MOAP1 Rabbit Polyclonal Antibody

MOAP1 Rabbit Polyclonal Antibody

To Order Now:

MOAP1 Polyclonal Antibody

27726-100ul 100ul
EUR 252

MOAP1 Polyclonal Antibody

27726-50ul 50ul
EUR 187

MOAP1 Polyclonal Antibody

ABP59300-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human MOAP1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of MOAP1 from Human. This MOAP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MOAP1 protein

MOAP1 Polyclonal Antibody

ABP59300-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MOAP1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of MOAP1 from Human. This MOAP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MOAP1 protein

MOAP1 Polyclonal Antibody

ABP59300-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MOAP1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of MOAP1 from Human. This MOAP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MOAP1 protein

MOAP1 Polyclonal Antibody

ES11803-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MOAP1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

MOAP1 Polyclonal Antibody

ES11803-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MOAP1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

MOAP1 Rabbit pAb

A12599-100ul 100 ul
EUR 308

MOAP1 Rabbit pAb

A12599-200ul 200 ul
EUR 459

MOAP1 Rabbit pAb

A12599-20ul 20 ul
EUR 183

MOAP1 Rabbit pAb

A12599-50ul 50 ul
EUR 223

MOAP1 Rabbit pAb

A5759-100ul 100 ul
EUR 308

MOAP1 Rabbit pAb

A5759-200ul 200 ul
EUR 459

MOAP1 Rabbit pAb

A5759-20ul 20 ul
EUR 183

MOAP1 Rabbit pAb

A5759-50ul 50 ul
EUR 223

MOAP1 Polyclonal Conjugated Antibody

C27726 100ul
EUR 397

MOAP1 Polyclonal Conjugated Antibody

C30664 100ul
EUR 397

MOAP1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MOAP1. Recognizes MOAP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

Polyclonal MOAP1 / MAP1 Antibody (Internal)

APR02274G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MOAP1 / MAP1 (Internal). This antibody is tested and proven to work in the following applications:

Anti-MOAP1 antibody

STJ28326 100 µl
EUR 277
Description: The protein encoded by this gene was identified by its interaction with apoptosis regulator BAX protein. This protein contains a Bcl-2 homology 3 (BH3)-like motif, which is required for the association with BAX. When overexpressed, this gene has been shown to mediate caspase-dependent apoptosis.

Anti-MOAP1 antibody

STJ114473 100 µl
EUR 277
Description: The protein encoded by this gene was identified by its interaction with apoptosis regulator BAX protein. This protein contains a Bcl-2 homology 3 (BH3)-like motif, which is required for the association with BAX. When overexpressed, this gene has been shown to mediate caspase-dependent apoptosis.

Anti-MOAP1 antibody

STJ192961 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MOAP1


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Modulator of apoptosis 1 (MOAP1) polyclonal antibody

ABP-PAB-10271 100 ug Ask for price
    • Product line: Apoptosis
    • Brand:

MOAP1 cloning plasmid

CSB-CL014693HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1056
  • Sequence: atgactttgaggcttttagaagactggtgcagggggatggacatgaaccctcggaaagcgctattgattgccggcatctcccagagctgcagtgtggcagaaatcgaggaggctctgcaggctggtttagctcccttgggggagtacagactgcttggaaggatgttcaggaggg
  • Show more
Description: A cloning plasmid for the MOAP1 gene.


PVT13194 2 ug
EUR 391

MOAP1 protein (His tag)

80R-3537 100 ug
EUR 424
Description: Purified recombinant MOAP1 protein (His tag)


EF005290 96 Tests
EUR 689

Mouse MOAP1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human MOAP1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MOAP1 Recombinant Protein (Human)

RP019669 100 ug Ask for price

MOAP1 Recombinant Protein (Mouse)

RP151040 100 ug Ask for price

MOAP1 Recombinant Protein (Mouse)

RP151043 100 ug Ask for price

MOAP1 Recombinant Protein (Rat)

RP212006 100 ug Ask for price

Modulator of Apoptosis 1 (MOAP1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Modulator of Apoptosis 1 (MOAP1) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Monoclonal MOAP1 Antibody (monoclonal) (M01), Clone: 4A11

AMM03806G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human MOAP1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 4A11. This antibody is applicable in WB, E

Moap1 ORF Vector (Rat) (pORF)

ORF070670 1.0 ug DNA
EUR 506

MOAP1 ORF Vector (Human) (pORF)

ORF006557 1.0 ug DNA
EUR 95

Moap1 ORF Vector (Mouse) (pORF)

ORF050348 1.0 ug DNA
EUR 506

Moap1 ORF Vector (Mouse) (pORF)

