NOX4 Rabbit Polyclonal Antibody
To Order Now: info@poweratlas.org
NOX4 Polyclonal Antibody |
ABP59498-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human NOX4 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of NOX4 from Human, Mouse, Rat. This NOX4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NOX4 protein |
NOX4 Polyclonal Antibody |
ABP59498-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human NOX4 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of NOX4 from Human, Mouse, Rat. This NOX4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NOX4 protein |
Nox4 Polyclonal Antibody |
A54539 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
NOX4 Polyclonal Antibody |
A63034 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
NOX4 Rabbit pAb |
A11274-100ul |
Abclonal |
100 ul |
EUR 308 |
NOX4 Rabbit pAb |
A11274-200ul |
Abclonal |
200 ul |
EUR 459 |
NOX4 Rabbit pAb |
A11274-20ul |
Abclonal |
20 ul |
EUR 183 |
NOX4 Rabbit pAb |
A11274-50ul |
Abclonal |
50 ul |
EUR 223 |
NOX4 Rabbit mAb |
A3656-100ul |
Abclonal |
100 ul |
EUR 410 |
NOX4 Rabbit mAb |
A3656-200ul |
Abclonal |
200 ul |
EUR 571 |
NOX4 Rabbit mAb |
A3656-20ul |
Abclonal |
20 ul |
EUR 221 |
NOX4 Rabbit mAb |
A3656-50ul |
Abclonal |
50 ul |
EUR 287 |
Anti-NOX4 Rabbit Monoclonal Antibody |
M00403 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal NOX4 Antibody. Validated in IP, IF, IHC, ICC, WB and tested in Human, Mouse, Rat. |
Polyclonal NOX4 Antibody (N-Terminus) |
APR08788G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NOX4 (N-Terminus). This antibody is tested and proven to work in the following applications: |
Nox4 Polyclonal Antibody, Biotin Conjugated |
A54536 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
Nox4 Polyclonal Antibody, FITC Conjugated |
A54537 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
Nox4 Polyclonal Antibody, HRP Conjugated |
A54538 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
NOX4 Polyclonal Antibody, HRP Conjugated |
A63035 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
NOX4 Polyclonal Antibody, FITC Conjugated |
A63036 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
NOX4 Polyclonal Antibody, Biotin Conjugated |
A63037 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Rabbit NOX4 ELISA Kit |
ERTN0050 |
Abclonal |
96Tests |
EUR 521 |
NOX4 antibody |
70R-50972 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal NOX4 antibody |
NOX4 Antibody |
32663-100ul |
SAB |
100ul |
EUR 252 |
NOX4 antibody |
70R-18930 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal NOX4 antibody |
NOX4 Antibody |
DF6924 |
Affbiotech |
200ul |
EUR 304 |
Description: NOX4 Antibody detects endogenous levels of total NOX4. |
NOX4 Antibody |
1-CSB-PA777165 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against NOX4. Recognizes NOX4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100 |
NOX4 Antibody |
1-CSB-PA034129 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against NOX4. Recognizes NOX4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
NOX4 Antibody |
1-CSB-PA015961GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against NOX4. Recognizes NOX4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
NOX4 Antibody |
1-CSB-PA015961LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NOX4. Recognizes NOX4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
Nox4 Antibody |
1-CSB-PA015961LA01RA |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Nox4. Recognizes Nox4 from Rat, Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000 |
Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit |
DLR-NOX4-Hu-48T |
DL Develop |
48T |
EUR 498 |
- Should the Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit |
DLR-NOX4-Hu-96T |
DL Develop |
96T |
EUR 647 |
- Should the Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) in samples from tissue homogenates, cell lysates or other biological fluids. |
Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit |
DLR-NOX4-Mu-48T |
DL Develop |
48T |
EUR 508 |
- Should the Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) in samples from tissue homogenates, cell lysates or other biological fluids. |
Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit |
DLR-NOX4-Mu-96T |
DL Develop |
96T |
EUR 661 |
- Should the Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) in samples from tissue homogenates, cell lysates or other biological fluids. |
Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit |
DLR-NOX4-Ra-48T |
DL Develop |
48T |
EUR 528 |
- Should the Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) in samples from tissue homogenates, cell lysates or other biological fluids. |
Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit |
DLR-NOX4-Ra-96T |
DL Develop |
96T |
EUR 690 |
- Should the Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit |
RD-NOX4-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit |
RD-NOX4-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit |
RD-NOX4-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit |
RD-NOX4-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit |
RD-NOX4-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 534 |
Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit |
RD-NOX4-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 742 |
Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit |
RDR-NOX4-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522 |
Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit |
