PTMA Rabbit Polyclonal Antibody
To Order Now: info@poweratlas.org
PTMA Polyclonal Antibody |
ABP60026-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human PTMA protein
- Applications tips:
|
Description: A polyclonal antibody for detection of PTMA from Human, Mouse. This PTMA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTMA protein |
PTMA Polyclonal Antibody |
ABP60026-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PTMA protein
- Applications tips:
|
Description: A polyclonal antibody for detection of PTMA from Human, Mouse. This PTMA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTMA protein |
PTMA Polyclonal Antibody |
ABP60026-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PTMA protein
- Applications tips:
|
Description: A polyclonal antibody for detection of PTMA from Human, Mouse. This PTMA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTMA protein |
PTMA Polyclonal Antibody |
ES11817-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against PTMA from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PTMA Polyclonal Antibody |
ES11817-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against PTMA from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Human Prothymosin Alpha (PTMa) ELISA Kit |
DLR-PTMa-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Prothymosin Alpha (PTMa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Prothymosin Alpha (PTMa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Prothymosin Alpha (PTMa) ELISA Kit |
DLR-PTMa-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Prothymosin Alpha (PTMa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Prothymosin Alpha (PTMa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Prothymosin Alpha (PTMa) ELISA Kit |
RDR-PTMa-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Prothymosin Alpha (PTMa) ELISA Kit |
RDR-PTMa-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Prothymosin Alpha (PTMa) ELISA Kit |
RD-PTMa-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Prothymosin Alpha (PTMa) ELISA Kit |
RD-PTMa-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
PTMA Rabbit pAb |
A1956-100ul |
Abclonal |
100 ul |
EUR 308 |
PTMA Rabbit pAb |
A1956-200ul |
Abclonal |
200 ul |
EUR 459 |
PTMA Rabbit pAb |
A1956-20ul |
Abclonal |
20 ul |
EUR 183 |
PTMA Rabbit pAb |
A1956-50ul |
Abclonal |
50 ul |
EUR 223 |
PTMA antibody |
70R-19633 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal PTMA antibody |
PTMA Antibody |
37277-100ul |
SAB |
100ul |
EUR 252 |
PTMA Antibody |
1-CSB-PA721303 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
PTMA Antibody |
1-CSB-PA799716 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
PTMA Antibody |
1-CSB-PA272943 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
PTMA Antibody |
1-CSB-PA01524A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
PTMA Antibody |
1-CSB-PA019000GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC |
Polyclonal PTMA Antibody (N-term) |
APR03615G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PTMA (N-term). This antibody is tested and proven to work in the following applications: |
Polyclonal PTMA Antibody (C-Term) |
APG00574G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PTMA (C-Term). This antibody is tested and proven to work in the following applications: |
Polyclonal PTMA Antibody (C-Terminus) |
APG01175G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PTMA (C-Terminus). This antibody is tested and proven to work in the following applications: |
PTMA Polyclonal Antibody, Biotin Conjugated |
A52461 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
PTMA Polyclonal Antibody, FITC Conjugated |
A52462 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
PTMA Polyclonal Antibody, HRP Conjugated |
A52463 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
PTMA |
E541-447 |
EnoGene |
100ug |
EUR 343 |
Prothymosin Alpha (PTMa) Polyclonal Antibody (Human) |
4-PAD221Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PTMa (Ser2~Asp111)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa) |
PTMA Conjugated Antibody |
C37277 |
SAB |
100ul |
EUR 397 |
Monoclonal PTMA Antibody |
AMM01760G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A Monoclonal antibody against Human PTMA. The antibodies are raised in Mouse. This antibody is applicable in WB and IHC-P, ICC, IP |
