PTMA Rabbit Polyclonal Antibody

PTMA Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

PTMA Polyclonal Antibody
ABP60026-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human PTMA protein Applications tips:
Description: A polyclonal antibody for detection of PTMA from Human, Mouse. This PTMA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTMA protein

PTMA Polyclonal Antibody
ABP60026-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human PTMA protein Applications tips:
Description: A polyclonal antibody for detection of PTMA from Human, Mouse. This PTMA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTMA protein

PTMA Polyclonal Antibody
ABP60026-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human PTMA protein Applications tips:
Description: A polyclonal antibody for detection of PTMA from Human, Mouse. This PTMA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTMA protein

PTMA Polyclonal Antibody
ES11817-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against PTMA from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PTMA Polyclonal Antibody
ES11817-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against PTMA from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Prothymosin Alpha (PTMa) ELISA Kit
DLR-PTMa-Hu-48T	DL Develop	48T	EUR 517
Should the Human Prothymosin Alpha (PTMa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Prothymosin Alpha (PTMa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Prothymosin Alpha (PTMa) ELISA Kit
DLR-PTMa-Hu-96T	DL Develop	96T	EUR 673
Should the Human Prothymosin Alpha (PTMa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Prothymosin Alpha (PTMa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Prothymosin Alpha (PTMa) ELISA Kit
RDR-PTMa-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Prothymosin Alpha (PTMa) ELISA Kit
RDR-PTMa-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Prothymosin Alpha (PTMa) ELISA Kit
RD-PTMa-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Prothymosin Alpha (PTMa) ELISA Kit
RD-PTMa-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

PTMA Rabbit pAb
A1956-100ul	Abclonal	100 ul	EUR 308

PTMA Rabbit pAb
A1956-200ul	Abclonal	200 ul	EUR 459

PTMA Rabbit pAb
A1956-20ul	Abclonal	20 ul	EUR 183

PTMA Rabbit pAb
A1956-50ul	Abclonal	50 ul	EUR 223

PTMA antibody
70R-19633	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal PTMA antibody

PTMA Antibody
37277-100ul	SAB	100ul	EUR 252

PTMA Antibody
1-CSB-PA721303	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

PTMA Antibody
1-CSB-PA799716	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

PTMA Antibody
1-CSB-PA272943	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

PTMA Antibody
1-CSB-PA01524A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PTMA Antibody
1-CSB-PA019000GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

Polyclonal PTMA Antibody (N-term)
APR03615G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PTMA (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal PTMA Antibody (C-Term)
APG00574G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PTMA (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal PTMA Antibody (C-Terminus)
APG01175G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PTMA (C-Terminus). This antibody is tested and proven to work in the following applications:

PTMA Polyclonal Antibody, Biotin Conjugated
A52461	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

PTMA Polyclonal Antibody, FITC Conjugated
A52462	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

PTMA Polyclonal Antibody, HRP Conjugated
A52463	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

PTMA
E541-447	EnoGene	100ug	EUR 343

Prothymosin Alpha (PTMa) Polyclonal Antibody (Human)
4-PAD221Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PTMa (Ser2~Asp111) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa)

PTMA Conjugated Antibody
C37277	SAB	100ul	EUR 397

Monoclonal PTMA Antibody
AMM01760G	Leading Biology	0.05mg	EUR 484
Description: A Monoclonal antibody against Human PTMA. The antibodies are raised in Mouse. This antibody is applicable in WB and IHC-P, ICC, IP

Anti-PTMA antibody
STJ11100717	St John's Laboratory	100 µl	EUR 277

Anti-PTMA antibody
STJ192975	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to PTMA

Anti-PTMA antibody
STJ71788	St John's Laboratory	100 µg	EUR 359

Ptma/ Rat Ptma ELISA Kit
ELI-05265r	Lifescience Market	96 Tests	EUR 657

Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), APC
4-PAD221Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PTMa (Ser2~Asp111) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with APC.

Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), Biotinylated
4-PAD221Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PTMa (Ser2~Asp111) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with Biotin.

Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), Cy3
4-PAD221Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PTMa (Ser2~Asp111) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with Cy3.

Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), FITC
4-PAD221Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PTMa (Ser2~Asp111) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with FITC.

Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), HRP
4-PAD221Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PTMa (Ser2~Asp111) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with HRP.

Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), PE
4-PAD221Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PTMa (Ser2~Asp111) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with PE.

PTMA siRNA
20-abx904361	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PTMA siRNA
20-abx930331	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PTMA siRNA
20-abx930332	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PTMA Antibody, HRP conjugated
1-CSB-PA01524B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PTMA Antibody, FITC conjugated
1-CSB-PA01524C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PTMA Antibody, Biotin conjugated
1-CSB-PA01524D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Prothymosin Alpha (PTMA) Antibody
abx026432-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Prothymosin Alpha (PTMA) Antibody
abx026432-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Prothymosin Alpha (PTMA) Antibody
20-abx110156	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Prothymosin Alpha (PTMA) Antibody
20-abx121680	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Prothymosin Alpha (PTMa) Antibody
20-abx128206	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Prothymosin Alpha (PTMa) Antibody
20-abx174300	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Prothymosin Alpha (PTMA) Antibody
20-abx241156	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Prothymosin Alpha (PTMA) Antibody
20-abx241411	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Prothymosin Alpha (PTMA) Antibody
20-abx241412	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Prothymosin Alpha (PTMA) Antibody
abx236808-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Prothymosin Alpha (PTMA) Antibody
abx431948-200ul	Abbexa	200 ul	EUR 286
Shipped within 1-3 working days.

Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), APC-Cy7
4-PAD221Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PTMa (Ser2~Asp111) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with APC-Cy7.

PTMA cloning plasmid
CSB-CL019000HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 333 Sequence: atgtcagacgcagccgtagacaccagctccgaaatcaccaccaaggacttaaaggagaagaaggaagttgtggaagaggcagaaaatggaagagacgcccctgctaacgggaatgctaatgaggaaaatggggagcaggaggctgacaatgaggtagacgaagaagaggaagaagg Show more
Description: A cloning plasmid for the PTMA gene.

PTMA cloning plasmid
CSB-CL019000HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 333 Sequence: atgtcagacgcagccgtagacaccagctccgaaatcaccaccaaggacttaaaggagaagaaggaagttgtggaagaggcagaaaatggaagagacgcccctgctaacgggaatgctaatgaggaaaatggggagcaggaggctgacaatgaggtagacgaagaagaggaagaagg Show more
Description: A cloning plasmid for the PTMA gene.

Human Prothymosin alpha (PTMA)
1-CSB-YP019000HU	Cusabio	EUR 430.00 EUR 234.00 EUR 1508.00 EUR 642.00 EUR 1009.00 EUR 291.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 14.2 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Prothymosin alpha(PTMA) expressed in Yeast

Human Prothymosin alpha (PTMA)
1-CSB-YP019000HUb0	Cusabio	EUR 430.00 EUR 234.00 EUR 1508.00 EUR 642.00 EUR 1009.00 EUR 291.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 14.7 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Prothymosin alpha(PTMA) expressed in Yeast

Rat Prothymosin alpha (Ptma)
1-CSB-YP019000RA	Cusabio	EUR 504.00 EUR 265.00 EUR 1832.00 EUR 763.00 EUR 1216.00 EUR 334.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 14.3 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Prothymosin alpha(Ptma) expressed in Yeast

PTMA protein (His tag)
80R-3024	Fitzgerald	50 ug	EUR 413
Description: Purified recombinant PTMA protein (His tag)

Human PTMA ELISA Kit
ELA-E1609h	Lifescience Market	96 Tests	EUR 824

PTMA ELISA KIT|Human
EF005969	Lifescience Market	96 Tests	EUR 689

Mouse PTMA shRNA Plasmid
20-abx972279	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat PTMA shRNA Plasmid
20-abx985361	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Prothymosin Alpha (PTMA) Protein
20-abx262698	Abbexa	EUR 328.00 EUR 6397.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

Human PTMA shRNA Plasmid
20-abx953893	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Recombinant Prothymosin Alpha (PTMa)
4-RPD221Hu01	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P06454 Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 42.1kDa Isoelectric Point: 3.7
Description: Recombinant Human Prothymosin Alpha expressed in: E.coli

Recombinant Prothymosin Alpha (PTMa)
4-RPD221Ra01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Inquire Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 42.2kDa Isoelectric Point: 3.7
Description: Recombinant Rat Recombinant Prothymosin Alpha (PTMa) expressed in: E.coli