RDR-NOX4-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724 |
Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit |
RDR-NOX4-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 534 |
Mouse Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit |
RDR-NOX4-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 742 |
Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit |
RDR-NOX4-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 558 |
Rat Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) ELISA Kit |
RDR-NOX4-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 776 |
NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody |
BNC551245-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF555 conjugate, Concentration: 0.1mg/mL |
NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody |
BNC551245-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF555 conjugate, Concentration: 0.1mg/mL |
NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody |
BNC611245-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF660R conjugate, Concentration: 0.1mg/mL |
NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody |
BNC611245-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF660R conjugate, Concentration: 0.1mg/mL |
NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody |
BNC401245-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF640R conjugate, Concentration: 0.1mg/mL |
NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody |
BNC401245-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF640R conjugate, Concentration: 0.1mg/mL |
NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody |
BNC431245-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF543 conjugate, Concentration: 0.1mg/mL |
NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody |
BNC431245-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF543 conjugate, Concentration: 0.1mg/mL |
NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody |
BNC471245-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF647 conjugate, Concentration: 0.1mg/mL |
NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody |
BNC471245-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF647 conjugate, Concentration: 0.1mg/mL |
NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody |
BNC051245-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF405M conjugate, Concentration: 0.1mg/mL |
NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody |
BNC051245-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF405M conjugate, Concentration: 0.1mg/mL |
NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody |
BNC041245-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF405S conjugate, Concentration: 0.1mg/mL |
NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody |
BNC041245-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF405S conjugate, Concentration: 0.1mg/mL |
NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody |
BNUB1245-100 |
Biotium |
100uL |
EUR 209 |
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245), Concentration: 0.2mg/mL |
NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody |
BNUB1245-500 |
Biotium |
500uL |
EUR 458 |
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245), Concentration: 0.2mg/mL |
NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody |
BNUM1245-50 |
Biotium |
50uL |
EUR 395 |
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245), 1mg/mL |
NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody |
BNC681245-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF568 conjugate, Concentration: 0.1mg/mL |
NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody |
BNC681245-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF568 conjugate, Concentration: 0.1mg/mL |
NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody |
BNC701245-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF770 conjugate, Concentration: 0.1mg/mL |
NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody |
BNC701245-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF770 conjugate, Concentration: 0.1mg/mL |
NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody |
BNC881245-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF488A conjugate, Concentration: 0.1mg/mL |
NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody |
BNC881245-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF488A conjugate, Concentration: 0.1mg/mL |
NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody |
BNC941245-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF594 conjugate, Concentration: 0.1mg/mL |
NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody |
BNC941245-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF594 conjugate, Concentration: 0.1mg/mL |
NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody |
BNCB1245-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),Biotin conjugate, Concentration: 0.1mg/mL |
NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody |
BNCB1245-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),Biotin conjugate, Concentration: 0.1mg/mL |
NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody |
BNCH1245-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL |
NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody |
BNCH1245-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL |
NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody |
BNC801245-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF680 conjugate, Concentration: 0.1mg/mL |
NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody |
