ACTN1 Rabbit Polyclonal Antibody

ACTN1 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

ACTN1 Polyclonal Antibody
ABP57700-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ACTN1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ACTN1 from Human. This ACTN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ACTN1 protein
ACTN1 Polyclonal Antibody
ABP57700-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ACTN1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ACTN1 from Human. This ACTN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ACTN1 protein
ACTN1 Polyclonal Antibody
ES11758-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ACTN1. This antibody is tested and validated for WB, ELISA, WB, ELISA
ACTN1 Polyclonal Antibody
ES11758-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ACTN1. This antibody is tested and validated for WB, ELISA, WB, ELISA
ACTN1 Rabbit pAb
A1160-100ul 100 ul
EUR 308
ACTN1 Rabbit pAb
A1160-200ul 200 ul
EUR 459
ACTN1 Rabbit pAb
A1160-20ul 20 ul
EUR 183
ACTN1 Rabbit pAb
A1160-50ul 50 ul
EUR 223
ACTN1 antibody
70R-15567 50 ul
EUR 435
Description: Rabbit polyclonal ACTN1 antibody
ACTN1 Antibody
34156-100ul 100ul
EUR 252
ACTN1 Antibody
34156-50ul 50ul
EUR 187
ACTN1 Antibody
32192-100ul 100ul
EUR 252
ACTN1 antibody
10R-3172 100 ul
EUR 726
Description: Mouse monoclonal ACTN1 antibody
ACTN1 antibody
10R-11454 50 ul
EUR 241
Description: Mouse Monoclonal ACTN1 antibody
ACTN1 Antibody
1-CSB-PA001241GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ACTN1. Recognizes ACTN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
ACTN1 Antibody
1-CSB-PA001241LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACTN1. Recognizes ACTN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:1000-1:5000, IF:1:50-1:200
ACTN1 Antibody
1-CSB-PA070129
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ACTN1. Recognizes ACTN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000
ACTN1 Antibody
1-CSB-PA080241
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against ACTN1. Recognizes ACTN1 from Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:1000-2000.IHC:1:200-500
ACTN1 Antibody
CSB-PA945352-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against ACTN1. Recognizes ACTN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
ACTN1 Antibody
CSB-PA945352-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against ACTN1. Recognizes ACTN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
ACTN1 Antibody
1-CSB-PA906019
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ACTN1. Recognizes ACTN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50
ACTN1 Antibody
DF6294 200ul
EUR 304
Description: ACTN1 Antibody detects endogenous levels of total ACTN1.
ACTN1 antibody
70R-32268 100 ug
EUR 327
Description: Rabbit polyclonal ACTN1 antibody
ACTN1 Antibody
ABD6294 100 ug
EUR 438
ACTN1 Conjugated Antibody
C32192 100ul
EUR 397
Anti-ACTN1 antibody
STJ192916 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ACTN1
Anti-ACTN1 antibody
STJ22500 100 µl
EUR 277
Description: Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a nonmuscle, cytoskeletal, alpha actinin isoform and maps to the same site as the structurally similar erythroid beta spectrin gene. Three transcript variants encoding different isoforms have been found for this gene.
Polyclonal ACTN1 (aa596-609) Antibody (internal region)
APR14794G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ACTN1 (aa596-609) (internal region). This antibody is tested and proven to work in the following applications:
Actinin Alpha 1 (ACTN1) Polyclonal Antibody (Human)
4-PAC236Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ACTN1 (Ala28~Asn260)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Actinin Alpha 1 (ACTN1)
ACTN1 protein
80R-4307 100 ug
EUR 327
Description: Purified Recombinant ACTN1 protein (His tagged)
ACTN1 siRNA
20-abx900153
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ACTN1 siRNA
20-abx906640
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ACTN1 siRNA
20-abx906641
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ACTN1 Antibody, HRP conjugated
1-CSB-PA001241LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACTN1. Recognizes ACTN1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
ACTN1 Antibody, FITC conjugated
1-CSB-PA001241LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACTN1. Recognizes ACTN1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
ACTN1 Antibody, Biotin conjugated
1-CSB-PA001241LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ACTN1. Recognizes ACTN1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Actinin Alpha 1 (ACTN1) Polyclonal Antibody (Human), APC
4-PAC236Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ACTN1 (Ala28~Asn260)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Actinin Alpha 1 (ACTN1). This antibody is labeled with APC.
