MC3R Rabbit Polyclonal Antibody

MC3R Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

MC3R Polyclonal Antibody
ABP59234-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MC3R protein at amino acid sequence of 280-360
  • Applications tips:
Description: A polyclonal antibody for detection of MC3R from Human, Mouse, Rat. This MC3R antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MC3R protein at amino acid sequence of 280-360

MC3R Polyclonal Antibody
ES11655-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MC3R from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MC3R Polyclonal Antibody
ES11655-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MC3R from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MC3R Rabbit pAb
A11609-100ul 100 ul
EUR 308

MC3R Rabbit pAb
A11609-200ul 200 ul
EUR 459

MC3R Rabbit pAb
A11609-20ul 20 ul
EUR 183

MC3R Rabbit pAb
A11609-50ul 50 ul
EUR 223

MC3R Rabbit pAb
A11654-100ul 100 ul
EUR 308

MC3R Rabbit pAb
A11654-200ul 200 ul
EUR 459

MC3R Rabbit pAb
A11654-20ul 20 ul
EUR 183

MC3R Rabbit pAb
A11654-50ul 50 ul
EUR 223

MC3R Rabbit pAb
A3011-100ul 100 ul
EUR 308

MC3R Rabbit pAb
A3011-200ul 200 ul
EUR 459

MC3R Rabbit pAb
A3011-20ul 20 ul
EUR 183

MC3R Rabbit pAb
A3011-50ul 50 ul
EUR 223

Polyclonal MC3R Antibody (Center)
APR08365G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MC3R (Center). This antibody is tested and proven to work in the following applications:

MC3R Antibody
36971-100ul 100ul
EUR 252

MC3R antibody
38535-100ul 100ul
EUR 252

MC3R Antibody
CSB-PA261897-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in pH7.3 PBS, 0.05% NaN3, 50% Glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against MC3R. Recognizes MC3R from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

MC3R Antibody
CSB-PA261897-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in pH7.3 PBS, 0.05% NaN3, 50% Glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against MC3R. Recognizes MC3R from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

MC3R Antibody
1-CSB-PA013560LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MC3R. Recognizes MC3R from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

Polyclonal MC3R Antibody (C-term)
APR08364G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MC3R (C-term). This antibody is tested and proven to work in the following applications:

MC3R Polyclonal Antibody, HRP Conjugated
A69588 100 ?g
EUR 628.55
Description: Ask the seller for details

MC3R Polyclonal Antibody, FITC Conjugated
A69589 100 ?g
EUR 628.55
Description: The best epigenetics products

MC3R Polyclonal Antibody, Biotin Conjugated
A69590 100 ?g
EUR 628.55
Description: kits suitable for this type of research

MC3R Conjugated Antibody
C36971 100ul
EUR 397

MC3R Conjugated Antibody
C38535 100ul
EUR 397

anti- MC3R antibody
FNab05045 100µg
EUR 585
  • Immunogen: melanocortin 3 receptor
  • Uniprot ID: P41968
  • Gene ID: 4159
  • Research Area: Neuroscience, Signal Transduction
Description: Antibody raised against MC3R

Anti-MC3R antibody
PAab05045 100 ug
EUR 412

Anti-MC3R antibody
STJ27686 100 µl
EUR 277
Description: This gene encodes a G-protein-coupled receptor for melanocyte-stimulating hormone and adrenocorticotropic hormone that is expressed in tissues other than the adrenal cortex and melanocytes. This gene maps to the same region as the locus for benign neonatal epilepsy. Mice deficient for this gene have increased fat mass despite decreased food intake, suggesting a role for this gene product in the regulation of energy homeostasis. Mutations in this gene are associated with a susceptibility to obesity in humans.

Anti-MC3R antibody
STJ113214 100 µl
EUR 277
Description: This gene encodes a G-protein-coupled receptor for melanocyte-stimulating hormone and adrenocorticotropic hormone that is expressed in tissues other than the adrenal cortex and melanocytes. This gene maps to the same region as the locus for benign neonatal epilepsy. Mice deficient for this gene have increased fat mass despite decreased food intake, suggesting a role for this gene product in the regulation of energy homeostasis. Mutations in this gene are associated with a susceptibility to obesity in humans.