BNC801245-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF680 conjugate, Concentration: 0.1mg/mL |
NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody |
BNCP1245-250 |
Biotium |
250uL |
EUR 383 |
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),PerCP conjugate, Concentration: 0.1mg/mL |
NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody |
BNCR1245-250 |
Biotium |
250uL |
EUR 383 |
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),RPE conjugate, Concentration: 0.1mg/mL |
NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody |
BNCA1245-250 |
Biotium |
250uL |
EUR 383 |
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),APC conjugate, Concentration: 0.1mg/mL |
NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody |
BNCAP1245-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL |
NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody |
BNCAP1245-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL |
NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody |
BNC811245-100 |
Biotium |
100uL |
EUR 199 |
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF680R conjugate, Concentration: 0.1mg/mL |
NOX4 / NADPH Oxidase 4 (NOX4/1245) Antibody |
BNC811245-500 |
Biotium |
500uL |
EUR 544 |
Description: Primary antibody against NOX4 / NADPH Oxidase 4 (NOX4/1245),CF680R conjugate, Concentration: 0.1mg/mL |
NOX4 Conjugated Antibody |
C32663 |
SAB |
100ul |
EUR 397 |
anti- NOX4 antibody |
FNab05806 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:200-1:2000
- IP: 1:500-1:2000
- IHC: 1:100-1:400
- IF: 1:10-1:100
- Immunogen: NADPH oxidase 4
- Uniprot ID: Q9NPH5
- Gene ID: 50507
- Research Area: Metabolism
|
Description: Antibody raised against NOX4 |
Anti-NOX4 antibody |
STJ24791 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the NOX-family of enzymes that functions as the catalytic subunit the NADPH oxidase complex. The encoded protein is localized to non-phagocytic cells where it acts as an oxygen sensor and catalyzes the reduction of molecular oxygen to various reactive oxygen species (ROS). The ROS generated by this protein have been implicated in numerous biological functions including signal transduction, cell differentiation and tumor cell growth. A pseudogene has been identified on the other arm of chromosome 11. Alternative splicing results in multiple transcript variants. |
Anti-NOX4 antibody |
STJ113053 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the NOX-family of enzymes that functions as the catalytic subunit the NADPH oxidase complex. The encoded protein is localized to non-phagocytic cells where it acts as an oxygen sensor and catalyzes the reduction of molecular oxygen to various reactive oxygen species (ROS). The ROS generated by this protein have been implicated in numerous biological functions including signal transduction, cell differentiation and tumor cell growth. A pseudogene has been identified on the other arm of chromosome 11. Alternative splicing results in multiple transcript variants. |
Anti-NOX4 antibody |
STJ193079 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to NOX4 |
NOX4 siRNA |
20-abx903611 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NOX4 siRNA |
20-abx926191 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NOX4 siRNA |
20-abx926192 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NOX4 recombinant monoclonal antibody |
A5258 |
Bimake |
100ul X 3 |
EUR 595 |
- Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
- Show more
|
Description: A recombinant monoclonal antibody from rabbit against human NOX4 for WB, IHC, IF,ELISA |
NOX4 Antibody, HRP conjugated |
1-CSB-PA015961LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NOX4. Recognizes NOX4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
Nox4 Antibody, HRP conjugated |
1-CSB-PA015961LB01RA |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Nox4. Recognizes Nox4 from Rat. This antibody is HRP conjugated. Tested in the following application: ELISA |
NOX4 Antibody, FITC conjugated |
1-CSB-PA015961LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NOX4. Recognizes NOX4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
Nox4 Antibody, FITC conjugated |
1-CSB-PA015961LC01RA |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Nox4. Recognizes Nox4 from Rat. This antibody is FITC conjugated. Tested in the following application: ELISA |
NOX4 Antibody, Biotin conjugated |
1-CSB-PA015961LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NOX4. Recognizes NOX4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Nox4 Antibody, Biotin conjugated |
1-CSB-PA015961LD01RA |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Nox4. Recognizes Nox4 from Rat. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Rabbit NADPH Oxidase 4 (NOX4) ELISA Kit |
abx363460-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Monoclonal NOX4 Antibody, Clone: 3H2C4 |
APR08785G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A Monoclonal antibody against Human NOX4. The antibodies are raised in Mouse and are from clone 3H2C4. This antibody is applicable in WB and IHC, FC, ICC, E |
Monoclonal NOX4 Antibody, Clone: 3H2G11 |
APR08786G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A Monoclonal antibody against Human NOX4. The antibodies are raised in Mouse and are from clone 3H2G11. This antibody is applicable in WB and IHC, FC, ICC, E |
NADPH Oxidase 4 (NOX4) Antibody |
abx125425-50ul |
Abbexa |
50 ul |
EUR 411 |
- Shipped within 5-10 working days.
