-200ul 200 ul
EUR 459
BRD2 Rabbit pAb
A2233-20ul 20 ul Ask for price
BRD2 Rabbit pAb
A2233-50ul 50 ul Ask for price
Polyclonal BRD2 Antibody (Center)
APR06057G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BRD2 (Center). This antibody is tested and proven to work in the following applications:
BRD2 Antibody
49970-100ul 100ul
EUR 333
BRD2 Antibody
49970-50ul 50ul
EUR 239
BRD2 Antibody
EUR 349
BRD2 Antibody
EUR 146
BRD2 Antibody
DF12857 200ul
EUR 304
Description: BRD2 Antibody detects endogenous levels of BRD2.
Polyclonal BRD2 antibody - C-terminal region
APR00570G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BRD2 - C-terminal region. This antibody is tested and proven to work in the following applications:
BRD2 Conjugated Antibody
C49970 100ul
EUR 397
anti- BRD2 antibody
FNab00946 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IP: 1:200-1:1000
  • Immunogen: bromodomain containing 2
  • Uniprot ID: P25440
  • Gene ID: 6046
  • Research Area: Metabolism, Developmental biology
Description: Antibody raised against BRD2
Anti-BRD2 antibody
PAab00946 100 ug
EUR 355
Anti-BRD2 antibody
STJ29878 100 µl
EUR 277
Description: This gene encodes a transcriptional regulator that belongs to the BET (bromodomains and extra terminal domain) family of proteins. This protein associates with transcription complexes and with acetylated chromatin during mitosis, and it selectively binds to the acetylated lysine-12 residue of histone H4 via its two bromodomains. The gene maps to the major histocompatability complex (MHC) class II region on chromosome 6p21.3, but sequence comparison suggests that the protein is not involved in the immune response. This gene has been implicated in juvenile myoclonic epilepsy, a common form of epilepsy that becomes apparent in adolescence. Multiple alternatively spliced variants have been described for this gene.
Anti-BRD2 antibody
STJ11100186 100 µl
EUR 277
Description: This gene encodes a transcriptional regulator that belongs to the BET (bromodomains and extra terminal domain) family of proteins. This protein associates with transcription complexes and with acetylated chromatin during mitosis, and it selectively binds to the acetylated lysine-12 residue of histone H4 via its two bromodomains. The gene maps to the major histocompatability complex (MHC) class II region on chromosome 6p21.3, but sequence comparison suggests that the protein is not involved in the immune response. This gene has been implicated in juvenile myoclonic epilepsy, a common form of epilepsy that becomes apparent in adolescence. Multiple alternatively spliced variants have been described for this gene.
Anti-BRD2 antibody
STJ118693 100 µl
EUR 277
Anti-BRD2 antibody
STJ192932 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to BRD2
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
YF-PA14402 50 ug
EUR 363
Description: Mouse polyclonal to BRD2
YF-PA14403 100 ul
EUR 403
Description: Rabbit polyclonal to BRD2
YF-PA24585 50 ul
EUR 334
Description: Mouse polyclonal to BRD2
BRD2 cloning plasmid
CSB-CL002800HU-10ug 10ug
EUR 812
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2511
  • Sequence: atgctgcaaaacgtgactccccacaataagctccctggggaagggaatgcagggttgctggggctgggcccagaagcagcagcaccagggaaaaggattcgaaaaccctctctcttgtatgagggctttgagagccccacaatggcttcggtgcctgctttgcaacttacccctg
  • Show more
Description: A cloning plasmid for the BRD2 gene.
BRD2 Blocking Peptide
EUR 153
BRD2 Blocking Peptide
DF12857-BP 1mg
EUR 195
Anti-BRD2 (3D10)
YF-MA10786 100 ug
EUR 363
Description: Mouse monoclonal to BRD2
Antibody for Human BRD2 (pSer37)
SPC-925D 0.1ml
EUR 354
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is unconjugated.
Antibody for Human BRD2 (pSer37)
SPC-925D-A390 0.1ml
EUR 401
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to ATTO 390.
Antibody for Human BRD2 (pSer37)
SPC-925D-A488 0.1ml
EUR 400
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to ATTO 488.
Antibody for Human BRD2 (pSer37)
SPC-925D-A565 0.1ml
EUR 400
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to ATTO 565.
Antibody for Human BRD2 (pSer37)
SPC-925D-A594 0.1ml
EUR 400
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to ATTO 594.
Antibody for Human BRD2 (pSer37)
SPC-925D-A633 0.1ml
EUR 400
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to ATTO 633.
