IGKC Rabbit Polyclonal Antibody

IGKC Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

IGKC Polyclonal Antibody
ES11846-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IGKC from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
IGKC Polyclonal Antibody
ABP58905-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human IGKC protein
  • Applications tips:
Description: A polyclonal antibody for detection of IGKC from Human. This IGKC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IGKC protein
IGKC Polyclonal Antibody
ABP58905-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human IGKC protein
  • Applications tips:
Description: A polyclonal antibody for detection of IGKC from Human. This IGKC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IGKC protein
IGKC Polyclonal Antibody
ABP58905-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human IGKC protein
  • Applications tips:
Description: A polyclonal antibody for detection of IGKC from Human. This IGKC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IGKC protein
IGKC Antibody
1-CSB-PA011340LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IGKC. Recognizes IGKC from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200
Anti-IGKC antibody
STJ193004 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to IGKC
IGKC Antibody, HRP conjugated
1-CSB-PA011340LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IGKC. Recognizes IGKC from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
IGKC Antibody, FITC conjugated
1-CSB-PA011340LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IGKC. Recognizes IGKC from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
IGKC Antibody, Biotin conjugated
1-CSB-PA011340LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IGKC. Recognizes IGKC from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
IGKC cloning plasmid
CSB-CL011340HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 705
  • Sequence: atgagggtccccgctcagctcctggggctcctgctgctctggctcccaggtgccagatgtgccatccggatgacccagtctccatcctcattctctgcatctacaggagacagagtcaccatcacttgtcgggcgagtcagagtattggtagttatttagcctggtatcagcaaaa
  • Show more
Description: A cloning plasmid for the IGKC gene.
IGKC cloning plasmid
CSB-CL011340HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 711
  • Sequence: atggacatgagggtcccctctcagctcctggggctcctgctgctctggctcccaggtgccagatgtgacatccagttgacccagtctccatccttcctgtctgcatctgtaggagacagagtcaccatcacttgccgggccagtcagggcattagcagttatttagcctggtatca
  • Show more
Description: A cloning plasmid for the IGKC gene.
IGKC cloning plasmid
CSB-CL011340HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 714
  • Sequence: atggacatgagggtccccgctcagctcctggggctcctgctgctctggttcccaggttccagatgcgacatccacatgacccagtctccatcttctgtgtctgcatctgtaggagacagagtcaccatcacctgtcgggcgagtcagcgtattagcagcagctggttagcctggta
  • Show more
Description: A cloning plasmid for the IGKC gene.
IGKC cloning plasmid
CSB-CL011340HU4-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 723
  • Sequence: ATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCTCTGGGTCCCAGGATCCAGTGGGGATGTTGTGATGACTCAGTCTCCACTCTCCCTGCCCGTCACCCTTGGACAGCCGGCCTCCATCTCCTGCAGGTCTAGTCAAAGCCTCGTATACAGTGATGGAAACACCTACTTGAA
  • Show more
Description: A cloning plasmid for the IGKC gene.
