MOAP1 Rabbit Polyclonal Antibody

MOAP1 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

MOAP1 Polyclonal Antibody

ABP59300-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human MOAP1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of MOAP1 from Human. This MOAP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MOAP1 protein

MOAP1 Polyclonal Antibody

ABP59300-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MOAP1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of MOAP1 from Human. This MOAP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MOAP1 protein

MOAP1 Polyclonal Antibody

ABP59300-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MOAP1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of MOAP1 from Human. This MOAP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MOAP1 protein

MOAP1 Polyclonal Antibody

30664-100ul 100ul
EUR 252

MOAP1 Polyclonal Antibody

30664-50ul 50ul
EUR 187

MOAP1 Polyclonal Antibody

27726-100ul 100ul
EUR 252

MOAP1 Polyclonal Antibody

27726-50ul 50ul
EUR 187

MOAP1 Rabbit pAb

A12599-100ul 100 ul
EUR 308

MOAP1 Rabbit pAb

A12599-200ul 200 ul
EUR 459

MOAP1 Rabbit pAb

A12599-20ul 20 ul
EUR 183

MOAP1 Rabbit pAb

A12599-50ul 50 ul
EUR 223

MOAP1 Rabbit pAb

A5759-100ul 100 ul
EUR 308

MOAP1 Rabbit pAb

A5759-200ul 200 ul
EUR 459

MOAP1 Rabbit pAb

A5759-20ul 20 ul
EUR 183

MOAP1 Rabbit pAb

A5759-50ul 50 ul
EUR 223

MOAP1 Polyclonal Conjugated Antibody

C30664 100ul
EUR 397

MOAP1 Polyclonal Conjugated Antibody

C27726 100ul
EUR 397

MOAP1 Antibody

1-CSB-PA014693ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MOAP1. Recognizes MOAP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

Polyclonal MOAP1 / MAP1 Antibody (Internal)

APR02274G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MOAP1 / MAP1 (Internal). This antibody is tested and proven to work in the following applications:

Anti-MOAP1 antibody

STJ28326 100 µl
EUR 277
Description: The protein encoded by this gene was identified by its interaction with apoptosis regulator BAX protein. This protein contains a Bcl-2 homology 3 (BH3)-like motif, which is required for the association with BAX. When overexpressed, this gene has been shown to mediate caspase-dependent apoptosis.

Anti-MOAP1 antibody

STJ114473 100 µl
EUR 277
Description: The protein encoded by this gene was identified by its interaction with apoptosis regulator BAX protein. This protein contains a Bcl-2 homology 3 (BH3)-like motif, which is required for the association with BAX. When overexpressed, this gene has been shown to mediate caspase-dependent apoptosis.

Anti-MOAP1 antibody

STJ192961 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MOAP1

MOAP1 siRNA

20-abx924354
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MOAP1 siRNA

20-abx924355
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Modulator of apoptosis 1 (MOAP1) polyclonal antibody

ABP-PAB-10271 100 ug Ask for price
    • Product line: Apoptosis
    • Brand:

MOAP1 cloning plasmid

CSB-CL014693HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1056
  • Sequence: atgactttgaggcttttagaagactggtgcagggggatggacatgaaccctcggaaagcgctattgattgccggcatctcccagagctgcagtgtggcagaaatcgaggaggctctgcaggctggtttagctcccttgggggagtacagactgcttggaaggatgttcaggaggg
  • Show more
Description: A cloning plasmid for the MOAP1 gene.

pCMV-SPORT6-MOAP1

PVT13194 2 ug
EUR 391

Mouse MOAP1 shRNA Plasmid

20-abx975258
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MOAP1 ELISA KIT|Human

EF005290 96 Tests
EUR 689

MOAP1 protein (His tag)

80R-3537 100 ug
EUR 424
Description: Purified recombinant MOAP1 protein (His tag)

Human MOAP1 shRNA Plasmid

20-abx961927
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MOAP1 Recombinant Protein (Human)

RP019669 100 ug Ask for price

MOAP1 Recombinant Protein (Rat)

RP212006 100 ug Ask for price

MOAP1 Recombinant Protein (Mouse)

RP151040 100 ug Ask for price

MOAP1 Recombinant Protein (Mouse)

RP151043 100 ug Ask for price

Modulator of Apoptosis 1 (MOAP1) Antibody

20-abx006312
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Modulator of Apoptosis 1 (MOAP1) Antibody

20-abx321726
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Monoclonal MOAP1 Antibody (monoclonal) (M01), Clone: 4A11

AMM03806G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human MOAP1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 4A11. This antibody is applicable in WB, E

MOAP1 ORF Vector (Human) (pORF)

ORF006557 1.0 ug DNA
EUR 95

Moap1 ORF Vector (Mouse) (pORF)

