ESM1 Rabbit Polyclonal Antibody

ESM1 Rabbit Polyclonal Antibody

To Order Now:

ESM1 Polyclonal Antibody
ES11806-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ESM1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
ESM1 Polyclonal Antibody
ABP58504-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human ESM1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ESM1 from Human. This ESM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ESM1 protein
ESM1 Polyclonal Antibody
ABP58504-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ESM1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ESM1 from Human. This ESM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ESM1 protein
ESM1 Polyclonal Antibody
ABP58504-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ESM1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ESM1 from Human. This ESM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ESM1 protein
ESM1 Polyclonal Antibody
A58962 100 µg
EUR 570.55
Description: fast delivery possible
Human Endothelial Cell Specific Molecule 1 (ESM1) ELISA Kit
DLR-ESM1-Hu-48T 48T
EUR 517
  • Should the Human Endothelial Cell Specific Molecule 1 (ESM1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Endothelial Cell Specific Molecule 1 (ESM1) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.
Human Endothelial Cell Specific Molecule 1 (ESM1) ELISA Kit
DLR-ESM1-Hu-96T 96T
EUR 673
  • Should the Human Endothelial Cell Specific Molecule 1 (ESM1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Endothelial Cell Specific Molecule 1 (ESM1) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.
Human Endothelial Cell Specific Molecule 1 (ESM1) ELISA Kit
RD-ESM1-Hu-48Tests 48 Tests
EUR 521
Human Endothelial Cell Specific Molecule 1 (ESM1) ELISA Kit
RD-ESM1-Hu-96Tests 96 Tests
EUR 723
Human Endothelial Cell Specific Molecule 1 (ESM1) ELISA Kit
RDR-ESM1-Hu-48Tests 48 Tests
EUR 544
Human Endothelial Cell Specific Molecule 1 (ESM1) ELISA Kit
RDR-ESM1-Hu-96Tests 96 Tests
EUR 756
ESM1 Polyclonal Antibody, Biotin Conjugated
A58963 100 µg
EUR 570.55
Description: reagents widely cited
ESM1 Polyclonal Antibody, FITC Conjugated
A58964 100 µg
EUR 570.55
Description: Ask the seller for details
ESM1 Polyclonal Antibody, HRP Conjugated
A58965 100 µg
EUR 570.55
Description: The best epigenetics products
ESM1 Antibody
47244-100ul 100ul
EUR 252
ESM1 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ESM1. Recognizes ESM1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
ESM1 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ESM1. Recognizes ESM1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500
ESM1 Conjugated Antibody
C47244 100ul
EUR 397
Anti-ESM1 Antibody
A04169-1 100ug/vial
EUR 294
Human ESM1 Antibody
33408-05111 150 ug
EUR 261
Anti-ESM1 antibody
STJ192964 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ESM1
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
YF-PA17423 50 ug
EUR 363
Description: Mouse polyclonal to ESM1
YF-PA17424 100 ul
EUR 403
Description: Rabbit polyclonal to ESM1
YF-PA17425 100 ug
EUR 403
Description: Rabbit polyclonal to ESM1
YF-PA25731 50 ul
EUR 334
Description: Mouse polyclonal to ESM1
ESM1 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ESM1. Recognizes ESM1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
ESM1 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ESM1. Recognizes ESM1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
ESM1 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ESM1. Recognizes ESM1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
ESM1 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ESM1. Recognizes ESM1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
ESM1 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ESM1. Recognizes ESM1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
ESM1 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ESM1. Recognizes ESM1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
ESM1 cloning plasmid
CSB-CL007825HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 555
  • Sequence: atgaagagcgtcttgctgctgaccacgctcctcgtgcctgcacacctggtggccgcctggagcaataattatgcggtggactgccctcaacactgtgacagcagtgagtgcaaaagcagcccgcgctgcgagaggacagtgctcgacgactgtggctgctgccgagtgtgcgctgc
  • Show more
Description: A cloning plasmid for the ESM1 gene.
Anti-ESM1 (6D4)
YF-MA11340 100 ug
EUR 363
Description: Mouse monoclonal to ESM1
Human ESM1 Antibody (Biotin Conjugate)
33408-05121 150 ug
EUR 369
Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Human)
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESM1 (Trp20~Arg184)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Specific Molecule 1 (ESM1)
Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse)
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESM1 (Ala22~Arg184)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1)
Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse)
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESM1 (Ala22~Arg184)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1)
Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Rat)
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESM1 (Ala22~Arg184)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Specific Molecule 1 (ESM1)
Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Human), APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESM1 (Trp20~Arg184)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with APC.
Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Human), Biotinylated
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESM1 (Trp20~Arg184)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with Biotin.
Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Human), Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESM1 (Trp20~Arg184)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with Cy3.
Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Human), FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESM1 (Trp20~Arg184)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with FITC.
Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Human), HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESM1 (Trp20~Arg184)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with HRP.
Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Human), PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESM1 (Trp20~Arg184)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with PE.
Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESM1 (Ala22~Arg184)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with APC.
Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), Biotinylated
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESM1 (Ala22~Arg184)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with Biotin.
Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESM1 (Ala22~Arg184)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with Cy3.
Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESM1 (Ala22~Arg184)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with FITC.
Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESM1 (Ala22~Arg184)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with HRP.
Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESM1 (Ala22~Arg184)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with PE.
Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESM1 (Ala22~Arg184)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with APC.
Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), Biotinylated
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESM1 (Ala22~Arg184)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with Biotin.
Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESM1 (Ala22~Arg184)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with Cy3.
Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESM1 (Ala22~Arg184)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with FITC.
Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESM1 (Ala22~Arg184)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with HRP.
Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESM1 (Ala22~Arg184)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with PE.
Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Rat), APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESM1 (Ala22~Arg184)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with APC.
Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Rat), Biotinylated
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESM1 (Ala22~Arg184)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with Biotin.
Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Rat), Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESM1 (Ala22~Arg184)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with Cy3.
Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Rat), FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESM1 (Ala22~Arg184)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with FITC.
Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Rat), HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESM1 (Ala22~Arg184)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with HRP.
Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Rat), PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESM1 (Ala22~Arg184)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with PE.
Human ESM1 AssayLite Antibody (FITC Conjugate)
33408-05141 150 ug
EUR 428
Human ESM1 AssayLite Antibody (RPE Conjugate)
33408-05151 150 ug
EUR 428
Human ESM1 AssayLite Antibody (APC Conjugate)
33408-05161 150 ug
EUR 428
Human ESM1 AssayLite Antibody (PerCP Conjugate)
33408-05171 150 ug
EUR 471
Mouse ESM1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat ESM1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human ESM1 ELISA Kit
ELA-E2112h 96 Tests
EUR 824
EF000099 96 Tests
EUR 689
Human ESM1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ESM1 protein (His tag)
30R-2928 100 ug
EUR 322
Description: Purified recombinant Human ESM1 protein (His tag)
ESM1 Recombinant Protein (Human)
RP010939 100 ug Ask for price
ESM1 Recombinant Protein (Rat)
RP199958 100 ug Ask for price
ESM1 Recombinant Protein (Mouse)
RP132248 100 ug Ask for price
Human ESM1 ELISA Kit
STJ150455 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of ESM1 in human serum, plasma and other biological fluids
Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Human), APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESM1 (Trp20~Arg184)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with APC-Cy7.
Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESM1 (Ala22~Arg184)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with APC-Cy7.
Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESM1 (Ala22~Arg184)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with APC-Cy7.
Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Rat), APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ESM1 (Ala22~Arg184)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with APC-Cy7.
Monoclonal ESM1 Antibody (monoclonal) (M02), Clone: 6D4
AMM03504G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human ESM1 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 6D4. This antibody is applicable in WB and IHC, E
Endothelial Cell Specific Molecule 1 (ESM1) Antibody
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Endothelial Cell Specific Molecule 1 (ESM1) Antibody
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Endothelial Cell Specific Molecule 1 (ESM1) Antibody
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Endothelial Cell Specific Molecule 1 (ESM1) Antibody
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Endothelial Cell Specific Molecule 1 (ESM1) Antibody
  • EUR 342.00
  • EUR 857.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-12 working days.