PTMA Recombinant Protein (Human)
RP025144	ABM	100 ug	Ask for price

PTMA Recombinant Protein (Human)
RP025147	ABM	100 ug	Ask for price

PTMA Recombinant Protein (Mouse)
RP165578	ABM	100 ug	Ask for price

PTMA Recombinant Protein (Rat)
RP222875	ABM	100 ug	Ask for price

Monoclonal PTMA Antibody (monoclonal) (M02), Clone: 1G8
AMM03967G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human PTMA (monoclonal) (M02). The antibodies are raised in mouse and are from clone 1G8. This antibody is applicable in WB, E

Human Prothymosin Alpha (PTMA) Protein
abx060044-100ug	Abbexa	100 ug	EUR 328
Shipped within 5-10 working days.

Human Prothymosin Alpha (PTMa) Protein
20-abx166598	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Rat Prothymosin Alpha (PTMa) Protein
20-abx654881	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Ptma ORF Vector (Rat) (pORF)
ORF074293	ABM	1.0 ug DNA	EUR 506

PTMA ORF Vector (Human) (pORF)
ORF008382	ABM	1.0 ug DNA	EUR 95

PTMA ORF Vector (Human) (pORF)
ORF008383	ABM	1.0 ug DNA	EUR 95

Ptma ORF Vector (Mouse) (pORF)
ORF055194	ABM	1.0 ug DNA	EUR 506

PTMA ELISA Kit (Human) (OKCD08419)
OKCD08419	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.061ng/mL

PTMA ELISA Kit (Human) (OKEH01154)
OKEH01154	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.039 ng/mL

PTMA ELISA Kit (Rat) (OKEH06132)
OKEH06132	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Prothymosin alpha may mediate immune function by conferring resistance to certain opportunistic infections. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.166 ng/mL

PTMA ELISA Kit (Mouse) (OKEH04264)
OKEH04264	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Prothymosin alpha may mediate immune function by conferring resistance to certain opportunistic infections.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.164 ng/mL

Human Prothymosin Alpha (PTMa)ELISA kit
201-12-2264	SunredBio	96 tests	EUR 440
This Prothymosin Alpha ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Prothymosin alpha (PTMa) ELISA Kit
20-abx152865	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Prothymosin alpha (PTMA) ELISA Kit
abx251157-96tests	Abbexa	96 tests	EUR 746
Shipped within 5-12 working days.

Mouse Ptma/ Prothymosin alpha ELISA Kit
E1227Mo	Sunlong	1 Kit	EUR 571

Human PTMA/ Prothymosin alpha ELISA Kit
E2090Hu	Sunlong	1 Kit	EUR 571

Human PTMA(Prothymosin alpha) ELISA Kit
EH1845	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: P06454 Alias: PTMA/Prothymosin alpha/TMSA
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Bovine Prothymosin alpha, PTMA ELISA KIT
ELI-05262b	Lifescience Market	96 Tests	EUR 928

Mouse Prothymosin alpha, Ptma ELISA KIT
ELI-05263m	Lifescience Market	96 Tests	EUR 865

Human Prothymosin alpha, PTMA ELISA KIT
ELI-05264h	Lifescience Market	96 Tests	EUR 824

Cow Prothymosin alpha (PTMA) ELISA Kit
abx517922-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Prothymosin alpha (PTMA) ELISA Kit
abx517923-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse Prothymosin alpha (PTMA) ELISA Kit
abx517924-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Prothymosin alpha (PTMA) ELISA Kit
abx517925-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Prothymosin alpha (PTMa) CLIA Kit
20-abx494145	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Prothymosin Alpha(PTMa)ELISA kit
GA-E0811MS-48T	GenAsia Biotech	48T	EUR 336

Mouse Prothymosin Alpha(PTMa)ELISA kit
GA-E0811MS-96T	GenAsia Biotech	96T	EUR 534

