OXGR1 Rabbit Polyclonal Antibody
To Order Now: info@poweratlas.org
OXGR1 Polyclonal Antibody |
ABP59780-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human OXGR1 protein at amino acid sequence of 130-210
- Applications tips:
|
Description: A polyclonal antibody for detection of OXGR1 from Human, Mouse, Rat. This OXGR1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OXGR1 protein at amino acid sequence of 130-210 |
OXGR1 Polyclonal Antibody |
ABP59780-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human OXGR1 protein at amino acid sequence of 130-210
- Applications tips:
|
Description: A polyclonal antibody for detection of OXGR1 from Human, Mouse, Rat. This OXGR1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OXGR1 protein at amino acid sequence of 130-210 |
OXGR1 Polyclonal Antibody |
ABP59780-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human OXGR1 protein at amino acid sequence of 130-210
- Applications tips:
|
Description: A polyclonal antibody for detection of OXGR1 from Human, Mouse, Rat. This OXGR1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OXGR1 protein at amino acid sequence of 130-210 |
OXGR1 Polyclonal Antibody |
ES11482-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against OXGR1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
OXGR1 Polyclonal Antibody |
ES11482-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against OXGR1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
OXGR1 Rabbit pAb |
A15431-100ul |
Abclonal |
100 ul |
EUR 308 |
OXGR1 Rabbit pAb |
A15431-200ul |
Abclonal |
200 ul |
EUR 459 |
OXGR1 Rabbit pAb |
A15431-20ul |
Abclonal |
20 ul |
EUR 183 |
OXGR1 Rabbit pAb |
A15431-50ul |
Abclonal |
50 ul |
EUR 223 |
OXGR1 Polyclonal Conjugated Antibody |
C28963 |
SAB |
100ul |
EUR 397 |
Polyclonal OXGR1 Antibody (C-term) |
AMM08661G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OXGR1 (C-term). This antibody is tested and proven to work in the following applications: |
Anti-OXGR1 antibody |
STJ192640 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to OXGR1 |
OXGR1 siRNA |
20-abx903793 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
OXGR1 siRNA |
20-abx927508 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
OXGR1 siRNA |
20-abx927509 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Polyclonal GPR80 / GPR99 / OXGR1 Antibody (Extracellular Domain) |
APR16608G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR80 / GPR99 / OXGR1 (Extracellular Domain). This antibody is tested and proven to work in the following applications: |
Polyclonal GPR80 / GPR99 / OXGR1 Antibody (Extracellular Domain) |
APR16609G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR80 / GPR99 / OXGR1 (Extracellular Domain). This antibody is tested and proven to work in the following applications: |
Polyclonal GPR80 / GPR99 / OXGR1 Antibody (N-Terminus) |
APR16610G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR80 / GPR99 / OXGR1 (N-Terminus). This antibody is tested and proven to work in the following applications: |
OXGR1 cloning plasmid |
CSB-CL839388HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1014
- Sequence: ATGAATGAGCCACTAGACTATTTAGCAAATGCTTCTGATTTCCCCGATTATGCAGCTGCTTTTGGAAATTGCACTGATGAAAACATCCCACTCAAGATGCACTACCTCCCTGTTATTTATGGCATTATCTTCCTCGTGGGATTTCCAGGCAATGCAGTAGTGATATCCACTTACA
- Show more
|
Description: A cloning plasmid for the OXGR1 gene. |
Rat OXGR1 shRNA Plasmid |
20-abx988436 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human OXGR1 shRNA Plasmid |
20-abx959020 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse OXGR1 shRNA Plasmid |
20-abx982379 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
OXGR1 Recombinant Protein (Human) |
RP041977 |
ABM |
100 ug |
Ask for price |
OXGR1 Recombinant Protein (Mouse) |
RP159710 |
ABM |
100 ug |
Ask for price |
OXGR1 Recombinant Protein (Rat) |
RP219014 |
ABM |
100 ug |
Ask for price |
2-Oxoglutarate Receptor 1 (OXGR1) Antibody |
abx034658-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
2-Oxoglutarate Receptor 1 (OXGR1) Antibody |
abx034658-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Oxgr1 ORF Vector (Rat) (pORF) |
ORF073006 |
ABM |
1.0 ug DNA |
EUR 506 |
OXGR1 ORF Vector (Human) (pORF) |
ORF013993 |
ABM |
1.0 ug DNA |
EUR 95 |
Oxgr1 ORF Vector (Mouse) (pORF) |
ORF053238 |
ABM |
1.0 ug DNA |
EUR 506 |
OXGR1 Rabbit Polyclonal Antibody