NOX4 Rabbit Polyclonal Antibody

NOX4 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

NOX4 Polyclonal Antibody

ABP59498-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human NOX4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of NOX4 from Human, Mouse, Rat. This NOX4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NOX4 protein

NOX4 Polyclonal Antibody

ABP59498-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NOX4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of NOX4 from Human, Mouse, Rat. This NOX4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NOX4 protein

NOX4 Polyclonal Antibody

ES11921-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NOX4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NOX4 Polyclonal Antibody

ES11921-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NOX4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NOX4 Rabbit pAb

A11274-100ul 100 ul
EUR 308

NOX4 Rabbit pAb

A11274-200ul 200 ul
EUR 459

NOX4 Rabbit pAb

A11274-20ul 20 ul
EUR 183

NOX4 Rabbit pAb

A11274-50ul 50 ul
EUR 223

NOX4 Rabbit mAb

A3656-100ul 100 ul
EUR 410

NOX4 Rabbit mAb

A3656-200ul 200 ul
EUR 571

NOX4 Rabbit mAb

A3656-20ul 20 ul
EUR 221

NOX4 Rabbit mAb

A3656-50ul 50 ul
EUR 287

Anti-NOX4 Rabbit Monoclonal Antibody

M00403 100ug/vial
EUR 397
Description: Rabbit Monoclonal NOX4 Antibody. Validated in IP, IF, IHC, ICC, WB and tested in Human, Mouse, Rat.

Polyclonal NOX4 Antibody (N-Terminus)

APR08788G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NOX4 (N-Terminus). This antibody is tested and proven to work in the following applications:

NOX4 Polyclonal Antibody, HRP Conjugated

A63035 100 µg
EUR 570.55
Description: reagents widely cited

NOX4 Polyclonal Antibody, FITC Conjugated

A63036 100 µg
EUR 570.55
Description: Ask the seller for details

NOX4 Polyclonal Antibody, Biotin Conjugated

A63037 100 µg
EUR 570.55
Description: The best epigenetics products

Nox4 Polyclonal Antibody, Biotin Conjugated

A54536 100 µg
EUR 570.55
Description: reagents widely cited

Nox4 Polyclonal Antibody, FITC Conjugated

A54537 100 µg
EUR 570.55
Description: Ask the seller for details

Nox4 Polyclonal Antibody, HRP Conjugated

A54538 100 µg
EUR 570.55
Description: The best epigenetics products

Rabbit NOX4 ELISA Kit

ERTN0050 96Tests
EUR 521

NOX4 antibody

70R-18930 50 ul
EUR 435
Description: Rabbit polyclonal NOX4 antibody

NOX4 Antibody

32663-100ul 100ul
EUR 252

NOX4 Antibody

1-CSB-PA777165
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NOX4. Recognizes NOX4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

NOX4 Antibody

DF6924 200ul
EUR 304
Description: NOX4 Antibody detects endogenous levels of total NOX4.

NOX4 Antibody

1-CSB-PA015961GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NOX4. Recognizes NOX4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

NOX4 Antibody

1-CSB-PA015961LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NOX4. Recognizes NOX4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

Nox4 Antibody

1-CSB-PA015961LA01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Nox4. Recognizes Nox4 from Rat, Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

NOX4 Antibody

1-CSB-PA034129
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NOX4. Recognizes NOX4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

NOX4 antibody

70R-50972 100 ul
EUR 244
Description: Purified Polyclonal NOX4 antibody

NOX4 Antibody

ABD6924 100 ug
EUR 438

Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

DLR-NOX4-Hu-48T 48T
EUR 498
  • Should the Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

DLR-NOX4-Hu-96T 96T
EUR 647
  • Should the Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

DLR-NOX4-Mu-48T 48T
EUR 508
  • Should the Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

DLR-NOX4-Mu-96T 96T
EUR 661
  • Should the Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

DLR-NOX4-Ra-48T 48T
EUR 528
  • Should the Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

