NOX4 Rabbit Polyclonal Antibody

NOX4 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

NOX4 Polyclonal Antibody

ABP59498-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human NOX4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of NOX4 from Human, Mouse, Rat. This NOX4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NOX4 protein

NOX4 Polyclonal Antibody

ABP59498-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NOX4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of NOX4 from Human, Mouse, Rat. This NOX4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NOX4 protein

Nox4 Polyclonal Antibody

A54539 100 µg
EUR 570.55
Description: Ask the seller for details

NOX4 Polyclonal Antibody

A63034 100 µg
EUR 570.55
Description: fast delivery possible

NOX4 Rabbit pAb

A11274-100ul 100 ul
EUR 308

NOX4 Rabbit pAb

A11274-200ul 200 ul
EUR 459

NOX4 Rabbit pAb

A11274-20ul 20 ul
EUR 183

NOX4 Rabbit pAb

A11274-50ul 50 ul
EUR 223

NOX4 Rabbit mAb

A3656-100ul 100 ul
EUR 410

NOX4 Rabbit mAb

A3656-200ul 200 ul
EUR 571

NOX4 Rabbit mAb

A3656-20ul 20 ul
EUR 221

NOX4 Rabbit mAb

A3656-50ul 50 ul
EUR 287

Anti-NOX4 Rabbit Monoclonal Antibody

M00403 100ug/vial
EUR 397
Description: Rabbit Monoclonal NOX4 Antibody. Validated in IP, IF, IHC, ICC, WB and tested in Human, Mouse, Rat.

Polyclonal NOX4 Antibody (N-Terminus)

APR08788G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NOX4 (N-Terminus). This antibody is tested and proven to work in the following applications:

Nox4 Polyclonal Antibody, Biotin Conjugated

A54536 100 µg
EUR 570.55
Description: reagents widely cited

Nox4 Polyclonal Antibody, FITC Conjugated

A54537 100 µg
EUR 570.55
Description: Ask the seller for details

Nox4 Polyclonal Antibody, HRP Conjugated

A54538 100 µg
EUR 570.55
Description: The best epigenetics products

NOX4 Polyclonal Antibody, HRP Conjugated

A63035 100 µg
EUR 570.55
Description: reagents widely cited

NOX4 Polyclonal Antibody, FITC Conjugated

A63036 100 µg
EUR 570.55
Description: Ask the seller for details

NOX4 Polyclonal Antibody, Biotin Conjugated

A63037 100 µg
EUR 570.55
Description: The best epigenetics products

Rabbit NOX4 ELISA Kit

ERTN0050 96Tests
EUR 521

NOX4 antibody

70R-50972 100 ul
EUR 244
Description: Purified Polyclonal NOX4 antibody

NOX4 Antibody

ABD6924 100 ug
EUR 438

NOX4 Antibody

32663-100ul 100ul
EUR 252

NOX4 antibody

70R-18930 50 ul
EUR 435
Description: Rabbit polyclonal NOX4 antibody

NOX4 Antibody

DF6924 200ul
EUR 304
Description: NOX4 Antibody detects endogenous levels of total NOX4.

NOX4 Antibody

1-CSB-PA777165
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NOX4. Recognizes NOX4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

NOX4 Antibody

1-CSB-PA034129
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NOX4. Recognizes NOX4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

NOX4 Antibody

1-CSB-PA015961GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NOX4. Recognizes NOX4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

NOX4 Antibody

1-CSB-PA015961LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NOX4. Recognizes NOX4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

Nox4 Antibody

1-CSB-PA015961LA01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Nox4. Recognizes Nox4 from Rat, Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

DLR-NOX4-Hu-48T 48T
EUR 498
  • Should the Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

DLR-NOX4-Hu-96T 96T
EUR 647
  • Should the Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

DLR-NOX4-Mu-48T 48T
EUR 508
  • Should the Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

DLR-NOX4-Mu-96T 96T
EUR 661
  • Should the Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