Endothelial Cell-Specific Molecule 1 (ESM1) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Endothelial Cell-Specific Molecule 1 (ESM1) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Human ESM1 AssayMax ELISA Kit
EE3520-1 96 Well Plate
EUR 477
ESM1 ORF Vector (Human) (pORF)
ORF003647 1.0 ug DNA
EUR 95
Esm1 ORF Vector (Rat) (pORF)
ORF066654 1.0 ug DNA
EUR 506
Human ESM1/Endocan ELISA Kit
LF-EK50900 1×96T
EUR 648
Mouse ESM1/Endocan ELISA Kit
LF-EK50901 1×96T
EUR 648
Esm1 ORF Vector (Mouse) (pORF)
ORF044084 1.0 ug DNA
EUR 506
ESM1 ELISA Kit (Human) (OKCD08140)
OKCD08140 96 Wells
EUR 975
Description: Description of target: Involved in angiogenesis; promotes angiogenic sprouting. May have potent implications in lung endothelial cell-leukocyte interactions.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 6.2pg/mL
ESM1 ELISA Kit (Rat) (OKCA02546)
OKCA02546 96 Wells
EUR 846
Description: Description of target: Involved in angiogenesis; promotes angiogenic sprouting. May have potent implications in lung endothelial cell-leukocyte interactions.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 0.156 ng/mL
ESM1 ELISA Kit (Rat) (OKEH06056)
OKEH06056 96 Wells
EUR 662
Description: Description of target: Involved in angiogenesis; promotes angiogenic sprouting. May have potent implications in lung endothelial cell-leukocyte interactions.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.71 pg/mL
ESM1 ELISA Kit (Mouse) (OKEH06959)
OKEH06959 96 Wells
EUR 662
Description: Description of target: Involved in angiogenesis; promotes angiogenic sprouting. May have potent implications in lung endothelial cell-leukocyte interactions.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 8.02 pg/mL
Endothelial Cell-Specific Molecule 1 (ESM1) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Endothelial Cell-Specific Molecule 1 (ESM1) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Endothelial Cell-Specific Molecule 1 (ESM1) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Endothelial Cell Specific Molecule 1 (ESM1) Antibody (Biotin)
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Endothelial Cell Specific Molecule 1 (ESM1) Antibody (Biotin)
  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Endothelial Cell-Specific Molecule 1 (ESM1) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Endothelial Cell-Specific Molecule 1 (ESM1) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Endothelial Cell-Specific Molecule 1 (ESM1) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
ELISA kit for Human ESM1/Endocan
EK5318 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human ESM1/Endocan in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for Mouse ESM1/Endocan
EK5319 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse ESM1/Endocan in samples from serum, plasma, tissue homogenates and other biological fluids.
Human ESM1/Endocan PicoKine ELISA Kit
EK0752 96 wells
EUR 425
Description: For quantitative detection of human ESM1 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).
Mouse ESM1/Endocan PicoKine ELISA Kit
EK0753 96 wells
EUR 425
Description: For quantitative detection of mouse ESM1 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).
Esm1 sgRNA CRISPR Lentivector set (Mouse)
K3500801 3 x 1.0 ug
EUR 339
ESM1 sgRNA CRISPR Lentivector set (Human)
K0696601 3 x 1.0 ug
EUR 339
Esm1 sgRNA CRISPR Lentivector set (Rat)
K6942301 3 x 1.0 ug
EUR 339
ESM1/Endocan ELISA Kit (Human) (OKBB00371)
OKBB00371 96 Wells
EUR 505
Description: Description of target: Endothelial cell-specific molecule 1, also known as Endocan, is a protein that in humans is encoded by the ESM1 gene. This gene encodes a secreted protein which is mainly expressed in the endothelial cells in human lung and kidney tissues. The expression of this gene is regulated by cytokines, suggesting that it may play a role in endothelium-dependent pathological disorders. The transcript contains multiple polyadenylation and mRNA instability signals. ESM1 has been described as a specific biomarker of tip cells during neoangiogenesis by independent teams. Its expression has been shown to be increase in presence of pro-angiogenic growth factors such as VEGF (vascular endothelial growth factor) or FGF-2 (fibroblast growth factor 2).;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL
ESM1/Endocan ELISA Kit (Mouse) (OKBB00372)
OKBB00372 96 Wells
EUR 505
Description: Description of target: Endothelial cell-specific molecule 1, also known as Endocan, is a protein that in humans is encoded by the ESM1 gene. This gene encodes a secreted protein which is mainly expressed in the endothelial cells in human lung and kidney tissues. The expression of this gene is regulated by cytokines, suggesting that it may play a role in endothelium-dependent pathological disorders. The transcript contains multiple polyadenylation and mRNA instability signals. ESM-1 has been described as a specific biomarker of tip cells during neoangiogenesis by independent teams. Its expression has been shown to be increase in presence of pro-angiogenic growth factors such as VEGF (vascular endothelial growth factor) or FGF-2 (fibroblast growth factor 2).;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL
Active Endothelial Cell Specific Molecule 1 (ESM1)
  • EUR 794.40
  • EUR 316.00
  • EUR 2704.00
  • EUR 968.00
  • EUR 1836.00
  • EUR 595.00
  • EUR 6610.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9NQ30
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.4kDa
  • Isoelectric Point: 6.7
Description: Recombinant Human Endothelial Cell Specific Molecule 1 expressed in: E.coli
Endothelial Cell-Specific Molecule 1 (ESM1) Protein
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
Esm1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3500802 1.0 ug DNA
EUR 154
Esm1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3500803 1.0 ug DNA
EUR 154
Esm1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3500804 1.0 ug DNA
EUR 154

ESM1 Rabbit Polyclonal Antibody