Actinin Alpha 1 (ACTN1) Polyclonal Antibody (Human), Biotinylated
4-PAC236Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ACTN1 (Ala28~Asn260)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Actinin Alpha 1 (ACTN1). This antibody is labeled with Biotin.
Actinin Alpha 1 (ACTN1) Polyclonal Antibody (Human), Cy3
4-PAC236Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ACTN1 (Ala28~Asn260)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Actinin Alpha 1 (ACTN1). This antibody is labeled with Cy3.
Actinin Alpha 1 (ACTN1) Polyclonal Antibody (Human), FITC
4-PAC236Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ACTN1 (Ala28~Asn260)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Actinin Alpha 1 (ACTN1). This antibody is labeled with FITC.
Actinin Alpha 1 (ACTN1) Polyclonal Antibody (Human), HRP
4-PAC236Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ACTN1 (Ala28~Asn260)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Actinin Alpha 1 (ACTN1). This antibody is labeled with HRP.
Actinin Alpha 1 (ACTN1) Polyclonal Antibody (Human), PE
4-PAC236Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ACTN1 (Ala28~Asn260)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Actinin Alpha 1 (ACTN1). This antibody is labeled with PE.
ACTN1 Blocking Peptide
DF6294-BP 1mg
EUR 195
ACTN1 Blocking Peptide
20-abx061810
  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
ACTN1 cloning plasmid
CSB-CL001241HU-10ug 10ug
EUR 860
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2679
  • Sequence: atggaccattatgattctcagcaaaccaacgattacatgcagccagaagaggactgggaccgggacctgctcctggacccggcctgggagaagcagcagagaaagacattcacggcatggtgtaactcccacctccggaaggcggggacacagatcgagaacatcgaagaggact
  • Show more
Description: A cloning plasmid for the ACTN1 gene.
Anti-ACTN1 (3F1)
YF-MA20269 200 ul
EUR 363
Description: Mouse monoclonal to ACTN1
ACTN1/2/3/4 Antibody
47879-100ul 100ul
EUR 252
ACTN1/2/3/4 Antibody
45407-100ul 100ul
EUR 252
ACTN1/2/3/4 Antibody
45407-50ul 50ul
EUR 187
ACTN1/ACTN2/ACTN3/ACTN4 Antibody
1-CSB-PA000814
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ACTN1/ACTN2/ACTN3/ACTN4. Recognizes ACTN1/ACTN2/ACTN3/ACTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000
ACTN1/ACTN2/ACTN3/ACTN4 Antibody
CSB-PA096347-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against ACTN1/ACTN2/ACTN3/ACTN4. Recognizes ACTN1/ACTN2/ACTN3/ACTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
ACTN1/ACTN2/ACTN3/ACTN4 Antibody
CSB-PA096347-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against ACTN1/ACTN2/ACTN3/ACTN4. Recognizes ACTN1/ACTN2/ACTN3/ACTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
ACTN1/2/3/4 Antibody
DF8633 200ul
EUR 304
Description: ACTN1/2/3/4 Antibody detects endogenous levels of total ACTN1/2/3/4.
ACTN1/2/3/4 antibody
70R-51785 100 ul
EUR 244
Description: Purified Polyclonal ACTN1/2/3/4 antibody
Actinin Alpha 1 (ACTN1) Antibody
20-abx213695
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Actinin Alpha 1 (ACTN1) Antibody
20-abx110774
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Actinin Alpha 1 (ACTN1) Antibody
20-abx130638
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
ACTN1 / 2 / 3 / 4 Antibody
20-abx133831
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Alpha Actinin 1 (ACTN1) Antibody
20-abx133859
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Alpha Actinin 1 (ACTN1) Antibody
abx122374-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
ACTN1 / 2 / 3 / 4 Antibody
20-abx147842
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Actinin Alpha 1 (ACTN1) Antibody
20-abx159318
  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Alpha Actinin 1 (ACTN1) Antibody
20-abx141112
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Alpha Actinin 1 (ACTN1) Antibody
20-abx013891
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
ACTN1 / 2 / 3 / 4 Antibody
20-abx013893
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
Alpha Actinin 1 (ACTN1) Antibody
abx239833-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Actinin Alpha 1 (ACTN1) Antibody
20-abx330218
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
ACTN1 / ACTN2 / ACTN3 / ACTN4 Antibody
abx332562-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
Actinin Alpha 1 (ACTN1) Antibody
20-abx327894
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
ACTN1 / ACTN2 / ACTN3 / ACTN4 Antibody
20-abx328684
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Actinin Alpha 1 (ACTN1) Antibody
abx332763-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
Alpha Actinin 1 (ACTN1) Antibody
abx431046-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
ACTN1/2/3/4 Antibody
ABD8633 100 ug
EUR 438
Alpha Actinin 1 (ACTN1) Antibody
20-abx001074
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Anti-ACTN1 (aa596-609) antibody
STJ73407 100 µg
EUR 359

ACTN1 Rabbit Polyclonal Antibody