DLR-NOX4-Ra-96T 96T
EUR 690
  • Should the Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

RDR-NOX4-Hu-48Tests 48 Tests
EUR 522

Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

RDR-NOX4-Hu-96Tests 96 Tests
EUR 724

Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

RDR-NOX4-Mu-48Tests 48 Tests
EUR 534

Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

RDR-NOX4-Mu-96Tests 96 Tests
EUR 742

Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

RDR-NOX4-Ra-48Tests 48 Tests
EUR 558

Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

RDR-NOX4-Ra-96Tests 96 Tests
EUR 776

Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

RD-NOX4-Hu-48Tests 48 Tests
EUR 500

Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

RD-NOX4-Hu-96Tests 96 Tests
EUR 692

Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

RD-NOX4-Mu-48Tests 48 Tests
EUR 511

Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

RD-NOX4-Mu-96Tests 96 Tests
EUR 709

Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

RD-NOX4-Ra-48Tests 48 Tests
EUR 534

Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit

RD-NOX4-Ra-96Tests 96 Tests
EUR 742

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNUM1245-50 50uL
EUR 395
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245), 1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNUB1245-100 100uL
EUR 209
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245), Concentration: 0.2mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNUB1245-500 500uL
EUR 458
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245), Concentration: 0.2mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC551245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF555 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC551245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF555 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC611245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF660R conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC611245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF660R conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC471245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF647 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC471245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF647 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC051245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF405M conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC051245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF405M conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC401245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF640R conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC401245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF640R conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC431245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF543 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC431245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF543 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC041245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF405S conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC041245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF405S conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC801245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF680 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC801245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF680 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNCP1245-250 250uL
EUR 383
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),PerCP conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNCR1245-250 250uL
EUR 383
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),RPE conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNCA1245-250 250uL
EUR 383
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),APC conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNCB1245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),Biotin conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNCB1245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),Biotin conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNCH1245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNCH1245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC881245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF488A conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC881245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF488A conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC941245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF594 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC941245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF594 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC681245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF568 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC681245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF568 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC701245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF770 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC701245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF770 conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNCAP1245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNCAP1245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC811245-100 100uL
EUR 199
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF680R conjugate, Concentration: 0.1mg/mL

NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody

BNC811245-500 500uL
EUR 544
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF680R conjugate, Concentration: 0.1mg/mL

Rabbit Anti-NOX4 monoclonal antibody, clone TZ1325

CABT-38500RH 100 ul
EUR 777

NOX4 Conjugated Antibody

C32663 100ul
EUR 397

anti- NOX4 antibody

FNab05806 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:2000
  • IP: 1:500-1:2000
  • IHC: 1:100-1:400
  • IF: 1:10-1:100
  • Immunogen: NADPH oxidase 4
  • Uniprot ID: Q9NPH5
  • Gene ID: 50507
  • Research Area: Metabolism
Description: Antibody raised against NOX4

Anti-NOX4 antibody

PAab05806 100 ug
EUR 386

Anti-NOX4 antibody

STJ24791 100 µl
EUR 277
Description: This gene encodes a member of the NOX-family of enzymes that functions as the catalytic subunit the NADPH oxidase complex. The encoded protein is localized to non-phagocytic cells where it acts as an oxygen sensor and catalyzes the reduction of molecular oxygen to various reactive oxygen species (ROS). The ROS generated by this protein have been implicated in numerous biological functions including signal transduction, cell differentiation and tumor cell growth. A pseudogene has been identified on the other arm of chromosome 11. Alternative splicing results in multiple transcript variants.

Anti-NOX4 antibody

STJ113053 100 µl
EUR 277
Description: This gene encodes a member of the NOX-family of enzymes that functions as the catalytic subunit the NADPH oxidase complex. The encoded protein is localized to non-phagocytic cells where it acts as an oxygen sensor and catalyzes the reduction of molecular oxygen to various reactive oxygen species (ROS). The ROS generated by this protein have been implicated in numerous biological functions including signal transduction, cell differentiation and tumor cell growth. A pseudogene has been identified on the other arm of chromosome 11. Alternative splicing results in multiple transcript variants.