ORF050349 1.0 ug DNA
EUR 506

Rabbit Anti-Mouse modulator of apoptosis 1 (MOAP1) IgG (aff pure)

AB-23039-A 100ug
EUR 482

Human Modulator of apoptosis 1 (MOAP1)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 66.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Modulator of apoptosis 1(MOAP1) expressed in E.coli

Moap1 sgRNA CRISPR Lentivector set (Rat)

K7145501 3 x 1.0 ug
EUR 339

MOAP1 sgRNA CRISPR Lentivector set (Human)

K1314501 3 x 1.0 ug
EUR 339

Moap1 sgRNA CRISPR Lentivector set (Mouse)

K3558001 3 x 1.0 ug
EUR 339

Moap1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7145502 1.0 ug DNA
EUR 154

Moap1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7145503 1.0 ug DNA
EUR 154

Moap1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7145504 1.0 ug DNA
EUR 154

MOAP1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1314502 1.0 ug DNA
EUR 154

MOAP1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1314503 1.0 ug DNA
EUR 154

MOAP1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1314504 1.0 ug DNA
EUR 154

Moap1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3558002 1.0 ug DNA
EUR 154

Moap1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3558003 1.0 ug DNA
EUR 154

Moap1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3558004 1.0 ug DNA
EUR 154

MOAP1 Protein Vector (Mouse) (pPB-C-His)

PV201390 500 ng
EUR 603

MOAP1 Protein Vector (Mouse) (pPB-N-His)

PV201391 500 ng
EUR 603

MOAP1 Protein Vector (Mouse) (pPM-C-HA)

PV201392 500 ng
EUR 603

MOAP1 Protein Vector (Mouse) (pPM-C-His)

PV201393 500 ng
EUR 603

MOAP1 Protein Vector (Mouse) (pPB-C-His)

PV201394 500 ng
EUR 603

MOAP1 Protein Vector (Mouse) (pPB-N-His)

PV201395 500 ng
EUR 603

MOAP1 Protein Vector (Mouse) (pPM-C-HA)

PV201396 500 ng
EUR 603

MOAP1 Protein Vector (Mouse) (pPM-C-His)

PV201397 500 ng
EUR 603

MOAP1 Protein Vector (Rat) (pPB-C-His)

PV282678 500 ng
EUR 603

MOAP1 Protein Vector (Rat) (pPB-N-His)

PV282679 500 ng
EUR 603

MOAP1 Protein Vector (Rat) (pPM-C-HA)

PV282680 500 ng
EUR 603

MOAP1 Protein Vector (Rat) (pPM-C-His)

PV282681 500 ng
EUR 603

MOAP1 Protein Vector (Human) (pPB-C-His)

PV026225 500 ng
EUR 329

MOAP1 Protein Vector (Human) (pPB-N-His)

PV026226 500 ng
EUR 329

MOAP1 Protein Vector (Human) (pPM-C-HA)

PV026227 500 ng
EUR 329

MOAP1 Protein Vector (Human) (pPM-C-His)

PV026228 500 ng
EUR 329

Moap1 3'UTR Luciferase Stable Cell Line

TU113304 1.0 ml Ask for price

Moap1 3'UTR GFP Stable Cell Line

TU163304 1.0 ml Ask for price

Moap1 3'UTR Luciferase Stable Cell Line

TU213289 1.0 ml Ask for price

Moap1 3'UTR GFP Stable Cell Line

TU263289 1.0 ml Ask for price

MOAP1 3'UTR GFP Stable Cell Line

TU064417 1.0 ml
EUR 2333

MOAP1 3'UTR Luciferase Stable Cell Line

TU014417 1.0 ml
EUR 2333

Human Modulator of apoptosis 1, MOAP1 ELISA KIT

ELI-20830h 96 Tests
EUR 824

Mouse Modulator of apoptosis 1, Moap1 ELISA KIT

ELI-20831m 96 Tests
EUR 865

Human Modulator of apoptosis 1 (MOAP1) ELISA Kit

abx385167-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Modulator of apoptosis 1 (MOAP1) ELISA Kit

abx389916-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

MOAP1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV627283 1.0 ug DNA
EUR 682

MOAP1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV627287 1.0 ug DNA
EUR 682

MOAP1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV627288 1.0 ug DNA
EUR 682

MOAP1 Modulator Of Apoptosis 1 Human Recombinant Protein

PROTQ96BY2 Regular: 20ug
EUR 317
Description: MOAP1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 374 amino acids (1-351a.a) and having a molecular mass of 41.9kDa.MOAP1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

MOAP1 Rabbit Polyclonal Antibody