PRKRA Rabbit Polyclonal Antibody

PRKRA Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

PRKRA Polyclonal Antibody

ES11874-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PRKRA from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PRKRA Polyclonal Antibody

ES11874-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PRKRA from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

PRKRA Rabbit pAb

A5417-100ul 100 ul
EUR 308

PRKRA Rabbit pAb

A5417-200ul 200 ul
EUR 459

PRKRA Rabbit pAb

A5417-20ul 20 ul
EUR 183

PRKRA Rabbit pAb

A5417-50ul 50 ul
EUR 223

PRKRA antibody

70R-19532 50 ul
EUR 435
Description: Rabbit polyclonal PRKRA antibody

PRKRA Antibody

32843-100ul 100ul
EUR 252

PRKRA antibody

10R-1568 100 ug
EUR 512
Description: Mouse monoclonal PRKRA antibody

PRKRA Antibody

1-CSB-PA13669A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRKRA. Recognizes PRKRA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:50-1:200, IF:1:50-1:500

PRKRA Antibody

DF7334 200ul
EUR 304
Description: PRKRA Antibody detects endogenous levels of total PRKRA.

PRKRA antibody

70R-5896 50 ug
EUR 467
Description: Rabbit polyclonal PRKRA antibody raised against the middle region of PRKRA

PRKRA antibody

70R-5897 50 ug
EUR 467
Description: Rabbit polyclonal PRKRA antibody raised against the N terminal of PRKRA

PRKRA Antibody

1-CSB-PA018717GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PRKRA. Recognizes PRKRA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

PRKRA Antibody

ABD7334 100 ug
EUR 438

PRKRA Polyclonal Antibody, Biotin Conjugated

A68271 100 µg
EUR 570.55
Description: reagents widely cited

PRKRA Polyclonal Antibody, FITC Conjugated

A68272 100 µg
EUR 570.55
Description: Ask the seller for details

PRKRA Polyclonal Antibody, HRP Conjugated

A68273 100 µg
EUR 570.55
Description: The best epigenetics products

Prkra/ Rat Prkra ELISA Kit

ELI-21653r 96 Tests
EUR 886

PRKRA (pS246) Antibody

abx032043-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

PRKRA (pS246) Antibody

abx032043-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

PRKRA Conjugated Antibody

C32843 100ul
EUR 397

PRKRA Antibody (HRP)

20-abx306568
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PRKRA Antibody (FITC)

20-abx306569
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PRKRA Antibody (Biotin)

20-abx306570
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-PRKRA antibody

STJ27370 100 µl
EUR 277
Description: This gene encodes a protein kinase activated by double-stranded RNA which mediates the effects of interferon in response to viral infection. Mutations in this gene have been associated with dystonia. Alternative splicing results in multiple transcript variants.

Anti-PRKRA antibody

STJ193032 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PRKRA

PRKRA siRNA

20-abx904247
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PRKRA siRNA

20-abx929793
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PRKRA siRNA

20-abx929794
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PRKRA Antibody, HRP conjugated

1-CSB-PA13669B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRKRA. Recognizes PRKRA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PRKRA Antibody, FITC conjugated

1-CSB-PA13669C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRKRA. Recognizes PRKRA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PRKRA Antibody, Biotin conjugated

1-CSB-PA13669D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PRKRA. Recognizes PRKRA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PRKRA Blocking Peptide

33R-8043 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PRKRA antibody, catalog no. 70R-5896

PRKRA Blocking Peptide

33R-6483 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PRKRA antibody, catalog no. 70R-5897

PRKRA Blocking Peptide

DF7334-BP 1mg
EUR 195

PRKRA cloning plasmid

CSB-CL018717HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 942
  • Sequence: atgtcccagagcaggcaccgcgccgaggccccgccgctggagcgcgaggacagtgggaccttcagtttggggaagatgataacagctaagccagggaaaacaccgattcaggtattacacgaatacggcatgaagaccaagaacatcccagtttatgaatgtgaaagatctgatgt
  • Show more
Description: A cloning plasmid for the PRKRA gene.