IGKC Recombinant Protein (Human)
RP015805 100 ug Ask for price
IGKC Recombinant Protein (Human)
RP015808 100 ug Ask for price
IGKC Recombinant Protein (Human)
RP015811 100 ug Ask for price
IGKC Recombinant Protein (Human)
RP040006 100 ug Ask for price
IGKC ORF Vector (Human) (pORF)
ORF005269 1.0 ug DNA
EUR 95
IGKC ORF Vector (Human) (pORF)
ORF005270 1.0 ug DNA
EUR 95
IGKC ORF Vector (Human) (pORF)
ORF005271 1.0 ug DNA
EUR 95
IGKC ORF Vector (Human) (pORF)
ORF013336 1.0 ug DNA
EUR 354
Kappa Light Chain/ IGKC MonoSpecific Antibody, Unconjugated-20ug
3514-MSM10-P0 20ug
EUR 233
Kappa Light Chain/ IGKC MonoSpecific Antibody, Unconjugated-100ug
3514-MSM10-P1 100ug
EUR 428
IGKC sgRNA CRISPR Lentivector set (Human)
K1049801 3 x 1.0 ug
EUR 339
Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody
BNC551999-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF555 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody
BNC551999-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF555 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody
BNC552050-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF555 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody
BNC552050-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF555 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody
BNC552289-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF555 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody
BNC552289-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF555 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody
BNC611999-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF660R conjugate, Concentration: 0.1mg/mL
Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody
BNC611999-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF660R conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody
BNC612050-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF660R conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody
BNC612050-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF660R conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody
BNC612289-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF660R conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody
BNC612289-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF660R conjugate, Concentration: 0.1mg/mL
Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody
BNC401999-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF640R conjugate, Concentration: 0.1mg/mL
Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody
BNC401999-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF640R conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody
BNC402050-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF640R conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody
BNC402050-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF640R conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody
BNC402289-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF640R conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody
BNC402289-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF640R conjugate, Concentration: 0.1mg/mL
Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody
BNC471999-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF647 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody
BNC471999-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF647 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody
BNC472050-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF647 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody
BNC472050-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF647 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody
BNC472289-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF647 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody
BNC472289-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF647 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody
BNC051999-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF405M conjugate, Concentration: 0.1mg/mL
Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody
BNC051999-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF405M conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody
BNC052050-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF405M conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody
BNC052050-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF405M conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody
BNC052289-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF405M conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody
BNC052289-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF405M conjugate, Concentration: 0.1mg/mL
Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody
BNC041999-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF405S conjugate, Concentration: 0.1mg/mL
Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody
BNC041999-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF405S conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody
BNC042050-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF405S conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody
BNC042050-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF405S conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody
BNC042289-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF405S conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody
BNC042289-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF405S conjugate, Concentration: 0.1mg/mL
Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody
BNC431999-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF543 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody
BNC431999-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF543 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody
BNC432050-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF543 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody
BNC432050-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF543 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody
BNC432289-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF543 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody
BNC432289-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF543 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody
BNUB1999-100 100uL
EUR 264
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), Concentration: 0.2mg/mL
Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody
BNUB1999-50 50uL
EUR 405
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), 1mg/mL
Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody
BNUB1999-500 500uL
EUR 513
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), Concentration: 0.2mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody
BNUB2050-100 100uL
EUR 264
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), Concentration: 0.2mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody
BNUB2050-50 50uL
EUR 405
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), 1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody
BNUB2050-500 500uL
EUR 513
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), Concentration: 0.2mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody
BNUB2289-100 100uL
EUR 264
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), Concentration: 0.2mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody
BNUB2289-50 50uL
EUR 405
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), 1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody
BNUB2289-500 500uL
EUR 513
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), Concentration: 0.2mg/mL
Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody
BNC681999-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF568 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody
BNC681999-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF568 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody
BNC682050-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF568 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody
BNC682050-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF568 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody
BNC682289-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF568 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody
BNC682289-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF568 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody
BNC701999-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF770 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody
BNC701999-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF770 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody
BNC702050-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF770 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody
BNC702050-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF770 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody
BNC702289-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF770 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody
BNC702289-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF770 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody
BNC881999-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF488A conjugate, Concentration: 0.1mg/mL
Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody
BNC881999-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF488A conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody
BNC882050-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF488A conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody
BNC882050-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF488A conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody
BNC882289-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF488A conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody
BNC882289-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF488A conjugate, Concentration: 0.1mg/mL
Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody
BNC941999-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF594 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody
BNC941999-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF594 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody
BNC942050-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF594 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody
BNC942050-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF594 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody
BNC942289-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF594 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody
BNC942289-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF594 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody
BNCB1999-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), Biotin conjugate, Concentration: 0.1mg/mL
Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody
BNCB1999-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), Biotin conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody
BNCB2050-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), Biotin conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody
BNCB2050-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), Biotin conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody
BNCB2289-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), Biotin conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody
BNCB2289-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), Biotin conjugate, Concentration: 0.1mg/mL
Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody
BNCH1999-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL
Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody
BNCH1999-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody
BNCH2050-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody
BNCH2050-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody
BNCH2289-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody
BNCH2289-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL
Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody
BNC801999-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF680 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody
BNC801999-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF680 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody
BNC802050-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF680 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody
BNC802050-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF680 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody
BNC802289-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF680 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody
BNC802289-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF680 conjugate, Concentration: 0.1mg/mL
Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody
BNCP1999-250 250uL
EUR 394
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), PerCP conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody
BNCP2050-250 250uL
EUR 394
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), PerCP conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody
BNCP2289-250 250uL
EUR 394
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), PerCP conjugate, Concentration: 0.1mg/mL
Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody
BNCR1999-250 250uL
EUR 394
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), RPE conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody
BNCR2050-250 250uL
EUR 394
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), RPE conjugate, Concentration: 0.1mg/mL
Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody
BNCA1999-250 250uL
EUR 394
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), APC conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody
BNCA2050-250 250uL
EUR 394
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), APC conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody
BNCA2289-250 250uL
EUR 394
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), APC conjugate, Concentration: 0.1mg/mL
Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody
BNCAP1999-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL
Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody
BNCAP1999-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody
BNCAP2050-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody
BNCAP2050-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody
BNCAP2289-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody
BNCAP2289-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL
Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody
BNC811999-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF680R conjugate, Concentration: 0.1mg/mL
Kappa Light Chain (B-Cell Marker) (IGKC/1999R) Antibody
BNC811999-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain (B-Cell Marker) (IGKC/1999R), CF680R conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody
BNC812050-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF680R conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709) Antibody
BNC812050-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (rKLC709), CF680R conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody
BNC812289-100 100uL
EUR 233
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF680R conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody
BNC812289-500 500uL
EUR 545
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), CF680R conjugate, Concentration: 0.1mg/mL
Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R) Antibody
BNCR2289-250 250uL
EUR 394
Description: Primary antibody against Kappa Light Chain / IGKC (B-Cell Marker) (KLC2289R), RPE conjugate, Concentration: 0.1mg/mL
IGKC sgRNA CRISPR Lentivector (Human) (Target 1)
K1049802 1.0 ug DNA
EUR 154
IGKC sgRNA CRISPR Lentivector (Human) (Target 2)
K1049803 1.0 ug DNA
EUR 154
IGKC sgRNA CRISPR Lentivector (Human) (Target 3)
K1049804 1.0 ug DNA
EUR 154
IGKC Protein Vector (Human) (pPB-C-His)
PV053341 500 ng
EUR 481
IGKC Protein Vector (Human) (pPB-N-His)
PV053342 500 ng
EUR 481
IGKC Protein Vector (Human) (pPM-C-HA)
PV053343 500 ng
EUR 481
IGKC Protein Vector (Human) (pPM-C-His)
PV053344 500 ng
EUR 481
IGKC Protein Vector (Human) (pPB-C-His)
PV021073 500 ng
EUR 329
IGKC Protein Vector (Human) (pPB-N-His)
PV021074 500 ng
EUR 329
IGKC Protein Vector (Human) (pPM-C-HA)
PV021075 500 ng
EUR 329
IGKC Protein Vector (Human) (pPM-C-His)
PV021076 500 ng
EUR 329
IGKC Protein Vector (Human) (pPB-C-His)
PV021077 500 ng
EUR 329
IGKC Protein Vector (Human) (pPB-N-His)
PV021078 500 ng
EUR 329
IGKC Protein Vector (Human) (pPM-C-HA)
PV021079 500 ng
EUR 329
IGKC Protein Vector (Human) (pPM-C-His)
PV021080 500 ng
EUR 329
IGKC Protein Vector (Human) (pPB-C-His)
PV021081 500 ng
EUR 329
IGKC Protein Vector (Human) (pPB-N-His)
PV021082 500 ng
EUR 329
IGKC Protein Vector (Human) (pPM-C-HA)
PV021083 500 ng
EUR 329
IGKC Protein Vector (Human) (pPM-C-His)
PV021084 500 ng
EUR 329
IGKC 3'UTR Luciferase Stable Cell Line
TU010772 1.0 ml
EUR 1394
IGKC 3'UTR GFP Stable Cell Line
TU060772 1.0 ml
EUR 1394
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IGKC Rabbit Polyclonal Antibody