Antibody for Human BRD2 (pSer37)
SPC-925D-A655 0.1ml
EUR 400
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to ATTO 655.
Antibody for Human BRD2 (pSer37)
SPC-925D-A680 0.1ml
EUR 400
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to ATTO 680.
Antibody for Human BRD2 (pSer37)
SPC-925D-A700 0.1ml
EUR 400
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to ATTO 700.
Antibody for Human BRD2 (pSer37)
SPC-925D-ALP 0.1ml
EUR 394
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to Alkaline Phosphatase.
Antibody for Human BRD2 (pSer37)
SPC-925D-APC 0.1ml
EUR 399
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to APC .
Antibody for Human BRD2 (pSer37)
SPC-925D-APCCY7 0.1ml
EUR 471
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to APC/Cy7.
Antibody for Human BRD2 (pSer37)
SPC-925D-BI 0.1ml
EUR 396
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to Biotin.
Antibody for Human BRD2 (pSer37)
SPC-925D-DY350 0.1ml
EUR 475
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to Dylight 350.
Antibody for Human BRD2 (pSer37)
SPC-925D-DY405 0.1ml
EUR 452
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to Dylight 405.
Antibody for Human BRD2 (pSer37)
SPC-925D-DY488 0.1ml
EUR 432
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to Dylight 488.
Antibody for Human BRD2 (pSer37)
SPC-925D-DY594 0.1ml
EUR 436
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to Dylight 594.
Antibody for Human BRD2 (pSer37)
SPC-925D-DY633 0.1ml
EUR 426
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to Dylight 633.
Antibody for Human BRD2 (pSer37)
SPC-925D-FITC 0.1ml
EUR 392
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to FITC.
Antibody for Human BRD2 (pSer37)
SPC-925D-HRP 0.1ml
EUR 388
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to HRP.
Antibody for Human BRD2 (pSer37)
SPC-925D-P594 0.1ml
EUR 407
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to PE/ATTO 594.
Antibody for Human BRD2 (pSer37)
SPC-925D-PCP 0.1ml
EUR 399
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to PerCP.
Antibody for Human BRD2 (pSer37)
SPC-925D-RPE 0.1ml
EUR 397
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to RPE .
Antibody for Human BRD2 (pSer37)
SPC-925D-STR 0.1ml
EUR 398
  • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to Streptavidin.
Rabbit Bromodomain containing protein 2(BRD2) ELISA kit
E04B0834-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Bromodomain containing protein 2(BRD2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Bromodomain containing protein 2(BRD2) ELISA kit
E04B0834-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Bromodomain containing protein 2(BRD2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Bromodomain containing protein 2(BRD2) ELISA kit
E04B0834-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Bromodomain containing protein 2(BRD2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Bromodomain-Containing Protein 2 (BRD2) Antibody
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Bromodomain-Containing Protein 2 (BRD2) Antibody
abx145199-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Bromodomain-Containing Protein 2 (BRD2) Antibody
abx033841-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Bromodomain-Containing Protein 2 (BRD2) Antibody
abx033841-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Bromodomain-Containing Protein 2 (BRD2) Antibody
abx224363-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.
Bromodomain-Containing Protein 2 (BRD2) Antibody
abx224465-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.
Bromodomain-Containing Protein 2 (BRD2) Antibody
abx230946-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Rat BRD2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
EF008143 96 Tests
EUR 689
Human BRD2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
BRD2 protein (His tag)
80R-4011 100 ug
EUR 349
Description: Recombinant Human BRD2 protein
Mouse BRD2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
pCMV-SPORT6-BRD2 Plasmid
PVTB00811 2 ug
EUR 356
BRD2 ORF Vector (Human) (pORF)
ORF001061 1.0 ug DNA
EUR 95
Brd2 ORF Vector (Mouse) (pORF)
ORF039956 1.0 ug DNA
EUR 506
Brd2 ORF Vector (Mouse) (pORF)
ORF039957 1.0 ug DNA
EUR 506
Brd2 ORF Vector (Rat) (pORF)
ORF064136 1.0 ug DNA
EUR 506
BRD2 sgRNA CRISPR Lentivector set (Human)
K0194001 3 x 1.0 ug
EUR 339
Brd2 sgRNA CRISPR Lentivector set (Mouse)
K4674101 3 x 1.0 ug
EUR 339
Brd2 sgRNA CRISPR Lentivector set (Rat)
K7291101 3 x 1.0 ug
EUR 339
BRD2-IT1 ORF Vector (Human) (pORF)
ORF016242 1.0 ug DNA Ask for price

BRD2 Rabbit Polyclonal Antibody