DLR-NOX4-Ra-48T 48T
EUR 528
  • Should the Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

DLR-NOX4-Ra-96T 96T
EUR 690
  • Should the Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

RD-NOX4-Hu-48Tests 48 Tests
EUR 500

Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

RD-NOX4-Hu-96Tests 96 Tests
EUR 692

Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

RD-NOX4-Mu-48Tests 48 Tests
EUR 511

Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

RD-NOX4-Mu-96Tests 96 Tests
EUR 709

Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

RD-NOX4-Ra-48Tests 48 Tests
EUR 534

Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

RD-NOX4-Ra-96Tests 96 Tests
EUR 742

Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

RDR-NOX4-Hu-48Tests 48 Tests
EUR 522

Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

RDR-NOX4-Hu-96Tests 96 Tests
EUR 724

Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

RDR-NOX4-Mu-48Tests 48 Tests
EUR 534

Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

RDR-NOX4-Mu-96Tests 96 Tests
EUR 742

Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

RDR-NOX4-Ra-48Tests 48 Tests
EUR 558

Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

RDR-NOX4-Ra-96Tests 96 Tests
EUR 776

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC551245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF555 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC551245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF555 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC611245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF660R conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC611245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF660R conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC401245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF640R conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC401245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF640R conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC431245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF543 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC431245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF543 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC471245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF647 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC471245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF647 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC051245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF405M conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC051245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF405M conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC041245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF405S conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC041245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF405S conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNUB1245-100 100uL
EUR 209
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245), Concentration: 0.2mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNUB1245-500 500uL
EUR 458
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245), Concentration: 0.2mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNUM1245-50 50uL
EUR 395
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245), 1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC681245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF568 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC681245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF568 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC701245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF770 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC701245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF770 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC881245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF488A conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC881245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF488A conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC941245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF594 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC941245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF594 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNCB1245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),Biotin conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNCB1245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),Biotin conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNCH1245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNCH1245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC801245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF680 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC801245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF680 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNCP1245-250 250uL
EUR 383
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),PerCP conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNCR1245-250 250uL
EUR 383
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),RPE conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNCA1245-250 250uL
EUR 383
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),APC conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNCAP1245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNCAP1245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC811245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF680R conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC811245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF680R conjugate, Concentration: 0.1mg/mL

Rabbit Anti-NOX4 monoclonal antibody, clone TZ1325

CABT-38500RH 100 ul
EUR 777

NOX4 Conjugated Antibody

C32663 100ul
EUR 397

anti- NOX4 antibody

FNab05806 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:2000
  • IP: 1:500-1:2000
  • IHC: 1:100-1:400
  • IF: 1:10-1:100
  • Immunogen: NADPH oxidase 4
  • Uniprot ID: Q9NPH5
  • Gene ID: 50507
  • Research Area: Metabolism
Description: Antibody raised against NOX4

Anti-NOX4 antibody

PAab05806 100 ug
EUR 386

Anti-NOX4 antibody

STJ24791 100 µl
EUR 277
Description: This gene encodes a member of the NOX-family of enzymes that functions as the catalytic subunit the NADPH oxidase complex. The encoded protein is localized to non-phagocytic cells where it acts as an oxygen sensor and catalyzes the reduction of molecular oxygen to various reactive oxygen species (ROS). The ROS generated by this protein have been implicated in numerous biological functions including signal transduction, cell differentiation and tumor cell growth. A pseudogene has been identified on the other arm of chromosome 11. Alternative splicing results in multiple transcript variants.

Anti-NOX4 antibody

STJ113053 100 µl
EUR 277
Description: This gene encodes a member of the NOX-family of enzymes that functions as the catalytic subunit the NADPH oxidase complex. The encoded protein is localized to non-phagocytic cells where it acts as an oxygen sensor and catalyzes the reduction of molecular oxygen to various reactive oxygen species (ROS). The ROS generated by this protein have been implicated in numerous biological functions including signal transduction, cell differentiation and tumor cell growth. A pseudogene has been identified on the other arm of chromosome 11. Alternative splicing results in multiple transcript variants.