Anti-PTMA antibody |
STJ192975 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PTMA |
Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), APC |
4-PAD221Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PTMa (Ser2~Asp111)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with APC. |
Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), Biotinylated |
4-PAD221Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PTMa (Ser2~Asp111)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with Biotin. |
Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), Cy3 |
4-PAD221Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PTMa (Ser2~Asp111)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with Cy3. |
Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), FITC |
4-PAD221Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PTMa (Ser2~Asp111)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with FITC. |
Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), HRP |
4-PAD221Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PTMa (Ser2~Asp111)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with HRP. |
Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), PE |
4-PAD221Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PTMa (Ser2~Asp111)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with PE. |
PTMA siRNA |
20-abx904361 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PTMA siRNA |
20-abx930331 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PTMA siRNA |
20-abx930332 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PTMA Antibody, HRP conjugated |
1-CSB-PA01524B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
PTMA Antibody, FITC conjugated |
1-CSB-PA01524C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
PTMA Antibody, Biotin conjugated |
1-CSB-PA01524D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Prothymosin Alpha (PTMA) Antibody |
abx026432-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Prothymosin Alpha (PTMA) Antibody |
abx026432-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Prothymosin Alpha (PTMA) Antibody |
20-abx110156 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Prothymosin Alpha (PTMA) Antibody |
20-abx121680 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Prothymosin Alpha (PTMa) Antibody |
20-abx128206 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Prothymosin Alpha (PTMa) Antibody |
20-abx174300 |
Abbexa |
|
|
|
Prothymosin Alpha (PTMA) Antibody |
20-abx241156 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Prothymosin Alpha (PTMA) Antibody |
20-abx241411 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Prothymosin Alpha (PTMA) Antibody |
20-abx241412 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Prothymosin Alpha (PTMA) Antibody |
abx236808-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Prothymosin Alpha (PTMA) Antibody |
abx431948-200ul |
Abbexa |
200 ul |
EUR 286 |
- Shipped within 1-3 working days.
|
Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), APC-Cy7 |
4-PAD221Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PTMa (Ser2~Asp111)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with APC-Cy7. |
PTMA cloning plasmid |
CSB-CL019000HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 333
- Sequence: atgtcagacgcagccgtagacaccagctccgaaatcaccaccaaggacttaaaggagaagaaggaagttgtggaagaggcagaaaatggaagagacgcccctgctaacgggaatgctaatgaggaaaatggggagcaggaggctgacaatgaggtagacgaagaagaggaagaagg
- Show more
|
Description: A cloning plasmid for the PTMA gene. |
PTMA cloning plasmid |
CSB-CL019000HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 333
- Sequence: atgtcagacgcagccgtagacaccagctccgaaatcaccaccaaggacttaaaggagaagaaggaagttgtggaagaggcagaaaatggaagagacgcccctgctaacgggaatgctaatgaggaaaatggggagcaggaggctgacaatgaggtagacgaagaagaggaagaagg
- Show more
|
Description: A cloning plasmid for the PTMA gene. |
Human Prothymosin alpha (PTMA) |
1-CSB-YP019000HU |
Cusabio |
-
EUR 430.00
-
EUR 234.00
-
EUR 1508.00
-
EUR 642.00
-
EUR 1009.00
-
EUR 291.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 14.2 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Prothymosin alpha(PTMA) expressed in Yeast |
Human Prothymosin alpha (PTMA) |
1-CSB-YP019000HUb0 |
Cusabio |
-
EUR 430.00
-
