MC3R Rabbit Polyclonal Antibody

MC3R Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

MC3R Polyclonal Antibody
ABP59234-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human MC3R protein at amino acid sequence of 280-360 Applications tips:
Description: A polyclonal antibody for detection of MC3R from Human, Mouse, Rat. This MC3R antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MC3R protein at amino acid sequence of 280-360

MC3R Polyclonal Antibody
ES11655-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MC3R from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MC3R Polyclonal Antibody
ES11655-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MC3R from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MC3R Rabbit pAb
A11609-100ul	Abclonal	100 ul	EUR 308

MC3R Rabbit pAb
A11609-200ul	Abclonal	200 ul	EUR 459

MC3R Rabbit pAb
A11609-20ul	Abclonal	20 ul	EUR 183

MC3R Rabbit pAb
A11609-50ul	Abclonal	50 ul	EUR 223

MC3R Rabbit pAb
A11654-100ul	Abclonal	100 ul	EUR 308

MC3R Rabbit pAb
A11654-200ul	Abclonal	200 ul	EUR 459

MC3R Rabbit pAb
A11654-20ul	Abclonal	20 ul	EUR 183

MC3R Rabbit pAb
A11654-50ul	Abclonal	50 ul	EUR 223

MC3R Rabbit pAb
A3011-100ul	Abclonal	100 ul	EUR 308

MC3R Rabbit pAb
A3011-200ul	Abclonal	200 ul	EUR 459

MC3R Rabbit pAb
A3011-20ul	Abclonal	20 ul	EUR 183

MC3R Rabbit pAb
A3011-50ul	Abclonal	50 ul	EUR 223

Polyclonal MC3R Antibody (Center)
APR08365G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MC3R (Center). This antibody is tested and proven to work in the following applications:

MC3R Antibody
36971-100ul	SAB	100ul	EUR 252

MC3R antibody
38535-100ul	SAB	100ul	EUR 252

MC3R Antibody
CSB-PA261897-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in pH7.3 PBS, 0.05% NaN3, 50% Glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against MC3R. Recognizes MC3R from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

MC3R Antibody
CSB-PA261897-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in pH7.3 PBS, 0.05% NaN3, 50% Glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against MC3R. Recognizes MC3R from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

MC3R Antibody
1-CSB-PA013560LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MC3R. Recognizes MC3R from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

Polyclonal MC3R Antibody (C-term)
APR08364G	Leading Biology	0.1ml	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MC3R (C-term). This antibody is tested and proven to work in the following applications:

MC3R Polyclonal Antibody, HRP Conjugated
A69588	EpiGentek	100 ?g	EUR 628.55
Description: Ask the seller for details

MC3R Polyclonal Antibody, FITC Conjugated
A69589	EpiGentek	100 ?g	EUR 628.55
Description: The best epigenetics products

MC3R Polyclonal Antibody, Biotin Conjugated
A69590	EpiGentek	100 ?g	EUR 628.55
Description: kits suitable for this type of research

MC3R Conjugated Antibody
C36971	SAB	100ul	EUR 397

MC3R Conjugated Antibody
C38535	SAB	100ul	EUR 397

anti- MC3R antibody
FNab05045	FN Test	100µg	EUR 585
Immunogen: melanocortin 3 receptor Uniprot ID: P41968 Gene ID: 4159 Research Area: Neuroscience, Signal Transduction
Description: Antibody raised against MC3R

Anti-MC3R antibody
PAab05045	Lifescience Market	100 ug	EUR 412

Anti-MC3R antibody
STJ27686	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a G-protein-coupled receptor for melanocyte-stimulating hormone and adrenocorticotropic hormone that is expressed in tissues other than the adrenal cortex and melanocytes. This gene maps to the same region as the locus for benign neonatal epilepsy. Mice deficient for this gene have increased fat mass despite decreased food intake, suggesting a role for this gene product in the regulation of energy homeostasis. Mutations in this gene are associated with a susceptibility to obesity in humans.

Anti-MC3R antibody
STJ113214	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a G-protein-coupled receptor for melanocyte-stimulating hormone and adrenocorticotropic hormone that is expressed in tissues other than the adrenal cortex and melanocytes. This gene maps to the same region as the locus for benign neonatal epilepsy. Mice deficient for this gene have increased fat mass despite decreased food intake, suggesting a role for this gene product in the regulation of energy homeostasis. Mutations in this gene are associated with a susceptibility to obesity in humans.