PRKRA protein (His tag)

80R-3908 50 ug
EUR 435
Description: Purified recombinant PRKRA protein (His tag)

Bovine PRKRA ELISA KIT

ELI-15441b 96 Tests
EUR 928

Mouse Prkra ELISA KIT

ELI-43081m 96 Tests
EUR 865

Human PRKRA ELISA KIT

ELI-45408h 96 Tests
EUR 824

Rat PRKRA shRNA Plasmid

20-abx989655
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PRKRA shRNA Plasmid

20-abx973595
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PRKRA shRNA Plasmid

20-abx955642
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-Myc-Prkra-m

PVT14616 2 ug
EUR 495

PRKRA Recombinant Protein (Human)

RP024649 100 ug Ask for price

PRKRA Recombinant Protein (Mouse)

RP164504 100 ug Ask for price

PRKRA Recombinant Protein (Rat)

RP222104 100 ug Ask for price

Prkra ORF Vector (Rat) (pORF)

ORF074036 1.0 ug DNA
EUR 506

PRKRA ORF Vector (Human) (pORF)

ORF008217 1.0 ug DNA
EUR 95

Prkra ORF Vector (Mouse) (pORF)

ORF054836 1.0 ug DNA
EUR 506

Prkra sgRNA CRISPR Lentivector set (Rat)

K6334801 3 x 1.0 ug
EUR 339

Prkra sgRNA CRISPR Lentivector set (Mouse)

K3838201 3 x 1.0 ug
EUR 339

PRKRA sgRNA CRISPR Lentivector set (Human)

K1723101 3 x 1.0 ug
EUR 339

Prkra sgRNA CRISPR Lentivector (Rat) (Target 1)

K6334802 1.0 ug DNA
EUR 154

Prkra sgRNA CRISPR Lentivector (Rat) (Target 2)

K6334803 1.0 ug DNA
EUR 154

Prkra sgRNA CRISPR Lentivector (Rat) (Target 3)

K6334804 1.0 ug DNA
EUR 154

Prkra sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3838202 1.0 ug DNA
EUR 154

Prkra sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3838203 1.0 ug DNA
EUR 154

Prkra sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3838204 1.0 ug DNA
EUR 154

PRKRA sgRNA CRISPR Lentivector (Human) (Target 1)

K1723102 1.0 ug DNA
EUR 154

PRKRA sgRNA CRISPR Lentivector (Human) (Target 2)

K1723103 1.0 ug DNA
EUR 154

PRKRA sgRNA CRISPR Lentivector (Human) (Target 3)

K1723104 1.0 ug DNA
EUR 154

PRKRA Protein Vector (Rat) (pPB-C-His)

PV296142 500 ng
EUR 603

PRKRA Protein Vector (Rat) (pPB-N-His)

PV296143 500 ng
EUR 603

PRKRA Protein Vector (Rat) (pPM-C-HA)

PV296144 500 ng
EUR 603

PRKRA Protein Vector (Rat) (pPM-C-His)

PV296145 500 ng
EUR 603

PRKRA Protein Vector (Human) (pPB-C-His)

PV032865 500 ng
EUR 329

PRKRA Protein Vector (Human) (pPB-N-His)

PV032866 500 ng
EUR 329

PRKRA Protein Vector (Human) (pPM-C-HA)

PV032867 500 ng
EUR 329

PRKRA Protein Vector (Human) (pPM-C-His)

PV032868 500 ng
EUR 329

PRKRA Protein Vector (Mouse) (pPB-C-His)

PV219342 500 ng
EUR 603

PRKRA Protein Vector (Mouse) (pPB-N-His)

PV219343 500 ng
EUR 603

PRKRA Protein Vector (Mouse) (pPM-C-HA)

PV219344 500 ng
EUR 603

PRKRA Protein Vector (Mouse) (pPM-C-His)

PV219345 500 ng
EUR 603

Recombinant Human PRKRA Protein, His, E.coli-10ug

QP13146-10ug 10ug
EUR 201

Recombinant Human PRKRA Protein, His, E.coli-1mg

QP13146-1mg 1mg
EUR 5251

Recombinant Human PRKRA Protein, His, E.coli-2ug

QP13146-2ug 2ug
EUR 155

Prkra 3'UTR Luciferase Stable Cell Line

TU116965 1.0 ml Ask for price

Prkra 3'UTR GFP Stable Cell Line

TU166965 1.0 ml Ask for price

Prkra 3'UTR Luciferase Stable Cell Line

TU216788 1.0 ml Ask for price

Prkra 3'UTR GFP Stable Cell Line

TU266788 1.0 ml Ask for price

PRKRA 3'UTR GFP Stable Cell Line

TU068842 1.0 ml
EUR 1394

PRKRA 3'UTR Luciferase Stable Cell Line

TU018842 1.0 ml
EUR 1394

PRKRA Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV683017 1.0 ug DNA
EUR 514

PRKRA Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV683021 1.0 ug DNA
EUR 514

PRKRA Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV683022 1.0 ug DNA
EUR 514

PRKRA Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV792463 1.0 ug DNA
EUR 316

PRKRA Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV792464 1.0 ug DNA
EUR 316

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

PRKRA Rabbit Polyclonal Antibody