|
NADPH Oxidase 4 (NOX4) Antibody |
20-abx126267 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
NADPH Oxidase 4 (NOX4) Antibody |
20-abx114020 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NADPH Oxidase 4 (NOX4) Antibody |
20-abx110460 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
NADPH Oxidase 4 (NOX4) Antibody |
20-abx001813 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
NADPH Oxidase 4 (NOX4) Antibody |
abx146310-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
NADPH Oxidase 4 (NOX4) Antibody |
20-abx008166 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
NADPH Oxidase 4 (NOX4) Antibody |
abx027743-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
NADPH Oxidase 4 (NOX4) Antibody |
abx027743-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
NADPH Oxidase 4 (NOX4) Antibody |
abx016156-100ug |
Abbexa |
100 ug |
EUR 411 |
- Shipped within 5-10 working days.
|
NADPH Oxidase 4 (NOX4) Antibody |
20-abx214042 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NADPH Oxidase 4 (NOX4) Antibody |
abx216479-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
NADPH Oxidase 4 (NOX4) Antibody |
abx224134-100ug |
Abbexa |
100 ug |
EUR 411 |
- Shipped within 5-10 working days.
|
NADPH Oxidase 4 (NOX4) Antibody |
20-abx241251 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NADPH Oxidase 4 (NOX4) Antibody |
abx235806-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
NADPH Oxidase 4 (NOX4) Antibody |
20-abx301944 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
NADPH oxidase 4/NOX4 Antibody |
48782-100ul |
SAB |
100ul |
EUR 333 |
NADPH oxidase 4/NOX4 Antibody |
48782-50ul |
SAB |
50ul |
EUR 239 |
NOX4 cloning plasmid |
CSB-CL015961HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1737
- Sequence: atggctgtgtcctggaggagctggctcgccaacgaaggggttaaacacctctgcctgttcatctggctctccatgaatgtcctgcttttctggaaaaccttcttgctgtataaccaagggccagagtatcactacctccaccagatgttggggctaggattgtgtctaagcagag
- Show more
|
Description: A cloning plasmid for the NOX4 gene. |
NOX4 Blocking Peptide |
20-abx063847 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NOX4 Blocking Peptide |
DF6924-BP |
Affbiotech |
1mg |
EUR 195 |
Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Polyclonal Antibody (Human) |
4-PAB924Hu01 |
Cloud-Clone |
-
EUR 239.00
-
EUR 2391.00
-
EUR 598.00
-
EUR 299.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NOX4 (Asp220~Asp392)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) |
NADPH oxidase 4/NOX4 Conjugated Antibody |
C48782 |
SAB |
100ul |
EUR 397 |
NADPH Oxidase 4 (NOX4) Antibody (HRP) |
20-abx109013 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
NADPH Oxidase 4 (NOX4) Antibody (Biotin) |
20-abx106181 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
NADPH Oxidase 4 (NOX4) Antibody (FITC) |
20-abx107595 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
NADPH Oxidase 4 (NOX4) Antibody (HRP) |
20-abx304654 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
NADPH Oxidase 4 (NOX4) Antibody (FITC) |
20-abx304655 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
NADPH Oxidase 4 (NOX4) Antibody (Biotin) |
20-abx304656 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-NADPH oxidase 4/NOX4 Antibody |
A00403 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-NADPH oxidase 4/NOX4 Antibody |
PA1929 |
BosterBio |
100ug/vial |
EUR 334 |
Mouse NOX4 shRNA Plasmid |
20-abx974073 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat NOX4 shRNA Plasmid |
20-abx987026 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human NOX4 ELISA Kit |
EHN0050 |
Abclonal |
96Tests |
EUR 521 |
Goat NOX4 ELISA Kit |
EGTN0050 |
Abclonal |
96Tests |
EUR 521 |
Bovine NOX4 ELISA Kit |
EBN0050 |
Abclonal |
96Tests |
EUR 521 |
Chicken NOX4 ELISA Kit |
ECKN0050 |
Abclonal |
96Tests |
EUR 521 |
Canine NOX4 ELISA Kit |
ECN0050 |
Abclonal |
96Tests |
EUR 521 |
Anserini NOX4 ELISA Kit |
EAN0050 |
Abclonal |
96Tests |
EUR 521 |
Porcine NOX4 ELISA Kit |
EPN0050 |
Abclonal |
96Tests |
EUR 521 |
Rat NOX4 ELISA Kit |
ERN0050 |
Abclonal |
96Tests |
EUR 521 |
Sheep NOX4 ELISA Kit |
ESN0050 |
Abclonal |
96Tests |
EUR 521 |
Monkey NOX4 ELISA Kit |
EMKN0050 |
Abclonal |
96Tests |
EUR 521 |
Mouse NOX4 ELISA Kit |
EMN0050 |
Abclonal |
96Tests |
EUR 521 |
Human NOX4 shRNA Plasmid |
20-abx959377 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