Anti-NOX4 antibody

STJ193079 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NOX4

Nox4/ Rat Nox4 ELISA Kit

ELI-04894r 96 Tests
EUR 886

NOX4 siRNA

20-abx903611
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NOX4 siRNA

20-abx926191
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NOX4 siRNA

20-abx926192
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NOX4 recombinant monoclonal antibody

A5258 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human NOX4 for WB, IHC, IF,ELISA

NOX4 Antibody, HRP conjugated

1-CSB-PA015961LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NOX4. Recognizes NOX4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

Nox4 Antibody, HRP conjugated

1-CSB-PA015961LB01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Nox4. Recognizes Nox4 from Rat. This antibody is HRP conjugated. Tested in the following application: ELISA

NOX4 Antibody, FITC conjugated

1-CSB-PA015961LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NOX4. Recognizes NOX4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

Nox4 Antibody, FITC conjugated

1-CSB-PA015961LC01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Nox4. Recognizes Nox4 from Rat. This antibody is FITC conjugated. Tested in the following application: ELISA

NOX4 Antibody, Biotin conjugated

1-CSB-PA015961LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NOX4. Recognizes NOX4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Nox4 Antibody, Biotin conjugated

1-CSB-PA015961LD01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Nox4. Recognizes Nox4 from Rat. This antibody is Biotin conjugated. Tested in the following application: ELISA

Rabbit NADPH Oxidase 4 (NOX4) ELISA Kit

abx363460-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monoclonal NOX4 Antibody, Clone: 3H2C4

APR08785G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human NOX4. The antibodies are raised in Mouse and are from clone 3H2C4. This antibody is applicable in WB and IHC, FC, ICC, E

Monoclonal NOX4 Antibody, Clone: 3H2G11

APR08786G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human NOX4. The antibodies are raised in Mouse and are from clone 3H2G11. This antibody is applicable in WB and IHC, FC, ICC, E

NADPH Oxidase 4 (NOX4) Antibody

abx125425-50ul 50 ul
EUR 411
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody

20-abx126267
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody

20-abx114020
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody

20-abx110460
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody

20-abx001813
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody

abx146310-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody

20-abx008166
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody

abx027743-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody

abx027743-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody

abx016156-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody

20-abx214042
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody

abx216479-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody

abx224134-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody

20-abx241251
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody

abx235806-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

NADPH Oxidase 4 (NOX4) Antibody

20-abx301944
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NADPH oxidase 4/NOX4 Antibody

48782-100ul 100ul
EUR 333

NADPH oxidase 4/NOX4 Antibody

48782-50ul 50ul
EUR 239

NOX4 cloning plasmid

CSB-CL015961HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1737
  • Sequence: atggctgtgtcctggaggagctggctcgccaacgaaggggttaaacacctctgcctgttcatctggctctccatgaatgtcctgcttttctggaaaaccttcttgctgtataaccaagggccagagtatcactacctccaccagatgttggggctaggattgtgtctaagcagag
  • Show more
Description: A cloning plasmid for the NOX4 gene.

NOX4 Blocking Peptide

20-abx063847
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

NOX4 Blocking Peptide

DF6924-BP 1mg
EUR 195

Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Polyclonal Antibody (Human)

4-PAB924Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOX4 (Asp220~Asp392)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4)

NADPH oxidase 4/NOX4 Conjugated Antibody

C48782 100ul
EUR 397

NADPH Oxidase 4 (NOX4) Antibody (HRP)

20-abx109013
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody (Biotin)

20-abx106181
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody (FITC)

20-abx107595
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody (HRP)

20-abx304654
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody (FITC)

20-abx304655
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody (Biotin)