Anti-MC3R antibody
STJ113256 100 µl
EUR 277
Description: This gene encodes a G-protein-coupled receptor for melanocyte-stimulating hormone and adrenocorticotropic hormone that is expressed in tissues other than the adrenal cortex and melanocytes. This gene maps to the same region as the locus for benign neonatal epilepsy. Mice deficient for this gene have increased fat mass despite decreased food intake, suggesting a role for this gene product in the regulation of energy homeostasis. Mutations in this gene are associated with a susceptibility to obesity in humans.

Anti-MC3R Antibody
STJ501725 100 µg
EUR 476

Anti-MC3R antibody
STJ192813 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MC3R

Mc3r/ Rat Mc3r ELISA Kit
ELI-43039r 96 Tests
EUR 886

MC3R siRNA
20-abx903183
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MC3R siRNA
20-abx923695
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MC3R siRNA
20-abx923696
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MC3R Antibody, HRP conjugated
1-CSB-PA013560LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MC3R. Recognizes MC3R from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MC3R Antibody, FITC conjugated
1-CSB-PA013560LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MC3R. Recognizes MC3R from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MC3R Antibody, Biotin conjugated
1-CSB-PA013560LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MC3R. Recognizes MC3R from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-MC3R Antibody (Biotin)
STJ501730 100 µg
EUR 586

Anti-MC3R Antibody (FITC)
STJ501731 100 µg
EUR 586

MC3R cloning plasmid
CSB-CL013560HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1083
  • Sequence: atgagcatccaaaagacgtatctggagggagattttgtctttcctgtgagcagcagcagcttcctacggaccctgctggagccccagctcggatcagcccttctgacagcaatgaatgcttcgtgctgcctgccctctgttcagccaacactgcctaatggctcggagcacctcc
  • Show more
Description: A cloning plasmid for the MC3R gene.

MC3R cloning plasmid
CSB-CL013560HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1083
  • Sequence: ATGAGCATCCAAAAGACGTATCTGGAGGGAGATTTTGTCTTTCCTGTGAGCAGCAGCAGCTTCCTACGGACCCTGCTGGAGCCCCAGCTCGGATCAGCCCTTCTGACAGCAATGAATGCTTCGTGCTGCCTGCCCTCTGTTCAGCCAACACTGCCTAATGGCTCGGAGCACCTCC
  • Show more
Description: A cloning plasmid for the MC3R gene.

Anti-MC3 Receptor/MC3R Antibody
A02841-2 100ug/vial
EUR 294

Melanocortin 3 Receptor (MC3R) Antibody
20-abx126135
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Melanocortin 3 Receptor (MC3R) Antibody
20-abx126136
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Melanocortin 3 Receptor (MC3R) Antibody
abx034077-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Melanocortin 3 Receptor (MC3R) Antibody
abx034077-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Melanocortin 3 Receptor (MC3R) Antibody
abx235045-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Melanocortin 3 Receptor (MC3R) Antibody
abx332792-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Melanocortin 3 Receptor (MC3R) Antibody
20-abx334291
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Melanocortin 3 Receptor (MC3R) Antibody
abx432962-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Melanocortin 3 Receptor (MC3R) Antibody
20-abx002184
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Melanocortin 3 Receptor (MC3R) Antibody (HRP)
20-abx336468
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Melanocortin 3 Receptor (MC3R) Antibody (FITC)
20-abx336469
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Melanocortin 3 Receptor (MC3R) Antibody (Biotin)
20-abx336470
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

MC3R ELISA KIT|Human
EF010862 96 Tests
EUR 689

Rat MC3R shRNA Plasmid
20-abx985417
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human MC3R shRNA Plasmid
20-abx952831
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse MC3R shRNA Plasmid
20-abx971456
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MC3R Recombinant Protein (Human)
RP018946 100 ug Ask for price

