ACTN1 Rabbit Polyclonal Antibody
To Order Now: info@poweratlas.org
ACTN1 Polyclonal Antibody |
ABP57700-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human ACTN1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of ACTN1 from Human. This ACTN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ACTN1 protein |
ACTN1 Polyclonal Antibody |
ABP57700-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human ACTN1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of ACTN1 from Human. This ACTN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ACTN1 protein |
ACTN1 Polyclonal Antibody |
ES11758-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ACTN1. This antibody is tested and validated for WB, ELISA, WB, ELISA |
ACTN1 Polyclonal Antibody |
ES11758-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ACTN1. This antibody is tested and validated for WB, ELISA, WB, ELISA |
ACTN1 Rabbit pAb |
A1160-100ul |
Abclonal |
100 ul |
EUR 308 |
ACTN1 Rabbit pAb |
A1160-200ul |
Abclonal |
200 ul |
EUR 459 |
ACTN1 Rabbit pAb |
A1160-20ul |
Abclonal |
20 ul |
EUR 183 |
ACTN1 Rabbit pAb |
A1160-50ul |
Abclonal |
50 ul |
EUR 223 |
ACTN1 antibody |
70R-15567 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal ACTN1 antibody |
ACTN1 Antibody |
34156-100ul |
SAB |
100ul |
EUR 252 |
ACTN1 Antibody |
34156-50ul |
SAB |
50ul |
EUR 187 |
ACTN1 Antibody |
32192-100ul |
SAB |
100ul |
EUR 252 |
ACTN1 antibody |
10R-3172 |
Fitzgerald |
100 ul |
EUR 726 |
Description: Mouse monoclonal ACTN1 antibody |
ACTN1 antibody |
10R-11454 |
Fitzgerald |
50 ul |
EUR 241 |
Description: Mouse Monoclonal ACTN1 antibody |
ACTN1 Antibody |
1-CSB-PA001241GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against ACTN1. Recognizes ACTN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
ACTN1 Antibody |
1-CSB-PA001241LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ACTN1. Recognizes ACTN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:1000-1:5000, IF:1:50-1:200 |
ACTN1 Antibody |
1-CSB-PA070129 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against ACTN1. Recognizes ACTN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000 |
ACTN1 Antibody |
1-CSB-PA080241 |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
|
Description: A polyclonal antibody against ACTN1. Recognizes ACTN1 from Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:1000-2000.IHC:1:200-500 |
ACTN1 Antibody |
CSB-PA945352- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against ACTN1. Recognizes ACTN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
ACTN1 Antibody |
CSB-PA945352-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against ACTN1. Recognizes ACTN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
ACTN1 Antibody |
1-CSB-PA906019 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against ACTN1. Recognizes ACTN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50 |
ACTN1 Antibody |
DF6294 |
Affbiotech |
200ul |
EUR 304 |
Description: ACTN1 Antibody detects endogenous levels of total ACTN1. |
ACTN1 antibody |
70R-32268 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal ACTN1 antibody |
ACTN1 Conjugated Antibody |
C32192 |
SAB |
100ul |
EUR 397 |
Anti-ACTN1 antibody |
STJ192916 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to ACTN1 |
Anti-ACTN1 antibody |
STJ22500 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a nonmuscle, cytoskeletal, alpha actinin isoform and maps to the same site as the structurally similar erythroid beta spectrin gene. Three transcript variants encoding different isoforms have been found for this gene. |
Polyclonal ACTN1 (aa596-609) Antibody (internal region) |
APR14794G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ACTN1 (aa596-609) (internal region). This antibody is tested and proven to work in the following applications: |
Actinin Alpha 1 (ACTN1) Polyclonal Antibody (Human) |
4-PAC236Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ACTN1 (Ala28~Asn260)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Actinin Alpha 1 (ACTN1) |
ACTN1 protein |
80R-4307 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Purified Recombinant ACTN1 protein (His tagged) |
ACTN1 siRNA |
20-abx900153 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ACTN1 siRNA |
20-abx906640 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ACTN1 siRNA |
20-abx906641 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ACTN1 Antibody, HRP conjugated |
1-CSB-PA001241LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ACTN1. Recognizes ACTN1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
ACTN1 Antibody, FITC conjugated |
1-CSB-PA001241LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ACTN1. Recognizes ACTN1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
ACTN1 Antibody, Biotin conjugated |
1-CSB-PA001241LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ACTN1. Recognizes ACTN1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Actinin Alpha 1 (ACTN1) Polyclonal Antibody (Human), APC |
4-PAC236Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ACTN1 (Ala28~Asn260)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Actinin Alpha 1 (ACTN1). This antibody is labeled with APC. |
