MOAP1 Rabbit Polyclonal Antibody
To Order Now: info@poweratlas.org
 MOAP1 Polyclonal Antibody |
|
ABP59300-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human MOAP1 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of MOAP1 from Human. This MOAP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MOAP1 protein |
MOAP1 Polyclonal Antibody |
|
ABP59300-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human MOAP1 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of MOAP1 from Human. This MOAP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MOAP1 protein |
MOAP1 Polyclonal Antibody |
|
ABP59300-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human MOAP1 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of MOAP1 from Human. This MOAP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MOAP1 protein |
MOAP1 Polyclonal Antibody |
|
30664-100ul |
SAB |
100ul |
EUR 252 |
MOAP1 Polyclonal Antibody |
|
30664-50ul |
SAB |
50ul |
EUR 187 |
MOAP1 Polyclonal Antibody |
|
27726-100ul |
SAB |
100ul |
EUR 252 |
MOAP1 Polyclonal Antibody |
|
27726-50ul |
SAB |
50ul |
EUR 187 |
 MOAP1 Rabbit pAb |
|
A12599-100ul |
Abclonal |
100 ul |
EUR 308 |
MOAP1 Rabbit pAb |
|
A12599-200ul |
Abclonal |
200 ul |
EUR 459 |
MOAP1 Rabbit pAb |
|
A12599-20ul |
Abclonal |
20 ul |
EUR 183 |
MOAP1 Rabbit pAb |
|
A12599-50ul |
Abclonal |
50 ul |
EUR 223 |
MOAP1 Rabbit pAb |
|
A5759-100ul |
Abclonal |
100 ul |
EUR 308 |
MOAP1 Rabbit pAb |
|
A5759-200ul |
Abclonal |
200 ul |
EUR 459 |
MOAP1 Rabbit pAb |
|
A5759-20ul |
Abclonal |
20 ul |
EUR 183 |
MOAP1 Rabbit pAb |
|
A5759-50ul |
Abclonal |
50 ul |
EUR 223 |
 MOAP1 Polyclonal Conjugated Antibody |
|
C30664 |
SAB |
100ul |
EUR 397 |
MOAP1 Polyclonal Conjugated Antibody |
|
C27726 |
SAB |
100ul |
EUR 397 |
 MOAP1 Antibody |
|
1-CSB-PA014693ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against MOAP1. Recognizes MOAP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
) Polyclonal MOAP1 / MAP1 Antibody (Internal) |
|
APR02274G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MOAP1 / MAP1 (Internal). This antibody is tested and proven to work in the following applications: |
 Anti-MOAP1 antibody |
|
STJ28326 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: The protein encoded by this gene was identified by its interaction with apoptosis regulator BAX protein. This protein contains a Bcl-2 homology 3 (BH3)-like motif, which is required for the association with BAX. When overexpressed, this gene has been shown to mediate caspase-dependent apoptosis. |
Anti-MOAP1 antibody |
|
STJ114473 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: The protein encoded by this gene was identified by its interaction with apoptosis regulator BAX protein. This protein contains a Bcl-2 homology 3 (BH3)-like motif, which is required for the association with BAX. When overexpressed, this gene has been shown to mediate caspase-dependent apoptosis. |
Anti-MOAP1 antibody |
|
STJ192961 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to MOAP1 |
 MOAP1 siRNA |
|
20-abx924354 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MOAP1 siRNA |
|
20-abx924355 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 polyclonal antibody) Modulator of apoptosis 1 (MOAP1) polyclonal antibody |
|
ABP-PAB-10271 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Apoptosis
- Brand:
|
 MOAP1 cloning plasmid |
|
CSB-CL014693HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1056
- Sequence: atgactttgaggcttttagaagactggtgcagggggatggacatgaaccctcggaaagcgctattgattgccggcatctcccagagctgcagtgtggcagaaatcgaggaggctctgcaggctggtttagctcccttgggggagtacagactgcttggaaggatgttcaggaggg
- Show more
|
|
Description: A cloning plasmid for the MOAP1 gene. |
 Mouse MOAP1 shRNA Plasmid |
|
20-abx975258 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) MOAP1 protein (His tag) |
|
80R-3537 |
Fitzgerald |
100 ug |
EUR 424 |
|
Description: Purified recombinant MOAP1 protein (His tag) |
 Human MOAP1 shRNA Plasmid |
|
20-abx961927 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) MOAP1 Recombinant Protein (Human) |
|
RP019669 |
ABM |
100 ug |
Ask for price |
) MOAP1 Recombinant Protein (Rat) |
|
RP212006 |
ABM |
100 ug |
Ask for price |
) MOAP1 Recombinant Protein (Mouse) |
|
RP151040 |
ABM |
100 ug |
Ask for price |
MOAP1 Recombinant Protein (Mouse) |
|
RP151043 |
ABM |
100 ug |
Ask for price |
 Antibody) Modulator of Apoptosis 1 (MOAP1) Antibody |
|
20-abx006312 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Modulator of Apoptosis 1 (MOAP1) Antibody |
|
20-abx321726 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 (M01), Clone: 4A11) Monoclonal MOAP1 Antibody (monoclonal) (M01), Clone: 4A11 |
|
AMM03806G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human MOAP1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 4A11. This antibody is applicable in WB, E |
 (pORF)) MOAP1 ORF Vector (Human) (pORF) |
|
ORF006557 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Moap1 ORF Vector (Mouse) (pORF) |
|
ORF050348 |
ABM |
1.0 ug DNA |
EUR 506 |
Moap1 ORF Vector (Mouse) (pORF) |
|
ORF050349 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Moap1 ORF Vector (Rat) (pORF) |