EUR 234.00
-
EUR 1508.00
-
EUR 642.00
-
EUR 1009.00
-
EUR 291.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 14.7 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Prothymosin alpha(PTMA) expressed in Yeast |
Rat Prothymosin alpha (Ptma) |
1-CSB-YP019000RA |
Cusabio |
-
EUR 504.00
-
EUR 265.00
-
EUR 1832.00
-
EUR 763.00
-
EUR 1216.00
-
EUR 334.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 14.3 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Rat Prothymosin alpha(Ptma) expressed in Yeast |
PTMA protein (His tag) |
80R-3024 |
Fitzgerald |
50 ug |
EUR 413 |
Description: Purified recombinant PTMA protein (His tag) |
Mouse PTMA shRNA Plasmid |
20-abx972279 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat PTMA shRNA Plasmid |
20-abx985361 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Prothymosin Alpha (PTMA) Protein |
20-abx262698 |
Abbexa |
-
EUR 328.00
-
EUR 6397.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Human PTMA shRNA Plasmid |
20-abx953893 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Recombinant Prothymosin Alpha (PTMa) |
4-RPD221Hu01 |
Cloud-Clone |
-
EUR 467.36
-
EUR 228.00
-
EUR 1477.60
-
EUR 559.20
-
EUR 1018.40
-
EUR 376.00
-
EUR 3544.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P06454
- Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 42.1kDa
- Isoelectric Point: 3.7
|
Description: Recombinant Human Prothymosin Alpha expressed in: E.coli |
Recombinant Prothymosin Alpha (PTMa) |
4-RPD221Ra01 |
Cloud-Clone |
-
EUR 476.32
-
EUR 230.00
-
EUR 1511.20
-
EUR 570.40
-
EUR 1040.80
-
EUR 382.00
-
EUR 3628.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Inquire
- Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 42.2kDa
- Isoelectric Point: 3.7
|
Description: Recombinant Rat Recombinant Prothymosin Alpha (PTMa) expressed in: E.coli |
PTMA Recombinant Protein (Human) |
RP025144 |
ABM |
100 ug |
Ask for price |
PTMA Recombinant Protein (Human) |
RP025147 |
ABM |
100 ug |
Ask for price |
PTMA Recombinant Protein (Mouse) |
RP165578 |
ABM |
100 ug |
Ask for price |
PTMA Recombinant Protein (Rat) |
RP222875 |
ABM |
100 ug |
Ask for price |
Monoclonal PTMA Antibody (monoclonal) (M02), Clone: 1G8 |
AMM03967G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human PTMA (monoclonal) (M02). The antibodies are raised in mouse and are from clone 1G8. This antibody is applicable in WB, E |
Human Prothymosin Alpha (PTMA) Protein |
abx060044-100ug |
Abbexa |
100 ug |
EUR 328 |
- Shipped within 5-10 working days.
|
Human Prothymosin Alpha (PTMa) Protein |
20-abx166598 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1998.00
-
EUR 773.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Rat Prothymosin Alpha (PTMa) Protein |
20-abx654881 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2040.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Ptma ORF Vector (Rat) (pORF) |
ORF074293 |
ABM |
1.0 ug DNA |
EUR 506 |
PTMA ORF Vector (Human) (pORF) |
ORF008382 |
ABM |
1.0 ug DNA |
EUR 95 |
PTMA ORF Vector (Human) (pORF) |
ORF008383 |
ABM |
1.0 ug DNA |
EUR 95 |
Ptma ORF Vector (Mouse) (pORF) |
ORF055194 |
ABM |
1.0 ug DNA |
EUR 506 |
PTMA ELISA Kit (Human) (OKCD08419) |
OKCD08419 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.061ng/mL |
PTMA ELISA Kit (Human) (OKEH01154) |
OKEH01154 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.039 ng/mL |
PTMA ELISA Kit (Rat) (OKEH06132) |
OKEH06132 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Prothymosin alpha may mediate immune function by conferring resistance to certain opportunistic infections. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.166 ng/mL |
PTMA ELISA Kit (Mouse) (OKEH04264) |
OKEH04264 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Prothymosin alpha may mediate immune function by conferring resistance to certain opportunistic infections.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.164 ng/mL |
Human Prothymosin Alpha (PTMa)ELISA kit |
201-12-2264 |
SunredBio |
96 tests |
EUR 440 |
- This Prothymosin Alpha ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Prothymosin alpha (PTMa) ELISA Kit |
20-abx152865 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Prothymosin alpha (PTMA) ELISA Kit |
abx251157-96tests |
Abbexa |
96 tests |
EUR 746 |
- Shipped within 5-12 working days.