20-abx304656
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-NADPH oxidase 4/NOX4 Antibody

A00403 100ug/vial
EUR 334

Anti-NADPH oxidase 4/NOX4 Antibody

PA1929 100ug/vial
EUR 334

Mouse NOX4 shRNA Plasmid

20-abx974073
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat NOX4 shRNA Plasmid

20-abx987026
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NOX4 ELISA Kit

EHN0050 96Tests
EUR 521

Human NOX4 ELISA Kit

ELA-E1488h 96 Tests
EUR 824

Goat NOX4 ELISA Kit

EGTN0050 96Tests
EUR 521

Bovine NOX4 ELISA Kit

EBN0050 96Tests
EUR 521

Chicken NOX4 ELISA Kit

ECKN0050 96Tests
EUR 521

Canine NOX4 ELISA Kit

ECN0050 96Tests
EUR 521

Anserini NOX4 ELISA Kit

EAN0050 96Tests
EUR 521

NOX4 ELISA KIT|Human

EF005809 96 Tests
EUR 689

Porcine NOX4 ELISA Kit

EPN0050 96Tests
EUR 521

Rat NOX4 ELISA Kit

ERN0050 96Tests
EUR 521

Sheep NOX4 ELISA Kit

ESN0050 96Tests
EUR 521

Monkey NOX4 ELISA Kit

EMKN0050 96Tests
EUR 521

Mouse NOX4 ELISA Kit

EMN0050 96Tests
EUR 521

Human NOX4 shRNA Plasmid

20-abx959377
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NOX4 Recombinant Protein (Human)

RP021499 100 ug Ask for price

NOX4 Recombinant Protein (Rat)

RP214274 100 ug Ask for price

pCMV-SPORT6-NOX4 Plasmid

PVT16853 2 ug
EUR 325

NOX4 Recombinant Protein (Mouse)

RP154637 100 ug Ask for price

Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Polyclonal Antibody (Human), APC

4-PAB924Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOX4 (Asp220~Asp392)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4). This antibody is labeled with APC.

Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Polyclonal Antibody (Human), Biotinylated

4-PAB924Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOX4 (Asp220~Asp392)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4). This antibody is labeled with Biotin.

Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Polyclonal Antibody (Human), Cy3

4-PAB924Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOX4 (Asp220~Asp392)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4). This antibody is labeled with Cy3.

Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Polyclonal Antibody (Human), FITC

4-PAB924Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOX4 (Asp220~Asp392)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4). This antibody is labeled with FITC.

Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Polyclonal Antibody (Human), HRP

4-PAB924Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOX4 (Asp220~Asp392)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4). This antibody is labeled with HRP.

Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Polyclonal Antibody (Human), PE

4-PAB924Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOX4 (Asp220~Asp392)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4). This antibody is labeled with PE.

Guinea Pig NOX4 ELISA Kit

EGN0050 96Tests
EUR 521

Rat NADPH oxidase 4 (Nox4)

1-CSB-YP015961RA
  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 40.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat NADPH oxidase 4(Nox4),partial expressed in Yeast

Human NADPH oxidase 4 (NOX4)

1-CSB-EP015961HU1
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 28.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human NADPH oxidase 4(NOX4),partial expressed in E.coli

Rat NADPH oxidase 4 (Nox4)

1-CSB-EP015961RA
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 38.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat NADPH oxidase 4(Nox4),partial expressed in E.coli

NOX4 ORF Vector (Human) (pORF)

ORF007167 1.0 ug DNA
EUR 95

Nox4 ORF Vector (Rat) (pORF)

ORF071426 1.0 ug DNA
EUR 506

Nox4 ORF Vector (Mouse) (pORF)

ORF051547 1.0 ug DNA
EUR 506

Recombinant NADPH Oxidase 4 (NOX4)

