OXGR1 Rabbit Polyclonal Antibody

OXGR1 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

OXGR1 Polyclonal Antibody
ABP59780-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human OXGR1 protein at amino acid sequence of 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of OXGR1 from Human, Mouse, Rat. This OXGR1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OXGR1 protein at amino acid sequence of 130-210

OXGR1 Polyclonal Antibody
ABP59780-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human OXGR1 protein at amino acid sequence of 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of OXGR1 from Human, Mouse, Rat. This OXGR1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OXGR1 protein at amino acid sequence of 130-210

OXGR1 Polyclonal Antibody
ABP59780-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human OXGR1 protein at amino acid sequence of 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of OXGR1 from Human, Mouse, Rat. This OXGR1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OXGR1 protein at amino acid sequence of 130-210

OXGR1 Polyclonal Antibody
ES11482-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against OXGR1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

OXGR1 Polyclonal Antibody
ES11482-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against OXGR1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

OXGR1 Rabbit pAb
A15431-100ul 100 ul
EUR 308

OXGR1 Rabbit pAb
A15431-200ul 200 ul
EUR 459

OXGR1 Rabbit pAb
A15431-20ul 20 ul
EUR 183

OXGR1 Rabbit pAb
A15431-50ul 50 ul
EUR 223

OXGR1 Polyclonal Conjugated Antibody
C28963 100ul
EUR 397

Polyclonal OXGR1 Antibody (C-term)
AMM08661G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OXGR1 (C-term). This antibody is tested and proven to work in the following applications:

Oxgr1/ Rat Oxgr1 ELISA Kit
ELI-21812r 96 Tests
EUR 886

Anti-OXGR1 antibody
STJ117626 100 µl
EUR 277

Anti-OXGR1 antibody
STJ192640 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to OXGR1

OXGR1 siRNA
20-abx903793
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

OXGR1 siRNA
20-abx927508
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

OXGR1 siRNA
20-abx927509
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Polyclonal GPR80 / GPR99 / OXGR1 Antibody (Extracellular Domain)
APR16608G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR80 / GPR99 / OXGR1 (Extracellular Domain). This antibody is tested and proven to work in the following applications:

Polyclonal GPR80 / GPR99 / OXGR1 Antibody (Extracellular Domain)
APR16609G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR80 / GPR99 / OXGR1 (Extracellular Domain). This antibody is tested and proven to work in the following applications:

Polyclonal GPR80 / GPR99 / OXGR1 Antibody (N-Terminus)
APR16610G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR80 / GPR99 / OXGR1 (N-Terminus). This antibody is tested and proven to work in the following applications:

OXGR1 cloning plasmid
CSB-CL839388HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1014
  • Sequence: ATGAATGAGCCACTAGACTATTTAGCAAATGCTTCTGATTTCCCCGATTATGCAGCTGCTTTTGGAAATTGCACTGATGAAAACATCCCACTCAAGATGCACTACCTCCCTGTTATTTATGGCATTATCTTCCTCGTGGGATTTCCAGGCAATGCAGTAGTGATATCCACTTACA
  • Show more
Description: A cloning plasmid for the OXGR1 gene.

OXGR1 ELISA KIT|Human
EF005390 96 Tests
EUR 689

Rat OXGR1 shRNA Plasmid
20-abx988436
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human OXGR1 shRNA Plasmid
20-abx959020
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse OXGR1 shRNA Plasmid
20-abx982379
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

OXGR1 Recombinant Protein (Human)
RP041977 100 ug Ask for price

OXGR1 Recombinant Protein (Mouse)
RP159710 100 ug Ask for price

OXGR1 Recombinant Protein (Rat)
RP219014 100 ug Ask for price

2-Oxoglutarate Receptor 1 (OXGR1) Antibody
abx034658-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

2-Oxoglutarate Receptor 1 (OXGR1) Antibody
abx034658-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Oxgr1 ORF Vector (Rat) (pORF)
ORF073006 1.0 ug DNA
EUR 506

OXGR1 ORF Vector (Human) (pORF)
ORF013993 1.0 ug DNA
EUR 95

Oxgr1 ORF Vector (Mouse) (pORF)
ORF053238 1.0 ug DNA
EUR 506

OXGR1 Rabbit Polyclonal Antibody