ORF050348 1.0 ug DNA
EUR 506

Moap1 ORF Vector (Mouse) (pORF)

ORF050349 1.0 ug DNA
EUR 506

Moap1 ORF Vector (Rat) (pORF)

ORF070670 1.0 ug DNA
EUR 506

Rabbit Anti-Mouse modulator of apoptosis 1 (MOAP1) IgG (aff pure)

AB-23039-A 100ug
EUR 482

MOAP1 sgRNA CRISPR Lentivector set (Human)

K1314501 3 x 1.0 ug
EUR 339

Moap1 sgRNA CRISPR Lentivector set (Mouse)

K3558001 3 x 1.0 ug
EUR 339

Human Modulator of apoptosis 1 (MOAP1)

1-CSB-EP014693HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 66.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Modulator of apoptosis 1(MOAP1) expressed in E.coli

Moap1 sgRNA CRISPR Lentivector set (Rat)

K7145501 3 x 1.0 ug
EUR 339

MOAP1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1314502 1.0 ug DNA
EUR 154

MOAP1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1314503 1.0 ug DNA
EUR 154

MOAP1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1314504 1.0 ug DNA
EUR 154

Moap1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3558002 1.0 ug DNA
EUR 154

Moap1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3558003 1.0 ug DNA
EUR 154

Moap1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3558004 1.0 ug DNA
EUR 154

Moap1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7145502 1.0 ug DNA
EUR 154

Moap1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7145503 1.0 ug DNA
EUR 154

Moap1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7145504 1.0 ug DNA
EUR 154

MOAP1 Protein Vector (Rat) (pPB-C-His)

PV282678 500 ng
EUR 603

MOAP1 Protein Vector (Rat) (pPB-N-His)

PV282679 500 ng
EUR 603

MOAP1 Protein Vector (Rat) (pPM-C-HA)

PV282680 500 ng
EUR 603

MOAP1 Protein Vector (Rat) (pPM-C-His)

PV282681 500 ng
EUR 603

MOAP1 Protein Vector (Human) (pPB-C-His)

PV026225 500 ng
EUR 329

MOAP1 Protein Vector (Human) (pPB-N-His)

PV026226 500 ng
EUR 329

MOAP1 Protein Vector (Human) (pPM-C-HA)

PV026227 500 ng
EUR 329

MOAP1 Protein Vector (Human) (pPM-C-His)

PV026228 500 ng
EUR 329

MOAP1 Protein Vector (Mouse) (pPB-C-His)

PV201390 500 ng
EUR 603

MOAP1 Protein Vector (Mouse) (pPB-N-His)

PV201391 500 ng
EUR 603

MOAP1 Protein Vector (Mouse) (pPM-C-HA)

PV201392 500 ng
EUR 603

MOAP1 Protein Vector (Mouse) (pPM-C-His)

PV201393 500 ng
EUR 603

MOAP1 Protein Vector (Mouse) (pPB-C-His)

PV201394 500 ng
EUR 603

MOAP1 Protein Vector (Mouse) (pPB-N-His)

PV201395 500 ng
EUR 603

MOAP1 Protein Vector (Mouse) (pPM-C-HA)

PV201396 500 ng
EUR 603

MOAP1 Protein Vector (Mouse) (pPM-C-His)

PV201397 500 ng
EUR 603

Moap1 3'UTR GFP Stable Cell Line

TU163304 1.0 ml Ask for price

Moap1 3'UTR Luciferase Stable Cell Line

TU213289 1.0 ml Ask for price

MOAP1 3'UTR Luciferase Stable Cell Line

TU014417 1.0 ml
EUR 2333

Moap1 3'UTR Luciferase Stable Cell Line

TU113304 1.0 ml Ask for price

MOAP1 3'UTR GFP Stable Cell Line

TU064417 1.0 ml
EUR 2333

Moap1 3'UTR GFP Stable Cell Line

TU263289 1.0 ml Ask for price

Human Modulator of apoptosis 1, MOAP1 ELISA KIT

ELI-20830h 96 Tests
EUR 824

Mouse Modulator of apoptosis 1, Moap1 ELISA KIT

ELI-20831m 96 Tests
EUR 865

Human Modulator of apoptosis 1 (MOAP1) ELISA Kit

abx385167-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Modulator of apoptosis 1 (MOAP1) ELISA Kit

abx389916-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

MOAP1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV627283 1.0 ug DNA
EUR 682

MOAP1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV627287 1.0 ug DNA
EUR 682

MOAP1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV627288 1.0 ug DNA
EUR 682

MOAP1 Modulator Of Apoptosis 1 Human Recombinant Protein

PROTQ96BY2 Regular: 20ug
EUR 317
Description: MOAP1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 374 amino acids (1-351a.a) and having a molecular mass of 41.9kDa.MOAP1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MOAP1 Rabbit Polyclonal Antibody