Actinin Alpha 1 (ACTN1) Polyclonal Antibody (Human), Biotinylated |
4-PAC236Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ACTN1 (Ala28~Asn260)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Actinin Alpha 1 (ACTN1). This antibody is labeled with Biotin. |
Actinin Alpha 1 (ACTN1) Polyclonal Antibody (Human), Cy3 |
4-PAC236Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ACTN1 (Ala28~Asn260)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Actinin Alpha 1 (ACTN1). This antibody is labeled with Cy3. |
Actinin Alpha 1 (ACTN1) Polyclonal Antibody (Human), FITC |
4-PAC236Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ACTN1 (Ala28~Asn260)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Actinin Alpha 1 (ACTN1). This antibody is labeled with FITC. |
Actinin Alpha 1 (ACTN1) Polyclonal Antibody (Human), HRP |
4-PAC236Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ACTN1 (Ala28~Asn260)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Actinin Alpha 1 (ACTN1). This antibody is labeled with HRP. |
Actinin Alpha 1 (ACTN1) Polyclonal Antibody (Human), PE |
4-PAC236Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ACTN1 (Ala28~Asn260)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Actinin Alpha 1 (ACTN1). This antibody is labeled with PE. |
ACTN1 Blocking Peptide |
DF6294-BP |
Affbiotech |
1mg |
EUR 195 |
ACTN1 Blocking Peptide |
20-abx061810 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ACTN1 cloning plasmid |
CSB-CL001241HU-10ug |
Cusabio |
10ug |
EUR 860 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2679
- Sequence: atggaccattatgattctcagcaaaccaacgattacatgcagccagaagaggactgggaccgggacctgctcctggacccggcctgggagaagcagcagagaaagacattcacggcatggtgtaactcccacctccggaaggcggggacacagatcgagaacatcgaagaggact
- Show more
|
Description: A cloning plasmid for the ACTN1 gene. |
Anti-ACTN1 (3F1) |
YF-MA20269 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to ACTN1 |
ACTN1/2/3/4 Antibody |
47879-100ul |
SAB |
100ul |
EUR 252 |
ACTN1/2/3/4 Antibody |
45407-100ul |
SAB |
100ul |
EUR 252 |
ACTN1/2/3/4 Antibody |
45407-50ul |
SAB |
50ul |
EUR 187 |
ACTN1/ACTN2/ACTN3/ACTN4 Antibody |
1-CSB-PA000814 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against ACTN1/ACTN2/ACTN3/ACTN4. Recognizes ACTN1/ACTN2/ACTN3/ACTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000 |
ACTN1/ACTN2/ACTN3/ACTN4 Antibody |
CSB-PA096347- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against ACTN1/ACTN2/ACTN3/ACTN4. Recognizes ACTN1/ACTN2/ACTN3/ACTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
ACTN1/ACTN2/ACTN3/ACTN4 Antibody |
CSB-PA096347-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against ACTN1/ACTN2/ACTN3/ACTN4. Recognizes ACTN1/ACTN2/ACTN3/ACTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
ACTN1/2/3/4 Antibody |
DF8633 |
Affbiotech |
200ul |
EUR 304 |
Description: ACTN1/2/3/4 Antibody detects endogenous levels of total ACTN1/2/3/4. |
ACTN1/2/3/4 antibody |
70R-51785 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal ACTN1/2/3/4 antibody |
Actinin Alpha 1 (ACTN1) Antibody |
20-abx213695 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Actinin Alpha 1 (ACTN1) Antibody |
20-abx110774 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Actinin Alpha 1 (ACTN1) Antibody |
20-abx130638 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
ACTN1 / 2 / 3 / 4 Antibody |
20-abx133831 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Alpha Actinin 1 (ACTN1) Antibody |
20-abx133859 |
Abbexa |
-
EUR 356.00
-
EUR 537.00
-
EUR 217.00
|
|
- Shipped within 5-10 working days.
|
Alpha Actinin 1 (ACTN1) Antibody |
abx122374-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
ACTN1 / 2 / 3 / 4 Antibody |
20-abx147842 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Actinin Alpha 1 (ACTN1) Antibody |
20-abx159318 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Alpha Actinin 1 (ACTN1) Antibody |
20-abx141112 |
Abbexa |
-
EUR 356.00
-
EUR 537.00
-
EUR 217.00
|
|
- Shipped within 5-10 working days.
|
Alpha Actinin 1 (ACTN1) Antibody |
20-abx013891 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
ACTN1 / 2 / 3 / 4 Antibody |
20-abx013893 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
Alpha Actinin 1 (ACTN1) Antibody |
abx239833-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Actinin Alpha 1 (ACTN1) Antibody |
20-abx330218 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ACTN1 / ACTN2 / ACTN3 / ACTN4 Antibody |
abx332562-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Actinin Alpha 1 (ACTN1) Antibody |
20-abx327894 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ACTN1 / ACTN2 / ACTN3 / ACTN4 Antibody |
20-abx328684 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Actinin Alpha 1 (ACTN1) Antibody |
abx332763-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Alpha Actinin 1 (ACTN1) Antibody |
abx431046-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Alpha Actinin 1 (ACTN1) Antibody |
20-abx001074 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
ACTN1 Rabbit Polyclonal Antibody