LPAR4 Rabbit Polyclonal Antibody

LPAR4 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

LPAR4 Polyclonal Antibody

ABP59132-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human LPAR4 protein at amino acid sequence of 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of LPAR4 from Human, Mouse. This LPAR4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LPAR4 protein at amino acid sequence of 10-90

LPAR4 Polyclonal Antibody

ES11623-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against LPAR4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

LPAR4 Polyclonal Antibody

ES11623-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against LPAR4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

LPAR4 Rabbit pAb

A3060-100ul 100 ul
EUR 308

LPAR4 Rabbit pAb

A3060-200ul 200 ul
EUR 459

LPAR4 Rabbit pAb

A3060-20ul 20 ul Ask for price

LPAR4 Rabbit pAb

A3060-50ul 50 ul
EUR 223

LPAR4 Antibody

31253-100ul 100ul
EUR 252

LPAR4 Antibody

31253-50ul 50ul
EUR 187

LPAR4 Antibody

1-CSB-PA943910
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LPAR4. Recognizes LPAR4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:25-1:100

LPAR4 Antibody

1-CSB-PA281843
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LPAR4. Recognizes LPAR4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000

LPAR4 Antibody

1-CSB-PA037833
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LPAR4. Recognizes LPAR4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

LPAR4 Antibody

1-CSB-PA013050LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LPAR4. Recognizes LPAR4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:200-1:500, IF:1:50-1:200

LPAR4 Polyclonal Antibody, HRP Conjugated

A62887 100 µg
EUR 570.55
Description: Ask the seller for details

LPAR4 Polyclonal Antibody, FITC Conjugated

A62888 100 µg
EUR 570.55
Description: The best epigenetics products

LPAR4 Polyclonal Antibody, Biotin Conjugated

A62889 100 µg
EUR 570.55
Description: kits suitable for this type of research

Polyclonal LPAR4 / GPR23 Antibody (Cytoplasmic Domain)

APR12452G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LPAR4 / GPR23 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

Polyclonal LPAR4 / GPR23 Antibody (N-Terminus)

APR12453G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LPAR4 / GPR23 (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal LPAR4 antibody - C-terminal region

APR12454G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LPAR4 - C-terminal region. This antibody is tested and proven to work in the following applications:

Polyclonal LPAR4 / GPR23 Antibody (C-Terminus)

AMM06330G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LPAR4 / GPR23 (C-Terminus). This antibody is tested and proven to work in the following applications:

LPAR4 Conjugated Antibody

C31253 100ul
EUR 397

anti- LPAR4 antibody

FNab04824 100µg
EUR 505.25
  • Immunogen: lysophosphatidic acid receptor 4
  • Uniprot ID: Q99677
  • Gene ID: 2846
  • Research Area: Signal Transduction
Description: Antibody raised against LPAR4

Anti-LPAR4 antibody

PAab04824 100 ug
EUR 355

Anti-LPAR4 antibody

STJ24418 100 µl
EUR 277
Description: This gene encodes a member of the lysophosphatidic acid receptor family. It may also be related to the P2Y receptors, a family of receptors that bind purine and pyrimidine nucleotides and are coupled to G proteins. The encoded protein may play a role in monocytic differentiation.

Anti-LPAR4 antibody

STJ192781 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to LPAR4

LPAR4 siRNA

20-abx922746
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LPAR4 siRNA

20-abx922747
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LPAR4 Antibody, HRP conjugated

1-CSB-PA013050LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LPAR4. Recognizes LPAR4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LPAR4 Antibody, FITC conjugated

1-CSB-PA013050LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LPAR4. Recognizes LPAR4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LPAR4 Antibody, Biotin conjugated

1-CSB-PA013050LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LPAR4. Recognizes LPAR4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

LPAR4 cloning plasmid

CSB-CL013050HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1113
  • Sequence: atgggtgacagaagattcattgacttccaattccaagattcaaattcaagcctcagacccaggttgggcaatgctactgccaataatacttgcattgttgatgattccttcaagtataatctcaatggtgctgtctacagtgttgcattcatcttgggtctgataaccaacagtg
  • Show more
Description: A cloning plasmid for the LPAR4 gene.

Human LPAR4 ELISA Kit

ELA-E0645h 96 Tests
EUR 824

LPAR4 ELISA KIT|Human

EF000680 96 Tests
EUR 689

Mouse LPAR4 shRNA Plasmid

20-abx978864
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human LPAR4 shRNA Plasmid

20-abx951909
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LPAR4 Recombinant Protein (Human)

RP018139 100 ug Ask for price

LPAR4 Recombinant Protein (Mouse)

RP147935 100 ug Ask for price

LPAR4 Recombinant Protein (Rat)

RP209795 100 ug Ask for price

Lysophosphatidic Acid Receptor 4 (LPAR4) Antibody

20-abx214671
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lysophosphatidic Acid Receptor 4 (LPAR4) Antibody

20-abx214764
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lysophosphatidic Acid Receptor 4 (LPAR4) Antibody

20-abx212321
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lysophosphatidic Acid Receptor 4 (LPAR4) Antibody

20-abx123010
  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lysophosphatidic Acid Receptor 4 (LPAR4) Antibody

abx234824-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Lysophosphatidic Acid Receptor 4 (LPAR4) Antibody

20-abx318521
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lysophosphatidic Acid Receptor 4 (LPAR4) Antibody (HRP)

20-abx304372
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lysophosphatidic Acid Receptor 4 (LPAR4) Antibody (FITC)

20-abx304373
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lysophosphatidic Acid Receptor 4 (LPAR4) Antibody (Biotin)

20-abx304374
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lpar4 ORF Vector (Rat) (pORF)

ORF069933 1.0 ug DNA
EUR 506

LPAR4 ORF Vector (Human) (pORF)