Ptma sgRNA CRISPR Lentivector set (Rat)
K6832301	ABM	3 x 1.0 ug	EUR 339

Ptma sgRNA CRISPR Lentivector set (Mouse)
K4010001	ABM	3 x 1.0 ug	EUR 339

PTMA sgRNA CRISPR Lentivector set (Human)
K1752701	ABM	3 x 1.0 ug	EUR 339

PTMA Prothymosin Alpha Human Recombinant Protein
PROTP06454-1	BosterBio	Regular: 10ug	EUR 317
Description: PTMA Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 133 amino acids (1-110) and having a molecular mass of 14.5 kDa.;PTMA is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Human Prothymosin Alpha(PTMa)ELISA Kit
QY-E01901	Qayee Biotechnology	96T	EUR 361

Rat Prothymosin Alpha(PTMa)ELISA kit
QY-E10505	Qayee Biotechnology	96T	EUR 361

Human Prothymosin Alpha (PTMa) ELISA Kit
SED221Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prothymosin Alpha (PTMa) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prothymosin Alpha (PTMa) in serum, plasma, tissue homogenates and other biological fluids.

Human Prothymosin Alpha (PTMa) ELISA Kit
SED221Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prothymosin Alpha (PTMa) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prothymosin Alpha (PTMa) in serum, plasma, tissue homogenates and other biological fluids.

Human Prothymosin Alpha (PTMa) ELISA Kit
SED221Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prothymosin Alpha (PTMa) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prothymosin Alpha (PTMa) in serum, plasma, tissue homogenates and other biological fluids.

Human Prothymosin Alpha (PTMa) ELISA Kit
SED221Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prothymosin Alpha (PTMa) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prothymosin Alpha (PTMa) in serum, plasma, tissue homogenates and other biological fluids.

Human Prothymosin Alpha (PTMa) ELISA Kit
4-SED221Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Prothymosin Alpha elisa. Alternative names of the recognized antigen: TMSA PTM-A Pro-Thymosin A Gene Sequence 28 Thymosin alpha-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Prothymosin Alpha (PTMa) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Prothymosin Alpha(PTMa)ELISA kit
QY-E21293	Qayee Biotechnology	96T	EUR 361

ELISA kit for Human PTMa (Prothymosin Alpha)
ELK3885	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Prothymosin Alpha (PTM?). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Prothymos Show more
Description: A sandwich ELISA kit for detection of Prothymosin Alpha from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Prothymosin, alpha (PTMA)
KTE61059-48T	Abbkine	48T	EUR 354
Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh Show more
Description: Quantitative sandwich ELISA for measuring Human Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Prothymosin, alpha (PTMA)
KTE61059-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh Show more
Description: Quantitative sandwich ELISA for measuring Human Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Prothymosin, alpha (PTMA)
KTE61059-96T	Abbkine	96T	EUR 572
Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh Show more
Description: Quantitative sandwich ELISA for measuring Human Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Ptma sgRNA CRISPR Lentivector (Rat) (Target 1)
K6832302	ABM	1.0 ug DNA	EUR 154

Ptma sgRNA CRISPR Lentivector (Rat) (Target 2)
K6832303	ABM	1.0 ug DNA	EUR 154

Ptma sgRNA CRISPR Lentivector (Rat) (Target 3)
K6832304	ABM	1.0 ug DNA	EUR 154

Ptma sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4010002	ABM	1.0 ug DNA	EUR 154

Ptma sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4010003	ABM	1.0 ug DNA	EUR 154

Ptma sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4010004	ABM	1.0 ug DNA	EUR 154

PTMA sgRNA CRISPR Lentivector (Human) (Target 1)
K1752702	ABM	1.0 ug DNA	EUR 154

PTMA sgRNA CRISPR Lentivector (Human) (Target 2)
K1752703	ABM	1.0 ug DNA	EUR 154

PTMA sgRNA CRISPR Lentivector (Human) (Target 3)
K1752704	ABM	1.0 ug DNA	EUR 154

ELISA kit for Canine Prothymosin, alpha (PTMA)
KTE20099-48T	Abbkine	48T	EUR 354
Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh Show more
Description: Quantitative sandwich ELISA for measuring Canine Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Canine Prothymosin, alpha (PTMA)
KTE20099-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh Show more
Description: Quantitative sandwich ELISA for measuring Canine Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Canine Prothymosin, alpha (PTMA)
KTE20099-96T	Abbkine	96T	EUR 572
Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh Show more
Description: Quantitative sandwich ELISA for measuring Canine Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

PTMA Rabbit Polyclonal Antibody