MC3R Recombinant Protein (Human)
RP041278 100 ug Ask for price

MC3R Recombinant Protein (Mouse)
RP149756 100 ug Ask for price

MC3R Recombinant Protein (Rat)
RP211067 100 ug Ask for price

Rabbit Anti-Human Melanocortin Receptor 3 (MC3R) antiserum # 1
MCR31-S 100 ul
EUR 457

Rabbit Anti-Mouse Melanocortin Receptor 3 (MC3R) antiserum # 2
MCR32-S 100 ul
EUR 457

Mc3r ORF Vector (Rat) (pORF)
ORF070357 1.0 ug DNA
EUR 506

MC3R ORF Vector (Human) (pORF)
ORF006316 1.0 ug DNA
EUR 95

MC3R ORF Vector (Human) (pORF)
ORF013760 1.0 ug DNA
EUR 354

Mc3r ORF Vector (Mouse) (pORF)
ORF049920 1.0 ug DNA
EUR 506

MC3R ELISA Kit (Rat) (OKEI00933)
OKEI00933 96 Wells
EUR 767
Description: Description of target: Receptor for MSH (alpha, beta and gamma) and ACTH. This receptor is mediated by G proteins which activate adenylate cyclase. Required for expression of anticipatory patterns of activity and wakefulness during periods of limited nutrient availability and for the normal regulation of circadian clock activity in the brain.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 46.9 pg/mL

Rabbit Anti-Human Melanocortin Receptor 3 (MC3R) IgG # 1, aff pure
MCR31-A 100 ug
EUR 482

Rabbit Anti-Mouse Melanocortin Receptor 3 (MC3R) IgG # 2, aff pure
MCR32-A 100 ug
EUR 482

Mc3r sgRNA CRISPR Lentivector set (Rat)
K6870301 3 x 1.0 ug
EUR 339

MC3R sgRNA CRISPR Lentivector set (Human)
K1277001 3 x 1.0 ug
EUR 339

Mc3r sgRNA CRISPR Lentivector set (Mouse)
K4443101 3 x 1.0 ug
EUR 339

Human Melanocortin receptor 3, MC3R ELISA KIT
ELI-43038h 96 Tests
EUR 824

Rat Melanocortin Receptor 3 (MC3R) ELISA Kit
abx354241-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Human Melanocortin 3 Receptor (MC3R) ELISA Kit
abx388449-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Melanocortin receptor 3, Mc3r ELISA KIT
ELI-39668m 96 Tests
EUR 865

Mc3r sgRNA CRISPR Lentivector (Rat) (Target 1)
K6870302 1.0 ug DNA
EUR 154

Mc3r sgRNA CRISPR Lentivector (Rat) (Target 2)
K6870303 1.0 ug DNA
EUR 154

Mc3r sgRNA CRISPR Lentivector (Rat) (Target 3)
K6870304 1.0 ug DNA
EUR 154

MC3R sgRNA CRISPR Lentivector (Human) (Target 1)
K1277002 1.0 ug DNA
EUR 154

MC3R sgRNA CRISPR Lentivector (Human) (Target 2)
K1277003 1.0 ug DNA
EUR 154

MC3R sgRNA CRISPR Lentivector (Human) (Target 3)
K1277004 1.0 ug DNA
EUR 154

Mc3r sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4443102 1.0 ug DNA
EUR 154

Mc3r sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4443103 1.0 ug DNA
EUR 154

Mc3r sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4443104 1.0 ug DNA
EUR 154

MC3R Protein Vector (Human) (pPB-C-His)
PV025261 500 ng
EUR 329

MC3R Protein Vector (Human) (pPB-N-His)
PV025262 500 ng
EUR 329

MC3R Protein Vector (Human) (pPM-C-HA)
PV025263 500 ng
EUR 329

MC3R Protein Vector (Human) (pPM-C-His)
PV025264 500 ng
EUR 329

MC3R Protein Vector (Rat) (pPB-C-His)
PV281426 500 ng
EUR 603

MC3R Protein Vector (Rat) (pPB-N-His)
PV281427 500 ng
EUR 603

MC3R Rabbit Polyclonal Antibody