|
Mouse Ptma/ Prothymosin alpha ELISA Kit |
E1227Mo |
Sunlong |
1 Kit |
EUR 571 |
Human PTMA/ Prothymosin alpha ELISA Kit |
E2090Hu |
Sunlong |
1 Kit |
EUR 571 |
Human PTMA(Prothymosin alpha) ELISA Kit |
EH1845 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P06454
- Alias: PTMA/Prothymosin alpha/TMSA
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Cow Prothymosin alpha (PTMA) ELISA Kit |
abx517922-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Prothymosin alpha (PTMA) ELISA Kit |
abx517923-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse Prothymosin alpha (PTMA) ELISA Kit |
abx517924-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Prothymosin alpha (PTMA) ELISA Kit |
abx517925-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Prothymosin alpha (PTMa) CLIA Kit |
20-abx494145 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Mouse Prothymosin Alpha(PTMa)ELISA kit |
GA-E0811MS-48T |
GenAsia Biotech |
48T |
EUR 336 |
Mouse Prothymosin Alpha(PTMa)ELISA kit |
GA-E0811MS-96T |
GenAsia Biotech |
96T |
EUR 534 |
Ptma sgRNA CRISPR Lentivector set (Rat) |
K6832301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ptma sgRNA CRISPR Lentivector set (Mouse) |
K4010001 |
ABM |
3 x 1.0 ug |
EUR 339 |
PTMA sgRNA CRISPR Lentivector set (Human) |
K1752701 |
ABM |
3 x 1.0 ug |
EUR 339 |
PTMA Prothymosin Alpha Human Recombinant Protein |
PROTP06454-1 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: PTMA Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 133 amino acids (1-110) and having a molecular mass of 14.5 kDa.;PTMA is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
Human Prothymosin Alpha (PTMa) ELISA Kit |
SED221Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prothymosin Alpha (PTMa) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prothymosin Alpha (PTMa) in serum, plasma, tissue homogenates and other biological fluids. |
Human Prothymosin Alpha (PTMa) ELISA Kit |
SED221Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prothymosin Alpha (PTMa) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prothymosin Alpha (PTMa) in serum, plasma, tissue homogenates and other biological fluids. |
Human Prothymosin Alpha (PTMa) ELISA Kit |
SED221Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prothymosin Alpha (PTMa) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prothymosin Alpha (PTMa) in serum, plasma, tissue homogenates and other biological fluids. |
Human Prothymosin Alpha (PTMa) ELISA Kit |
SED221Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Prothymosin Alpha (PTMa) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Prothymosin Alpha (PTMa) in serum, plasma, tissue homogenates and other biological fluids. |
Human Prothymosin Alpha (PTMa) ELISA Kit |
4-SED221Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Prothymosin Alpha elisa. Alternative names of the recognized antigen: TMSA
- PTM-A
- Pro-Thymosin A
- Gene Sequence 28
- Thymosin alpha-1
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Prothymosin Alpha (PTMa) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
ELISA kit for Human PTMa (Prothymosin Alpha) |
ELK3885 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Prothymosin Alpha (PTM?). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Prothymos
- Show more
|
Description: A sandwich ELISA kit for detection of Prothymosin Alpha from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Prothymosin, alpha (PTMA) |
KTE61059-48T |
Abbkine |
48T |
EUR 354 |
- Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Prothymosin, alpha (PTMA) |
KTE61059-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Prothymosin, alpha (PTMA) |
KTE61059-96T |
Abbkine |
96T |
EUR 572 |
- Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Ptma sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6832302 |
ABM |
1.0 ug DNA |
EUR 154 |
Ptma sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6832303 |
ABM |
1.0 ug DNA |
EUR 154 |
Ptma sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6832304 |
ABM |
1.0 ug DNA |
EUR 154 |
Ptma sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4010002 |
ABM |
1.0 ug DNA |
EUR 154 |
Ptma sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4010003 |
ABM |
1.0 ug DNA |
EUR 154 |
Ptma sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4010004 |
ABM |
1.0 ug DNA |
EUR 154 |
PTMA sgRNA CRISPR Lentivector (Human) (Target 1) |
K1752702 |
ABM |
1.0 ug DNA |
EUR 154 |
PTMA sgRNA CRISPR Lentivector (Human) (Target 2) |
K1752703 |
ABM |
1.0 ug DNA |
EUR 154 |
PTMA sgRNA CRISPR Lentivector (Human) (Target 3) |
K1752704 |
ABM |
1.0 ug DNA |
EUR 154 |
ELISA kit for Canine Prothymosin, alpha (PTMA) |
KTE20099-48T |
Abbkine |
48T |
EUR 354 |
- Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
- Show more
|
Description: Quantitative sandwich ELISA for measuring Canine Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Canine Prothymosin, alpha (PTMA) |
KTE20099-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
- Show more
|
Description: Quantitative sandwich ELISA for measuring Canine Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Canine Prothymosin, alpha (PTMA) |
KTE20099-96T |
Abbkine |
96T |
EUR 572 |
- Prothymosin alpha is a protein encoded by the PTMA. PTMA is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin alpha-1. The encoded human PTMA protein is a highly acidic (54 residues out of 111) and sh
- Show more
|
Description: Quantitative sandwich ELISA for measuring Canine Prothymosin, alpha (PTMA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
PTMA Rabbit Polyclonal Antibody