Anti-MC3R antibody
STJ113256	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a G-protein-coupled receptor for melanocyte-stimulating hormone and adrenocorticotropic hormone that is expressed in tissues other than the adrenal cortex and melanocytes. This gene maps to the same region as the locus for benign neonatal epilepsy. Mice deficient for this gene have increased fat mass despite decreased food intake, suggesting a role for this gene product in the regulation of energy homeostasis. Mutations in this gene are associated with a susceptibility to obesity in humans.

Anti-MC3R Antibody
STJ501725	St John's Laboratory	100 µg	EUR 476

Anti-MC3R antibody
STJ192813	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to MC3R

Mc3r/ Rat Mc3r ELISA Kit
ELI-43039r	Lifescience Market	96 Tests	EUR 886

MC3R siRNA
20-abx903183	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MC3R siRNA
20-abx923695	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MC3R siRNA
20-abx923696	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MC3R Antibody, HRP conjugated
1-CSB-PA013560LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MC3R. Recognizes MC3R from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MC3R Antibody, FITC conjugated
1-CSB-PA013560LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MC3R. Recognizes MC3R from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MC3R Antibody, Biotin conjugated
1-CSB-PA013560LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MC3R. Recognizes MC3R from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-MC3R Antibody (Biotin)
STJ501730	St John's Laboratory	100 µg	EUR 586

Anti-MC3R Antibody (FITC)
STJ501731	St John's Laboratory	100 µg	EUR 586

MC3R cloning plasmid
CSB-CL013560HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1083 Sequence: atgagcatccaaaagacgtatctggagggagattttgtctttcctgtgagcagcagcagcttcctacggaccctgctggagccccagctcggatcagcccttctgacagcaatgaatgcttcgtgctgcctgccctctgttcagccaacactgcctaatggctcggagcacctcc Show more
Description: A cloning plasmid for the MC3R gene.

MC3R cloning plasmid
CSB-CL013560HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1083 Sequence: ATGAGCATCCAAAAGACGTATCTGGAGGGAGATTTTGTCTTTCCTGTGAGCAGCAGCAGCTTCCTACGGACCCTGCTGGAGCCCCAGCTCGGATCAGCCCTTCTGACAGCAATGAATGCTTCGTGCTGCCTGCCCTCTGTTCAGCCAACACTGCCTAATGGCTCGGAGCACCTCC Show more
Description: A cloning plasmid for the MC3R gene.

Anti-MC3 Receptor/MC3R Antibody
A02841-2	BosterBio	100ug/vial	EUR 294

Melanocortin 3 Receptor (MC3R) Antibody
20-abx126135	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Melanocortin 3 Receptor (MC3R) Antibody
20-abx126136	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Melanocortin 3 Receptor (MC3R) Antibody
abx034077-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Melanocortin 3 Receptor (MC3R) Antibody
abx034077-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Melanocortin 3 Receptor (MC3R) Antibody
abx235045-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Melanocortin 3 Receptor (MC3R) Antibody
abx332792-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Melanocortin 3 Receptor (MC3R) Antibody
20-abx334291	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Melanocortin 3 Receptor (MC3R) Antibody
abx432962-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Melanocortin 3 Receptor (MC3R) Antibody
20-abx002184	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Melanocortin 3 Receptor (MC3R) Antibody (HRP)
20-abx336468	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Melanocortin 3 Receptor (MC3R) Antibody (FITC)
20-abx336469	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Melanocortin 3 Receptor (MC3R) Antibody (Biotin)
20-abx336470	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

MC3R ELISA KIT|Human
EF010862	Lifescience Market	96 Tests	EUR 689

Rat MC3R shRNA Plasmid
20-abx985417	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human MC3R shRNA Plasmid
20-abx952831	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse MC3R shRNA Plasmid
20-abx971456	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

MC3R Recombinant Protein (Human)
RP018946	ABM	100 ug	Ask for price

MC3R Recombinant Protein (Human)
RP041278	ABM	100 ug	Ask for price

MC3R Recombinant Protein (Mouse)
RP149756	ABM	100 ug	Ask for price

MC3R Recombinant Protein (Rat)
RP211067	ABM	100 ug	Ask for price

Rabbit Anti-Human Melanocortin Receptor 3 (MC3R) antiserum # 1
MCR31-S	Alpha Diagnostics	100 ul	EUR 457

