PTMA Rabbit Polyclonal Antibody

PTMA Rabbit Polyclonal Antibody

To Order Now:

PTMA Polyclonal Antibody
ABP60026-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PTMA protein
  • Applications tips:
Description: A polyclonal antibody for detection of PTMA from Human, Mouse. This PTMA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTMA protein
PTMA Polyclonal Antibody
ABP60026-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PTMA protein
  • Applications tips:
Description: A polyclonal antibody for detection of PTMA from Human, Mouse. This PTMA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTMA protein
PTMA Polyclonal Antibody
ABP60026-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PTMA protein
  • Applications tips:
Description: A polyclonal antibody for detection of PTMA from Human, Mouse. This PTMA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTMA protein
PTMA Polyclonal Antibody
ES11817-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PTMA from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
PTMA Polyclonal Antibody
ES11817-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PTMA from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
Human Prothymosin Alpha (PTMa) ELISA Kit
DLR-PTMa-Hu-48T 48T
EUR 517
  • Should the Human Prothymosin Alpha (PTMa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Prothymosin Alpha (PTMa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Prothymosin Alpha (PTMa) ELISA Kit
DLR-PTMa-Hu-96T 96T
EUR 673
  • Should the Human Prothymosin Alpha (PTMa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Prothymosin Alpha (PTMa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Prothymosin Alpha (PTMa) ELISA Kit
RDR-PTMa-Hu-48Tests 48 Tests
EUR 544
Human Prothymosin Alpha (PTMa) ELISA Kit
RDR-PTMa-Hu-96Tests 96 Tests
EUR 756
Human Prothymosin Alpha (PTMa) ELISA Kit
RD-PTMa-Hu-48Tests 48 Tests
EUR 521
Human Prothymosin Alpha (PTMa) ELISA Kit
RD-PTMa-Hu-96Tests 96 Tests
EUR 723
PTMA Rabbit pAb
A1956-100ul 100 ul
EUR 308
PTMA Rabbit pAb
A1956-200ul 200 ul
EUR 459
PTMA Rabbit pAb
A1956-20ul 20 ul
EUR 183
PTMA Rabbit pAb
A1956-50ul 50 ul
EUR 223
PTMA antibody
70R-19633 50 ul
EUR 435
Description: Rabbit polyclonal PTMA antibody
PTMA Antibody
37277-100ul 100ul
EUR 252
PTMA Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
PTMA Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
PTMA Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
PTMA Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
PTMA Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC
Polyclonal PTMA Antibody (N-term)
APR03615G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PTMA (N-term). This antibody is tested and proven to work in the following applications:
Polyclonal PTMA Antibody (C-Term)
APG00574G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PTMA (C-Term). This antibody is tested and proven to work in the following applications:
Polyclonal PTMA Antibody (C-Terminus)
APG01175G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PTMA (C-Terminus). This antibody is tested and proven to work in the following applications:
PTMA Polyclonal Antibody, Biotin Conjugated
A52461 100 µg
EUR 570.55
Description: Ask the seller for details
PTMA Polyclonal Antibody, FITC Conjugated
A52462 100 µg
EUR 570.55
Description: The best epigenetics products
PTMA Polyclonal Antibody, HRP Conjugated
A52463 100 µg
EUR 570.55
Description: kits suitable for this type of research
E541-447 100ug
EUR 343
Prothymosin Alpha (PTMa) Polyclonal Antibody (Human)
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTMa (Ser2~Asp111)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa)
PTMA Conjugated Antibody
C37277 100ul
EUR 397
Monoclonal PTMA Antibody
AMM01760G 0.05mg
EUR 484
Description: A Monoclonal antibody against Human PTMA. The antibodies are raised in Mouse. This antibody is applicable in WB and IHC-P, ICC, IP
Anti-PTMA antibody
STJ11100717 100 µl
EUR 277
Anti-PTMA antibody
STJ192975 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PTMA
Anti-PTMA antibody
STJ71788 100 µg
EUR 359
Ptma/ Rat Ptma ELISA Kit
ELI-05265r 96 Tests
EUR 657
Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTMa (Ser2~Asp111)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with APC.
Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), Biotinylated
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTMa (Ser2~Asp111)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with Biotin.
Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTMa (Ser2~Asp111)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with Cy3.
Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTMa (Ser2~Asp111)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with FITC.
Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTMa (Ser2~Asp111)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with HRP.
Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTMa (Ser2~Asp111)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with PE.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PTMA Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
PTMA Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
PTMA Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Prothymosin Alpha (PTMA) Antibody
abx026432-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Prothymosin Alpha (PTMA) Antibody
abx026432-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Prothymosin Alpha (PTMA) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Prothymosin Alpha (PTMA) Antibody
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Prothymosin Alpha (PTMa) Antibody
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Prothymosin Alpha (PTMa) Antibody
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Prothymosin Alpha (PTMA) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Prothymosin Alpha (PTMA) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Prothymosin Alpha (PTMA) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Prothymosin Alpha (PTMA) Antibody
abx236808-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Prothymosin Alpha (PTMA) Antibody
abx431948-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.
Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PTMa (Ser2~Asp111)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with APC-Cy7.
PTMA cloning plasmid
CSB-CL019000HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 333
  • Sequence: atgtcagacgcagccgtagacaccagctccgaaatcaccaccaaggacttaaaggagaagaaggaagttgtggaagaggcagaaaatggaagagacgcccctgctaacgggaatgctaatgaggaaaatggggagcaggaggctgacaatgaggtagacgaagaagaggaagaagg
  • Show more
Description: A cloning plasmid for the PTMA gene.
PTMA cloning plasmid
CSB-CL019000HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 333
  • Sequence: atgtcagacgcagccgtagacaccagctccgaaatcaccaccaaggacttaaaggagaagaaggaagttgtggaagaggcagaaaatggaagagacgcccctgctaacgggaatgctaatgaggaaaatggggagcaggaggctgacaatgaggtagacgaagaagaggaagaagg
  • Show more
Description: A cloning plasmid for the PTMA gene.
Human Prothymosin alpha (PTMA)
  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 14.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Prothymosin alpha(PTMA) expressed in Yeast
Human Prothymosin alpha (PTMA)
  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 14.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Prothymosin alpha(PTMA) expressed in Yeast
Rat Prothymosin alpha (Ptma)
  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 14.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Prothymosin alpha(Ptma) expressed in Yeast
PTMA protein (His tag)
80R-3024 50 ug
EUR 413
Description: Purified recombinant PTMA protein (His tag)
ELA-E1609h 96 Tests
EUR 824
EF005969 96 Tests
EUR 689
Mouse PTMA shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat PTMA shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Prothymosin Alpha (PTMA) Protein
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.
Human PTMA shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Recombinant Prothymosin Alpha (PTMa)
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P06454
  • Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 42.1kDa
  • Isoelectric Point: 3.7
Description: Recombinant Human Prothymosin Alpha expressed in: E.coli
Recombinant Prothymosin Alpha (PTMa)
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 42.2kDa
  • Isoelectric Point: 3.7
Description: Recombinant Rat Recombinant Prothymosin Alpha (PTMa) expressed in: E.coli
PTMA Recombinant Protein (Human)
RP025144 100 ug Ask for price
PTMA Recombinant Protein (Human)
RP025147 100 ug Ask for price
PTMA Recombinant Protein (Mouse)
RP165578 100 ug Ask for price
PTMA Recombinant Protein (Rat)
RP222875 100 ug Ask for price
Monoclonal PTMA Antibody (monoclonal) (M02), Clone: 1G8
AMM03967G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human PTMA (monoclonal) (M02). The antibodies are raised in mouse and are from clone 1G8. This antibody is applicable in WB, E
Human Prothymosin Alpha (PTMA) Protein
abx060044-100ug 100 ug
EUR 328
  • Shipped within 5-10 working days.
Human Prothymosin Alpha (PTMa) Protein
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Rat Prothymosin Alpha (PTMa) Protein
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Ptma ORF Vector (Rat) (pORF)
ORF074293 1.0 ug DNA
EUR 506
PTMA ORF Vector (Human) (pORF)
ORF008382 1.0 ug DNA
EUR 95
PTMA ORF Vector (Human) (pORF)
ORF008383 1.0 ug DNA
EUR 95
Ptma ORF Vector (Mouse) (pORF)
ORF055194 1.0 ug DNA
EUR 506
PTMA ELISA Kit (Human) (OKCD08419)
OKCD08419 96 Wells
EUR 975
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.061ng/mL
PTMA ELISA Kit (Human) (OKEH01154)
OKEH01154 96 Wells
EUR 662
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.039 ng/mL
PTMA ELISA Kit (Rat) (OKEH06132)
OKEH06132 96 Wells
EUR 662
Description: Description of target: Prothymosin alpha may mediate immune function by conferring resistance to certain opportunistic infections. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.166 ng/mL
PTMA ELISA Kit (Mouse) (OKEH04264)
OKEH04264 96 Wells
EUR 662
Description: Description of target: Prothymosin alpha may mediate immune function by conferring resistance to certain opportunistic infections.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.164 ng/mL
Human Prothymosin Alpha (PTMa)ELISA kit
201-12-2264 96 tests
EUR 440
  • This Prothymosin Alpha ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Prothymosin alpha (PTMa) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Prothymosin alpha (PTMA) ELISA Kit
abx251157-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.