ORF006047 1.0 ug DNA
EUR 95

Lpar4 ORF Vector (Mouse) (pORF)

ORF049313 1.0 ug DNA
EUR 506

LPAR4 ELISA Kit (Mouse) (OKEH03171)

OKEH03171 96 Wells
EUR 662
Description: Description of target: Receptor for lysophosphatidic acid (LPA), a mediator of diverse cellular activities. Transduces a signal by increasing the intracellular calcium ions and by stimulating adenylyl cyclase activity. The rank order of potency for agonists of this receptor is 1-oleoyl- > 1-stearoyl- > 1-palmitoyl- > 1-myristoyl- > 1-alkyl- > 1-alkenyl-LPA.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.082 ng/mL

Lpar4 sgRNA CRISPR Lentivector set (Rat)

K6376401 3 x 1.0 ug
EUR 339

Lpar4 sgRNA CRISPR Lentivector set (Mouse)

K3832101 3 x 1.0 ug
EUR 339

LPAR4 sgRNA CRISPR Lentivector set (Human)

K1225901 3 x 1.0 ug
EUR 339

Lpar4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6376402 1.0 ug DNA
EUR 154

Lpar4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6376403 1.0 ug DNA
EUR 154

Lpar4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6376404 1.0 ug DNA
EUR 154

Lpar4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3832102 1.0 ug DNA
EUR 154

Lpar4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3832103 1.0 ug DNA
EUR 154

Lpar4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3832104 1.0 ug DNA
EUR 154

LPAR4 sgRNA CRISPR Lentivector (Human) (Target 1)

K1225902 1.0 ug DNA
EUR 154

LPAR4 sgRNA CRISPR Lentivector (Human) (Target 2)

K1225903 1.0 ug DNA
EUR 154

LPAR4 sgRNA CRISPR Lentivector (Human) (Target 3)

K1225904 1.0 ug DNA
EUR 154

LPAR4 Protein Vector (Human) (pPB-C-His)

PV024185 500 ng
EUR 329

LPAR4 Protein Vector (Human) (pPB-N-His)

PV024186 500 ng
EUR 329

LPAR4 Protein Vector (Human) (pPM-C-HA)

PV024187 500 ng
EUR 329

LPAR4 Protein Vector (Human) (pPM-C-His)

PV024188 500 ng
EUR 329

LPAR4 Protein Vector (Rat) (pPB-C-His)

PV279730 500 ng
EUR 603

LPAR4 Protein Vector (Rat) (pPB-N-His)

PV279731 500 ng
EUR 603

LPAR4 Protein Vector (Rat) (pPM-C-HA)

PV279732 500 ng
EUR 603

LPAR4 Protein Vector (Rat) (pPM-C-His)

PV279733 500 ng
EUR 603

LPAR4 Protein Vector (Mouse) (pPB-C-His)

PV197250 500 ng
EUR 603

LPAR4 Protein Vector (Mouse) (pPB-N-His)

PV197251 500 ng
EUR 603

LPAR4 Protein Vector (Mouse) (pPM-C-HA)

PV197252 500 ng
EUR 603

LPAR4 Protein Vector (Mouse) (pPM-C-His)

PV197253 500 ng
EUR 603

Lpar4 3'UTR Luciferase Stable Cell Line

TU112532 1.0 ml Ask for price

Lpar4 3'UTR GFP Stable Cell Line

TU162532 1.0 ml Ask for price

Lpar4 3'UTR Luciferase Stable Cell Line

TU212488 1.0 ml Ask for price

Lpar4 3'UTR GFP Stable Cell Line

TU262488 1.0 ml Ask for price

LPAR4 3'UTR GFP Stable Cell Line

TU062572 1.0 ml
EUR 1394

LPAR4 3'UTR Luciferase Stable Cell Line

TU012572 1.0 ml
EUR 1394

LPAR4 ELISA Kit (Human) : 96 Wells (OKEH02820)

OKEH02820 96 Wells
EUR 662
Description: Description of target: This gene encodes a member of the lysophosphatidic acid receptor family. It may also be related to the P2Y receptors, a family of receptors that bind purine and pyrimidine nucleotides and are coupled to G proteins. The encoded protein may play a role in monocytic differentiation.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.12 ng/mL

Human Lysophosphatidic Acid Receptor 4 (LPAR4) ELISA Kit

abx253944-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Lysophosphatidic Acid Receptor 4 (LPAR4) ELISA Kit

abx254782-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Lpar4/ Lysophosphatidic acid receptor 4 ELISA Kit

E0887Mo 1 Kit
EUR 571

Human LPAR4/ Lysophosphatidic acid receptor 4 ELISA Kit

E1492Hu 1 Kit
EUR 571

Human LPAR4(Lysophosphatidic acid receptor 4) ELISA Kit

EH0990 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: Q99677
  • Alias: LPAR4/Lysophosphatidic acid receptor 4/LPA receptor 4/LPA-4/Purinergic receptor 9/P2Y5-like receptor/G-protein coupled receptor 23/P2Y purinoceptor 9(P2Y9)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Lysophosphatidic acid receptor 4, LPAR4 ELISA KIT

ELI-02277h 96 Tests
EUR 824

Mouse Lysophosphatidic acid receptor 4, Lpar4 ELISA KIT

ELI-02278m 96 Tests
EUR 865

Mouse Lpar4(Lysophosphatidic acid receptor 4) ELISA Kit

EM0427 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q8BLG2
  • Alias: Lpar4/Lysophosphatidic acid receptor 4/LPA receptor 4/LPA-4/Purinergic receptor 9/P2Y5-like receptor/G-protein coupled receptor 23/P2Y purinoceptor 9(P2Y9)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

LPAR4 Rabbit Polyclonal Antibody