Rabbit Anti-Mouse Melanocortin Receptor 3 (MC3R) antiserum # 2
MCR32-S	Alpha Diagnostics	100 ul	EUR 457

Mc3r ORF Vector (Rat) (pORF)
ORF070357	ABM	1.0 ug DNA	EUR 506

MC3R ORF Vector (Human) (pORF)
ORF006316	ABM	1.0 ug DNA	EUR 95

MC3R ORF Vector (Human) (pORF)
ORF013760	ABM	1.0 ug DNA	EUR 354

Mc3r ORF Vector (Mouse) (pORF)
ORF049920	ABM	1.0 ug DNA	EUR 506

MC3R ELISA Kit (Rat) (OKEI00933)
OKEI00933	Aviva Systems Biology	96 Wells	EUR 767
Description: Description of target: Receptor for MSH (alpha, beta and gamma) and ACTH. This receptor is mediated by G proteins which activate adenylate cyclase. Required for expression of anticipatory patterns of activity and wakefulness during periods of limited nutrient availability and for the normal regulation of circadian clock activity in the brain.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 46.9 pg/mL

Rabbit Anti-Human Melanocortin Receptor 3 (MC3R) IgG # 1, aff pure
MCR31-A	Alpha Diagnostics	100 ug	EUR 482

Rabbit Anti-Mouse Melanocortin Receptor 3 (MC3R) IgG # 2, aff pure
MCR32-A	Alpha Diagnostics	100 ug	EUR 482

Mc3r sgRNA CRISPR Lentivector set (Rat)
K6870301	ABM	3 x 1.0 ug	EUR 339

MC3R sgRNA CRISPR Lentivector set (Human)
K1277001	ABM	3 x 1.0 ug	EUR 339

Mc3r sgRNA CRISPR Lentivector set (Mouse)
K4443101	ABM	3 x 1.0 ug	EUR 339

Human Melanocortin receptor 3, MC3R ELISA KIT
ELI-43038h	Lifescience Market	96 Tests	EUR 824

Rat Melanocortin Receptor 3 (MC3R) ELISA Kit
abx354241-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Human Melanocortin 3 Receptor (MC3R) ELISA Kit
abx388449-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Melanocortin receptor 3, Mc3r ELISA KIT
ELI-39668m	Lifescience Market	96 Tests	EUR 865

Mc3r sgRNA CRISPR Lentivector (Rat) (Target 1)
K6870302	ABM	1.0 ug DNA	EUR 154

Mc3r sgRNA CRISPR Lentivector (Rat) (Target 2)
K6870303	ABM	1.0 ug DNA	EUR 154

Mc3r sgRNA CRISPR Lentivector (Rat) (Target 3)
K6870304	ABM	1.0 ug DNA	EUR 154

MC3R sgRNA CRISPR Lentivector (Human) (Target 1)
K1277002	ABM	1.0 ug DNA	EUR 154

MC3R sgRNA CRISPR Lentivector (Human) (Target 2)
K1277003	ABM	1.0 ug DNA	EUR 154

MC3R sgRNA CRISPR Lentivector (Human) (Target 3)
K1277004	ABM	1.0 ug DNA	EUR 154

Mc3r sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4443102	ABM	1.0 ug DNA	EUR 154

Mc3r sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4443103	ABM	1.0 ug DNA	EUR 154

Mc3r sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4443104	ABM	1.0 ug DNA	EUR 154