Anti-NOX4 antibody

STJ193079 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NOX4

Nox4/ Rat Nox4 ELISA Kit

ELI-04894r 96 Tests
EUR 886

NOX4 siRNA

20-abx903611
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NOX4 siRNA

20-abx926191
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NOX4 siRNA

20-abx926192
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NOX4 Antibody, HRP conjugated

1-CSB-PA015961LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NOX4. Recognizes NOX4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

Nox4 Antibody, HRP conjugated

1-CSB-PA015961LB01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Nox4. Recognizes Nox4 from Rat. This antibody is HRP conjugated. Tested in the following application: ELISA

NOX4 Antibody, FITC conjugated

1-CSB-PA015961LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NOX4. Recognizes NOX4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

Nox4 Antibody, FITC conjugated

1-CSB-PA015961LC01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Nox4. Recognizes Nox4 from Rat. This antibody is FITC conjugated. Tested in the following application: ELISA

NOX4 Antibody, Biotin conjugated

1-CSB-PA015961LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NOX4. Recognizes NOX4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Nox4 Antibody, Biotin conjugated

1-CSB-PA015961LD01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Nox4. Recognizes Nox4 from Rat. This antibody is Biotin conjugated. Tested in the following application: ELISA

NOX4 recombinant monoclonal antibody

A5258 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human NOX4 for WB, IHC, IF,ELISA

Rabbit NADPH Oxidase 4 (NOX4) ELISA Kit

abx363460-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

NADPH oxidase 4/NOX4 Antibody

48782-100ul 100ul
EUR 333

NADPH oxidase 4/NOX4 Antibody

48782-50ul 50ul
EUR 239

NADPH Oxidase 4 (NOX4) Antibody

20-abx008166
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody

abx027743-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody

abx027743-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody

abx016156-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody

20-abx214042
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody

abx216479-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody

abx224134-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody

20-abx110460
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody

20-abx114020
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody

abx125425-50ul 50 ul
EUR 411
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody

20-abx126267
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody

abx146310-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody

20-abx241251
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Monoclonal NOX4 Antibody, Clone: 3H2C4

APR08785G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human NOX4. The antibodies are raised in Mouse and are from clone 3H2C4. This antibody is applicable in WB and IHC, FC, ICC, E

Monoclonal NOX4 Antibody, Clone: 3H2G11

APR08786G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human NOX4. The antibodies are raised in Mouse and are from clone 3H2G11. This antibody is applicable in WB and IHC, FC, ICC, E

NADPH Oxidase 4 (NOX4) Antibody

abx235806-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

NADPH Oxidase 4 (NOX4) Antibody

20-abx301944
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody

20-abx001813
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

NOX4 Blocking Peptide

DF6924-BP 1mg
EUR 195

NOX4 Blocking Peptide

20-abx063847
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

NOX4 cloning plasmid

CSB-CL015961HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1737
  • Sequence: atggctgtgtcctggaggagctggctcgccaacgaaggggttaaacacctctgcctgttcatctggctctccatgaatgtcctgcttttctggaaaaccttcttgctgtataaccaagggccagagtatcactacctccaccagatgttggggctaggattgtgtctaagcagag
  • Show more
Description: A cloning plasmid for the NOX4 gene.

Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Polyclonal Antibody (Human)

4-PAB924Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOX4 (Asp220~Asp392)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4)

Anti-NADPH oxidase 4/NOX4 Antibody

A00403 100ug/vial
EUR 334

NADPH Oxidase 4 (NOX4) Antibody (Biotin)

20-abx106181
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody (FITC)

20-abx107595
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody (HRP)

20-abx109013
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NADPH oxidase 4/NOX4 Conjugated Antibody

C48782 100ul
EUR 397

NADPH Oxidase 4 (NOX4) Antibody (HRP)

20-abx304654
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody (FITC)

20-abx304655
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NADPH Oxidase 4 (NOX4) Antibody (Biotin)

20-abx304656
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-NADPH oxidase 4/NOX4 Antibody

PA1929 100ug/vial
EUR 334

Human NOX4 ELISA Kit

ELA-E1488h 96 Tests
EUR 824

Human NOX4 ELISA Kit

EHN0050 96Tests
EUR 521

Bovine NOX4 ELISA Kit

EBN0050 96Tests
EUR 521

Anserini NOX4 ELISA Kit

EAN0050 96Tests
EUR 521

Chicken NOX4 ELISA Kit

ECKN0050 96Tests
EUR 521

Canine NOX4 ELISA Kit

ECN0050 96Tests
EUR 521

Goat NOX4 ELISA Kit

EGTN0050 96Tests
EUR 521

NOX4 ELISA KIT|Human

EF005809 96 Tests
EUR 689

Mouse NOX4 shRNA Plasmid

20-abx974073
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat NOX4 shRNA Plasmid

20-abx987026
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NOX4 shRNA Plasmid

20-abx959377
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Porcine NOX4 ELISA Kit

EPN0050 96Tests
EUR 521

Sheep NOX4 ELISA Kit

ESN0050 96Tests
EUR 521

Rat NOX4 ELISA Kit

ERN0050 96Tests
EUR 521

Monkey NOX4 ELISA Kit

EMKN0050 96Tests
EUR 521

Mouse NOX4 ELISA Kit

EMN0050 96Tests
EUR 521

pCMV-SPORT6-NOX4 Plasmid

PVT16853 2 ug
EUR 325

NOX4 Recombinant Protein (Human)

RP021499 100 ug Ask for price

NOX4 Recombinant Protein (Mouse)

RP154637 100 ug Ask for price

NOX4 Recombinant Protein (Rat)

RP214274 100 ug Ask for price

Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Polyclonal Antibody (Human), APC

4-PAB924Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOX4 (Asp220~Asp392)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4). This antibody is labeled with APC.

Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Polyclonal Antibody (Human), Biotinylated

4-PAB924Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOX4 (Asp220~Asp392)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4). This antibody is labeled with Biotin.

Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Polyclonal Antibody (Human), Cy3

4-PAB924Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOX4 (Asp220~Asp392)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4). This antibody is labeled with Cy3.

Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Polyclonal Antibody (Human), FITC

4-PAB924Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOX4 (Asp220~Asp392)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4). This antibody is labeled with FITC.

Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Polyclonal Antibody (Human), HRP

4-PAB924Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOX4 (Asp220~Asp392)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4). This antibody is labeled with HRP.

Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Polyclonal Antibody (Human), PE

4-PAB924Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOX4 (Asp220~Asp392)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4). This antibody is labeled with PE.

Human NADPH oxidase 4 (NOX4)

1-CSB-EP015961HU1
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 28.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human NADPH oxidase 4(NOX4),partial expressed in E.coli

Rat NADPH oxidase 4 (Nox4)

1-CSB-EP015961RA
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 38.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat NADPH oxidase 4(Nox4),partial expressed in E.coli

Rat NADPH oxidase 4 (Nox4)

1-CSB-YP015961RA
  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 40.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat NADPH oxidase 4(Nox4),partial expressed in Yeast

Guinea Pig NOX4 ELISA Kit

EGN0050 96Tests
EUR 521

Nox4 ORF Vector (Rat) (pORF)

ORF071426 1.0 ug DNA
EUR 506

NOX4 ORF Vector (Human) (pORF)

ORF007167 1.0 ug DNA
EUR 95

Nox4 ORF Vector (Mouse) (pORF)

ORF051547 1.0 ug DNA
EUR 506

Recombinant NADPH Oxidase 4 (NOX4)