NOX4 Recombinant Protein (Human) |
RP021499 |
ABM |
100 ug |
Ask for price |
NOX4 Recombinant Protein (Rat) |
RP214274 |
ABM |
100 ug |
Ask for price |
NOX4 Recombinant Protein (Mouse) |
RP154637 |
ABM |
100 ug |
Ask for price |
Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Polyclonal Antibody (Human), APC |
4-PAB924Hu01-APC |
Cloud-Clone |
-
EUR 333.00
-
EUR 3113.00
-
EUR 872.00
-
EUR 423.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NOX4 (Asp220~Asp392)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4). This antibody is labeled with APC. |
Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Polyclonal Antibody (Human), Biotinylated |
4-PAB924Hu01-Biotin |
Cloud-Clone |
-
EUR 303.00
-
EUR 2341.00
-
EUR 697.00
-
EUR 369.00
-
EUR 216.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NOX4 (Asp220~Asp392)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4). This antibody is labeled with Biotin. |
Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Polyclonal Antibody (Human), Cy3 |
4-PAB924Hu01-Cy3 |
Cloud-Clone |
-
EUR 403.00
-
EUR 4109.00
-
EUR 1121.00
-
EUR 523.00
-
EUR 245.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NOX4 (Asp220~Asp392)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4). This antibody is labeled with Cy3. |
Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Polyclonal Antibody (Human), FITC |
4-PAB924Hu01-FITC |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NOX4 (Asp220~Asp392)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4). This antibody is labeled with FITC. |
Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Polyclonal Antibody (Human), HRP |
4-PAB924Hu01-HRP |
Cloud-Clone |
-
EUR 305.00
-
EUR 2714.00
-
EUR 772.00
-
EUR 383.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NOX4 (Asp220~Asp392)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4). This antibody is labeled with HRP. |
Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Polyclonal Antibody (Human), PE |
4-PAB924Hu01-PE |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NOX4 (Asp220~Asp392)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4). This antibody is labeled with PE. |
Guinea Pig NOX4 ELISA Kit |
EGN0050 |
Abclonal |
96Tests |
EUR 521 |
Rat NADPH oxidase 4 (Nox4) |
1-CSB-YP015961RA |
Cusabio |
-
EUR 504.00
-
EUR 265.00
-
EUR 1832.00
-
EUR 763.00
-
EUR 1216.00
-
EUR 334.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 40.6 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Rat NADPH oxidase 4(Nox4),partial expressed in Yeast |
Human NADPH oxidase 4 (NOX4) |
1-CSB-EP015961HU1 |
Cusabio |
-
EUR 505.00
-
EUR 265.00
-
EUR 1827.00
-
EUR 766.00
-
EUR 1218.00
-
EUR 335.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 28.8 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human NADPH oxidase 4(NOX4),partial expressed in E.coli |
Rat NADPH oxidase 4 (Nox4) |
1-CSB-EP015961RA |
Cusabio |
-
EUR 611.00
-
EUR 309.00
-
EUR 1827.00
-
EUR 939.00
-
EUR 1218.00
-
EUR 397.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 38.6 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Rat NADPH oxidase 4(Nox4),partial expressed in E.coli |
NOX4 ORF Vector (Human) (pORF) |
ORF007167 |
ABM |
1.0 ug DNA |
EUR 95 |
Nox4 ORF Vector (Rat) (pORF) |
ORF071426 |
ABM |
1.0 ug DNA |
EUR 506 |
Nox4 ORF Vector (Mouse) (pORF) |
ORF051547 |
ABM |
1.0 ug DNA |
EUR 506 |
Recombinant NADPH Oxidase 4 (NOX4) |
4-RPB924Mu02 |
Cloud-Clone |
-
EUR 413.60
-
EUR 214.00
-
EUR 1276.00
-
EUR 492.00
-
EUR 884.00
-
EUR 340.00
-
EUR 3040.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Inquire
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): Inquire
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Recombinant NADPH Oxidase 4 (NOX4) expressed in: E.coli |
NOX4 ELISA Kit (Human) (OKAN06649) |
OKAN06649 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene encodes a member of the NOX-family of enzymes that functions as the catalytic subunit the NADPH oxidase complex. The encoded protein is localized to non-phagocytic cells where it acts as an oxygen sensor and catalyzes the reduction of molecular oxygen to various reactive oxygen species (ROS). The ROS generated by this protein have been implicated in numerous biological functions including signal transduction, cell differentiation and tumor cell growth. A pseudogene has been identified on the other arm of chromosome 11. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.057 ng/mL |