MC3R Protein Vector (Human) (pPB-C-His)
PV025261	ABM	500 ng	EUR 329

MC3R Protein Vector (Human) (pPB-N-His)
PV025262	ABM	500 ng	EUR 329

MC3R Protein Vector (Human) (pPM-C-HA)
PV025263	ABM	500 ng	EUR 329

MC3R Protein Vector (Human) (pPM-C-His)
PV025264	ABM	500 ng	EUR 329

MC3R Protein Vector (Rat) (pPB-C-His)
PV281426	ABM	500 ng	EUR 603

MC3R Protein Vector (Rat) (pPB-N-His)
PV281427	ABM	500 ng	EUR 603

MC3R Protein Vector (Rat) (pPM-C-HA)
PV281428	ABM	500 ng	EUR 603

MC3R Protein Vector (Rat) (pPM-C-His)
PV281429	ABM	500 ng	EUR 603

MC3R Protein Vector (Mouse) (pPB-C-His)
PV199678	ABM	500 ng	EUR 603

MC3R Protein Vector (Mouse) (pPB-N-His)
PV199679	ABM	500 ng	EUR 603

MC3R Protein Vector (Mouse) (pPM-C-HA)
PV199680	ABM	500 ng	EUR 603

MC3R Protein Vector (Mouse) (pPM-C-His)
PV199681	ABM	500 ng	EUR 603

Human Melanocortin 3 Receptor(MC3R)ELISA Kit
QY-E03127	Qayee Biotechnology	96T	EUR 361

MC3R Protein Vector (Human) (pPB-C-His)
PV055037	ABM	500 ng	EUR 481

MC3R Protein Vector (Human) (pPB-N-His)
PV055038	ABM	500 ng	EUR 481

MC3R Protein Vector (Human) (pPM-C-HA)
PV055039	ABM	500 ng	EUR 481

MC3R Protein Vector (Human) (pPM-C-His)
PV055040	ABM	500 ng	EUR 481

Mc3r 3'UTR Luciferase Stable Cell Line
TU112978	ABM	1.0 ml	Ask for price

Mc3r 3'UTR GFP Stable Cell Line
TU162978	ABM	1.0 ml	Ask for price

Mc3r 3'UTR Luciferase Stable Cell Line
TU212943	ABM	1.0 ml	Ask for price

Mc3r 3'UTR GFP Stable Cell Line
TU262943	ABM	1.0 ml	Ask for price

MC3R 3'UTR GFP Stable Cell Line
TU063090	ABM	1.0 ml	EUR 2333

MC3R 3'UTR Luciferase Stable Cell Line
TU013090	ABM	1.0 ml	EUR 2333

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul	SAB	100ul	EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul	SAB	50ul	EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul	SAB	100ul	EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul	SAB	50ul	EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul	SAB	100ul	EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul	SAB	50ul	EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml	Abbkine	0.05ml	EUR 147
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml	Abbkine	0.2ml	EUR 332
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5	Abbkine	0.2ml×5	EUR 920
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody
ABP57463-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody
ABP57569-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody
ABP57570-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK3 Rabbit Polyclonal Antibody
ABP57572-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody
ABP57572-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody
ABP57572-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

MEK2 Rabbit Polyclonal Antibody
ABP57573-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody
ABP57573-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody
ABP57573-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK3 Rabbit Polyclonal Antibody
ABP57574-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody
ABP57574-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody
ABP57574-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

Nrf2 Rabbit Polyclonal Antibody
ABP57575-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Nrf2 Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody
ABP57575-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Nrf2 Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody
ABP57575-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Nrf2 Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

ATG4a Rabbit Polyclonal Antibody
ABP57576-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG4a Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody
ABP57576-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG4a Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody
ABP57576-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG4a Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4b Rabbit Polyclonal Antibody
ABP57577-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG4b Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4b Rabbit Polyclonal Antibody
ABP57577-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG4b Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4b Rabbit Polyclonal Antibody
ABP57577-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG4b Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4c Rabbit Polyclonal Antibody
ABP57578-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG4c Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG4c Rabbit Polyclonal Antibody
ABP57578-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG4c Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG4c Rabbit Polyclonal Antibody
ABP57578-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG4c Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG5 Rabbit Polyclonal Antibody
ABP57579-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG5 Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG5 Rabbit Polyclonal Antibody
ABP57579-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG5 Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG5 Rabbit Polyclonal Antibody
ABP57579-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG5 Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG7 Rabbit Polyclonal Antibody
ABP57580-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG7 Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

ATG7 Rabbit Polyclonal Antibody
ABP57580-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG7 Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

ATG7 Rabbit Polyclonal Antibody
ABP57580-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG7 Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

ATG13 Rabbit Polyclonal Antibody
ABP57581-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57581-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57581-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATG13 Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

MC3R Rabbit Polyclonal Antibody