Mouse Ptma/ Prothymosin alpha ELISA Kit
E1227Mo 1 Kit
EUR 571
Human PTMA/ Prothymosin alpha ELISA Kit
E2090Hu 1 Kit
EUR 571
Human PTMA(Prothymosin alpha) ELISA Kit
EH1845 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P06454
  • Alias: PTMA/Prothymosin alpha/TMSA
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
Bovine Prothymosin alpha, PTMA ELISA KIT
ELI-05262b 96 Tests
EUR 928
Mouse Prothymosin alpha, Ptma ELISA KIT
ELI-05263m 96 Tests
EUR 865
Human Prothymosin alpha, PTMA ELISA KIT
ELI-05264h 96 Tests
EUR 824
Cow Prothymosin alpha (PTMA) ELISA Kit
abx517922-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Prothymosin alpha (PTMA) ELISA Kit
abx517923-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Mouse Prothymosin alpha (PTMA) ELISA Kit
abx517924-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Rat Prothymosin alpha (PTMA) ELISA Kit
abx517925-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Prothymosin alpha (PTMa) CLIA Kit
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Mouse Prothymosin Alpha(PTMa)ELISA kit
GA-E0811MS-48T 48T
EUR 336
Mouse Prothymosin Alpha(PTMa)ELISA kit
GA-E0811MS-96T 96T
EUR 534
Ptma sgRNA CRISPR Lentivector set (Rat)
K6832301 3 x 1.0 ug
EUR 339
Ptma sgRNA CRISPR Lentivector set (Mouse)
K4010001 3 x 1.0 ug
EUR 339
PTMA sgRNA CRISPR Lentivector set (Human)
K1752701 3 x 1.0 ug
EUR 339
PTMA Prothymosin Alpha Human Recombinant Protein
PROTP06454-1 Regular: 10ug
EUR 317
Description: PTMA Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 133 amino acids (1-110) and having a molecular mass of 14.5 kDa.;PTMA is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
Human Prothymosin Alpha(PTMa)ELISA Kit
QY-E01901 96T
EUR 361
Rat Prothymosin Alpha(PTMa)ELISA kit
QY-E10505 96T
EUR 361
Human Prothymosin Alpha (PTMa) ELISA Kit
SED221Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prothymosin Alpha (PTMa) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prothymosin Alpha (PTMa) in serum, plasma, tissue homogenates and other biological fluids.
Human Prothymosin Alpha (PTMa) ELISA Kit
SED221Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prothymosin Alpha (PTMa) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prothymosin Alpha (PTMa) in serum, plasma, tissue homogenates and other biological fluids.
Human Prothymosin Alpha (PTMa) ELISA Kit
SED221Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prothymosin Alpha (PTMa) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prothymosin Alpha (PTMa) in serum, plasma, tissue homogenates and other biological fluids.
Human Prothymosin Alpha (PTMa) ELISA Kit
SED221Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prothymosin Alpha (PTMa) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prothymosin Alpha (PTMa) in serum, plasma, tissue homogenates and other biological fluids.
Human Prothymosin Alpha (PTMa) ELISA Kit
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Prothymosin Alpha elisa. Alternative names of the recognized antigen: TMSA
  • PTM-A
  • Pro-Thymosin A
  • Gene Sequence 28
  • Thymosin alpha-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Prothymosin Alpha (PTMa) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Mouse Prothymosin Alpha(PTMa)ELISA kit
QY-E21293 96T
EUR 361
ELISA kit for Human PTMa (Prothymosin Alpha)
ELK3885 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Prothymosin Alpha (PTM?). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Prothymos
  • Show more
Description: A sandwich ELISA kit for detection of Prothymosin Alpha from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human Prothymosin, alpha (PTMA)
KTE61059-48T 48T
EUR 354
  • Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Prothymosin, alpha (PTMA)
KTE61059-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Prothymosin, alpha (PTMA)
KTE61059-96T 96T
EUR 572
  • Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Ptma sgRNA CRISPR Lentivector (Rat) (Target 1)
K6832302 1.0 ug DNA
EUR 154
Ptma sgRNA CRISPR Lentivector (Rat) (Target 2)
K6832303 1.0 ug DNA
EUR 154
Ptma sgRNA CRISPR Lentivector (Rat) (Target 3)
K6832304 1.0 ug DNA
EUR 154
Ptma sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4010002 1.0 ug DNA
EUR 154
Ptma sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4010003 1.0 ug DNA
EUR 154
Ptma sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4010004 1.0 ug DNA
EUR 154
PTMA sgRNA CRISPR Lentivector (Human) (Target 1)
K1752702 1.0 ug DNA
EUR 154
PTMA sgRNA CRISPR Lentivector (Human) (Target 2)
K1752703 1.0 ug DNA
EUR 154
PTMA sgRNA CRISPR Lentivector (Human) (Target 3)
K1752704 1.0 ug DNA
EUR 154
ELISA kit for Canine Prothymosin, alpha (PTMA)
KTE20099-48T 48T
EUR 354
  • Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
  • Show more
Description: Quantitative sandwich ELISA for measuring Canine Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Canine Prothymosin, alpha (PTMA)
KTE20099-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
  • Show more
Description: Quantitative sandwich ELISA for measuring Canine Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Canine Prothymosin, alpha (PTMA)
KTE20099-96T 96T
EUR 572
  • Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
  • Show more
Description: Quantitative sandwich ELISA for measuring Canine Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

PTMA Rabbit Polyclonal Antibody