4-RPB924Mu02
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): Inquire
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Recombinant NADPH Oxidase 4 (NOX4) expressed in: E.coli

pECMV-Nox4-m-FLAG Plasmid

PVT15132 2 ug
EUR 325

NOX4 ELISA Kit (Human) (OKAN06649)

OKAN06649 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the NOX-family of enzymes that functions as the catalytic subunit the NADPH oxidase complex. The encoded protein is localized to non-phagocytic cells where it acts as an oxygen sensor and catalyzes the reduction of molecular oxygen to various reactive oxygen species (ROS). The ROS generated by this protein have been implicated in numerous biological functions including signal transduction, cell differentiation and tumor cell growth. A pseudogene has been identified on the other arm of chromosome 11. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.057 ng/mL

NOX4 ELISA Kit (Mouse) (OKCD02767)

OKCD02767 96 Wells
EUR 818
Description: Description of target: Constitutive NADPH oxidase which generates superoxide intracellularly upon formation of a complex with CYBA/p22phox. Regulates signaling cascades probably through phosphatases inhibition. May function as an oxygen sensor regulating the KCNK3/TASK-1 potassium channel and HIF1A activity. May regulate insulin signaling cascade. May play a role in apoptosis, bone resorption and lipolysaccharide-mediated activation of NFKB.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.058 ng/mL

NOX4 ELISA Kit (Human) (OKCD07801)

OKCD07801 96 Wells
EUR 936
Description: Description of target: Constitutive NADPH oxidase which generates superoxide intracellularly upon formation of a complex with CYBA/p22phox. Regulates signaling cascades probably through phosphatases inhibition. May function as an oxygen sensor regulating the KCNK3/TASK-1 potassium channel and HIF1A activity. May regulate insulin signaling cascade. May play a role in apoptosis, bone resorption and lipolysaccharide-mediated activation of NFKB. May produce superoxide in the nucleus and play a role in regulating gene expression upon cell stimulation. Isoform 3 is not functional. Isoform 4 displays an increased activity. Isoform 5 and isoform 6 display reduced activity.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.057ng/mL

NOX4 ELISA Kit (Rat) (OKCD07802)

OKCD07802 96 Wells
EUR 1001
Description: Description of target: enzyme involved in the production of reactive oxygen species in vascular smooth muscle cells.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.113ng/mL

NOX4 ELISA Kit (Human) (OKEH04476)

OKEH04476 96 Wells
EUR 662
Description: Description of target: This gene encodes a member of the NOX-family of enzymes that functions as the catalytic subunit the NADPH oxidase complex. The encoded protein is localized to non-phagocytic cells where it acts as an oxygen sensor and catalyzes the reduction of molecular oxygen to various reactive oxygen species (ROS). The ROS generated by this protein have been implicated in numerous biological functions including signal transduction, cell differentiation and tumor cell growth. A pseudogene has been identified on the other arm of chromosome 11. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Polyclonal Antibody (Human), APC-Cy7

4-PAB924Hu01-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NOX4 (Asp220~Asp392)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4). This antibody is labeled with APC-Cy7.

Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Antibody

20-abx177805
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Antibody

20-abx177806
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Antibody

20-abx177807
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Antibody

20-abx177808
  • EUR 1247.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Antibody

20-abx104608
  • EUR 300.00
  • EUR 133.00
  • EUR 787.00
  • EUR 411.00
  • EUR 258.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Antibody

20-abx173823
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Antibody

20-abx173824
  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.

Nox4 sgRNA CRISPR Lentivector set (Rat)

K6996501 3 x 1.0 ug
EUR 339

Nox4 sgRNA CRISPR Lentivector set (Mouse)

K3877001 3 x 1.0 ug
EUR 339

NOX4 sgRNA CRISPR Lentivector set (Human)

K1443201 3 x 1.0 ug
EUR 339

Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Antibody (Biotin)

20-abx272212
  • EUR 439.00
  • EUR 244.00
  • EUR 1261.00
  • EUR 606.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

NOX4 Rabbit Polyclonal Antibody