NOX4 ELISA Kit (Mouse) (OKCD02767) |
OKCD02767 |
Aviva Systems Biology |
96 Wells |
EUR 818 |
Description: Description of target: Constitutive NADPH oxidase which generates superoxide intracellularly upon formation of a complex with CYBA/p22phox. Regulates signaling cascades probably through phosphatases inhibition. May function as an oxygen sensor regulating the KCNK3/TASK-1 potassium channel and HIF1A activity. May regulate insulin signaling cascade. May play a role in apoptosis, bone resorption and lipolysaccharide-mediated activation of NFKB.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.058 ng/mL |
NOX4 ELISA Kit (Human) (OKCD07801) |
OKCD07801 |
Aviva Systems Biology |
96 Wells |
EUR 936 |
Description: Description of target: Constitutive NADPH oxidase which generates superoxide intracellularly upon formation of a complex with CYBA/p22phox. Regulates signaling cascades probably through phosphatases inhibition. May function as an oxygen sensor regulating the KCNK3/TASK-1 potassium channel and HIF1A activity. May regulate insulin signaling cascade. May play a role in apoptosis, bone resorption and lipolysaccharide-mediated activation of NFKB. May produce superoxide in the nucleus and play a role in regulating gene expression upon cell stimulation. Isoform 3 is not functional. Isoform 4 displays an increased activity. Isoform 5 and isoform 6 display reduced activity.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.057ng/mL |
NOX4 ELISA Kit (Rat) (OKCD07802) |
OKCD07802 |
Aviva Systems Biology |
96 Wells |
EUR 1001 |
Description: Description of target: enzyme involved in the production of reactive oxygen species in vascular smooth muscle cells.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.113ng/mL |
NOX4 ELISA Kit (Human) (OKEH04476) |
OKEH04476 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: This gene encodes a member of the NOX-family of enzymes that functions as the catalytic subunit the NADPH oxidase complex. The encoded protein is localized to non-phagocytic cells where it acts as an oxygen sensor and catalyzes the reduction of molecular oxygen to various reactive oxygen species (ROS). The ROS generated by this protein have been implicated in numerous biological functions including signal transduction, cell differentiation and tumor cell growth. A pseudogene has been identified on the other arm of chromosome 11. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL |
Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Polyclonal Antibody (Human), APC-Cy7 |
4-PAB924Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 547.00
-
EUR 6106.00
-
EUR 1624.00
-
EUR 727.00
-
EUR 310.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NOX4 (Asp220~Asp392)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4). This antibody is labeled with APC-Cy7. |
Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Antibody |
20-abx104608 |
Abbexa |
-
EUR 300.00
-
EUR 133.00
-
EUR 787.00
-
EUR 411.00
-
EUR 258.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Antibody |
20-abx173823 |
Abbexa |
|
|
|
Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Antibody |
20-abx173824 |
Abbexa |
|
|
|
Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Antibody |
20-abx177805 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1149.00
-
EUR 565.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Antibody |
20-abx177806 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1177.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Antibody |
20-abx177807 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1177.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Antibody |
20-abx177808 |
Abbexa |
|
|
|
NOX4 sgRNA CRISPR Lentivector set (Human) |
K1443201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nox4 sgRNA CRISPR Lentivector set (Mouse) |
K3877001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nox4 sgRNA CRISPR Lentivector set (Rat) |
K6996501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nicotinamide Adenine Dinucleotide Phosphate Oxidase 4 (NOX4) Antibody (Biotin) |
20-abx272212 |
Abbexa |
-
EUR 439.00
-
EUR 244.00
-
EUR 1261.00
-
EUR 606.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NOX4 Rabbit Polyclonal Antibody