|
ORF070670 |
ABM |
1.0 ug DNA |
EUR 506 |
 IgG (aff pure)) Rabbit Anti-Mouse modulator of apoptosis 1 (MOAP1) IgG (aff pure) |
|
AB-23039-A |
Alpha Diagnostics |
100ug |
EUR 482 |
) MOAP1 sgRNA CRISPR Lentivector set (Human) |
|
K1314501 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Moap1 sgRNA CRISPR Lentivector set (Mouse) |
|
K3558001 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Human Modulator of apoptosis 1 (MOAP1) |
|
1-CSB-EP014693HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 66.5 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
|
Description: Recombinant Human Modulator of apoptosis 1(MOAP1) expressed in E.coli |
) Moap1 sgRNA CRISPR Lentivector set (Rat) |
|
K7145501 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) MOAP1 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1314502 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) MOAP1 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1314503 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) MOAP1 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1314504 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Moap1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3558002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Moap1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3558003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Moap1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3558004 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Moap1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K7145502 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Moap1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K7145503 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Moap1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K7145504 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) MOAP1 Protein Vector (Rat) (pPB-C-His) |
|
PV282678 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) MOAP1 Protein Vector (Rat) (pPB-N-His) |
|
PV282679 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) MOAP1 Protein Vector (Rat) (pPM-C-HA) |
|
PV282680 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) MOAP1 Protein Vector (Rat) (pPM-C-His) |
|
PV282681 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) MOAP1 Protein Vector (Human) (pPB-C-His) |
|
PV026225 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) MOAP1 Protein Vector (Human) (pPB-N-His) |
|
PV026226 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) MOAP1 Protein Vector (Human) (pPM-C-HA) |
|
PV026227 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) MOAP1 Protein Vector (Human) (pPM-C-His) |
|
PV026228 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) MOAP1 Protein Vector (Mouse) (pPB-C-His) |
|
PV201390 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) MOAP1 Protein Vector (Mouse) (pPB-N-His) |
|
PV201391 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) MOAP1 Protein Vector (Mouse) (pPM-C-HA) |
|
PV201392 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) MOAP1 Protein Vector (Mouse) (pPM-C-His) |
|
PV201393 |
ABM |
500 ng |
EUR 603 |
MOAP1 Protein Vector (Mouse) (pPB-C-His) |
|
PV201394 |
ABM |
500 ng |
EUR 603 |
MOAP1 Protein Vector (Mouse) (pPB-N-His) |
|
PV201395 |
ABM |
500 ng |
EUR 603 |
MOAP1 Protein Vector (Mouse) (pPM-C-HA) |
|
PV201396 |
ABM |
500 ng |
EUR 603 |
MOAP1 Protein Vector (Mouse) (pPM-C-His) |
|
PV201397 |
ABM |
500 ng |
EUR 603 |
 Moap1 3'UTR GFP Stable Cell Line |
|
TU163304 |
ABM |
1.0 ml |
Ask for price |
 Moap1 3'UTR Luciferase Stable Cell Line |
|
TU213289 |
ABM |
1.0 ml |
Ask for price |
 MOAP1 3'UTR Luciferase Stable Cell Line |
|
TU014417 |
ABM |
1.0 ml |
EUR 2333 |
Moap1 3'UTR Luciferase Stable Cell Line |
|
TU113304 |
ABM |
1.0 ml |
Ask for price |
 MOAP1 3'UTR GFP Stable Cell Line |
|
TU064417 |
ABM |
1.0 ml |
EUR 2333 |
Moap1 3'UTR GFP Stable Cell Line |
|
TU263289 |
ABM |
1.0 ml |
Ask for price |
 Human Modulator of apoptosis 1, MOAP1 ELISA KIT |
|
ELI-20830h |
Lifescience Market |
96 Tests |
EUR 824 |
 Mouse Modulator of apoptosis 1, Moap1 ELISA KIT |
|
ELI-20831m |
Lifescience Market |
96 Tests |
EUR 865 |
 ELISA Kit) Human Modulator of apoptosis 1 (MOAP1) ELISA Kit |
|
abx385167-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Mouse Modulator of apoptosis 1 (MOAP1) ELISA Kit |
|
abx389916-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 (CMV) (pLenti-GIII-CMV)) MOAP1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV627283 |
ABM |
1.0 ug DNA |
EUR 682 |
 (UbC) (pLenti-GIII-UbC)) MOAP1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV627287 |
ABM |
1.0 ug DNA |
EUR 682 |
 (EF1a) (pLenti-GIII-EF1a)) MOAP1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV627288 |
ABM |
1.0 ug DNA |
EUR 682 |
 MOAP1 Modulator Of Apoptosis 1 Human Recombinant Protein |
|
PROTQ96BY2 |
BosterBio |
Regular: 20ug |
EUR 317 |
|
Description: MOAP1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 374 amino acids (1-351a.a) and having a molecular mass of 41.9kDa.MOAP1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MOAP1 Rabbit Polyclonal Antibody