4-RPB924Mu02
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): Inquire
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Recombinant NADPH Oxidase 4 (NOX4) expressed in: E.coli

pECMV-Nox4-m-FLAG Plasmid

PVT15132 2 ug
EUR 325

NOX4 ELISA Kit (Human) (OKAN06649)

OKAN06649 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the NOX-family of enzymes that functions as the catalytic subunit the NADPH oxidase complex. The encoded protein is localized to non-phagocytic cells where it acts as an oxygen sensor and catalyzes the reduction of molecular oxygen to various reactive oxygen species (ROS). The ROS generated by this protein have been implicated in numerous biological functions including signal transduction, cell differentiation and tumor cell growth. A pseudogene has been identified on the other arm of chromosome 11. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.057 ng/mL

NOX4 ELISA Kit (Mouse) (OKCD02767)

OKCD02767 96 Wells
EUR 818
Description: Description of target: Constitutive NADPH oxidase which generates superoxide intracellularly upon formation of a complex with CYBA/p22phox. Regulates signaling cascades probably through phosphatases inhibition. May function as an oxygen sensor regulating the KCNK3/TASK-1 potassium channel and HIF1A activity. May regulate insulin signaling cascade. May play a role in apoptosis, bone resorption and lipolysaccharide-mediated activation of NFKB.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.058 ng/mL

NOX4 ELISA Kit (Human) (OKCD07801)

OKCD07801 96 Wells
EUR 936
Description: Description of target: Constitutive NADPH oxidase which generates superoxide intracellularly upon formation of a complex with CYBA/p22phox. Regulates signaling cascades probably through phosphatases inhibition. May function as an oxygen sensor regulating the KCNK3/TASK-1 potassium channel and HIF1A activity. May regulate insulin signaling cascade. May play a role in apoptosis, bone resorption and lipolysaccharide-mediated activation of NFKB. May produce superoxide in the nucleus and play a role in regulating gene expression upon cell stimulation. Isoform 3 is not functional. Isoform 4 displays an increased activity. Isoform 5 and isoform 6 display reduced activity.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.057ng/mL

NOX4 ELISA Kit (Rat) (OKCD07802)

OKCD07802 96 Wells
EUR 1001
Description: Description of target: enzyme involved in the production of reactive oxygen species in vascular smooth muscle cells.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.113ng/mL

NOX4 ELISA Kit (Human) (OKEH04476)

OKEH04476 96 Wells
EUR 662
Description: Description of target: This gene encodes a member of the NOX-family of enzymes that functions as the catalytic subunit the NADPH oxidase complex. The encoded protein is localized to non-phagocytic cells where it acts as an oxygen sensor and catalyzes the reduction of molecular oxygen to various reactive oxygen species (ROS). The ROS generated by this protein have been implicated in numerous biological functions including signal transduction, cell differentiation and tumor cell growth. A pseudogene has been identified on the other arm of chromosome 11. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Polyclonal Antibody (Human), APC-Cy7

4-PAB924Hu01-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOX4 (Asp220~Asp392)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4). This antibody is labeled with APC-Cy7.

Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Antibody

20-abx104608
  • EUR 300.00
  • EUR 133.00
  • EUR 787.00
  • EUR 411.00
  • EUR 258.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Antibody

20-abx173823
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Antibody

20-abx173824
  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.

Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Antibody

20-abx177805
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Antibody

20-abx177806
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Antibody

20-abx177807
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Antibody

20-abx177808
  • EUR 1247.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

NOX4 sgRNA CRISPR Lentivector set (Human)

K1443201 3 x 1.0 ug
EUR 339

Nox4 sgRNA CRISPR Lentivector set (Mouse)

K3877001 3 x 1.0 ug
EUR 339

Nox4 sgRNA CRISPR Lentivector set (Rat)

K6996501 3 x 1.0 ug
EUR 339

Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Antibody (Biotin)

20-abx272212
  • EUR 439.00
  • EUR 244.00
  • EUR 1261.00
  • EUR 606.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NOX4 Rabbit Polyclonal Antibody