LIX1 Rabbit Polyclonal Antibody

LIX1 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

LIX1 Polyclonal Antibody

ABP59127-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human LIX1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of LIX1 from Human, Mouse. This LIX1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LIX1 protein

LIX1 Polyclonal Antibody

ABP59127-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human LIX1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of LIX1 from Human, Mouse. This LIX1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LIX1 protein

LIX1 Polyclonal Antibody

ABP59127-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human LIX1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of LIX1 from Human, Mouse. This LIX1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LIX1 protein

LIX1 Polyclonal Antibody

ES11804-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against LIX1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

LIX1 Polyclonal Antibody

ES11804-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against LIX1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

LIX1 Rabbit pAb

A12809-100ul 100 ul
EUR 308

LIX1 Rabbit pAb

A12809-200ul 200 ul
EUR 459

LIX1 Rabbit pAb

A12809-20ul 20 ul
EUR 183

LIX1 Rabbit pAb

A12809-50ul 50 ul
EUR 223

LIX1 Polyclonal Conjugated Antibody

C27790 100ul
EUR 397

LIX1 Antibody

1-CSB-PA822702LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LIX1. Recognizes LIX1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:10-1:100

LIX1 antibody

70R-3596 50 ug
EUR 467
Description: Rabbit polyclonal LIX1 antibody

LIX1 Polyclonal Antibody, Biotin Conjugated

A59639 100 µg
EUR 570.55
Description: The best epigenetics products

LIX1 Polyclonal Antibody, FITC Conjugated

A59640 100 µg
EUR 570.55
Description: kits suitable for this type of research

LIX1 Polyclonal Antibody, HRP Conjugated

A59641 100 µg
EUR 570.55
Description: fast delivery possible

Anti-LIX1 antibody

STJ114675 100 µl
EUR 277

Anti-LIX1 antibody

STJ192962 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to LIX1

LIX1 siRNA

20-abx922646
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LIX1 siRNA

20-abx922647
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-LIX1

YF-PA22607 50 ul
EUR 363
Description: Mouse polyclonal to LIX1

LIX1 Antibody, HRP conjugated

1-CSB-PA822702LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LIX1. Recognizes LIX1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LIX1 Antibody, FITC conjugated

1-CSB-PA822702LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LIX1. Recognizes LIX1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LIX1 Antibody, Biotin conjugated

1-CSB-PA822702LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LIX1. Recognizes LIX1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

LIX1 Blocking Peptide

33R-9181 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LIX1 antibody, catalog no. 70R-3596

LIX1 cloning plasmid

CSB-CL822702HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 849
  • Sequence: atggacataaccttggaatctctgagacacatcattgcccaagtcttgcctcacagagatccggctctagtcttcaaagacttgaacgttgtgtcaatgttacaggaattttgggaaagcaagcagcagcagaaggctgcattcccaagtgaaggtgtggtggtctatgagtcact
  • Show more
Description: A cloning plasmid for the LIX1 gene.

LIX1 ELISA KIT|Human

EF005212 96 Tests
EUR 689

Mouse LIX1 shRNA Plasmid

20-abx975718
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human LIX1 shRNA Plasmid

20-abx966057
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LIX1 Recombinant Protein (Human)

RP017857 100 ug Ask for price

LIX1 Recombinant Protein (Rat)

RP208283 100 ug Ask for price

LIX1 Recombinant Protein (Mouse)

RP147638 100 ug Ask for price

Protein Limb Expression 1 (LIX1) Antibody

abx025913-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Protein Limb Expression 1 (LIX1) Antibody

abx025913-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Protein Limb Expression 1 (LIX1) Antibody

abx146234-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Protein Limb Expression 1 (LIX1) Antibody

20-abx318393
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein Limb Expression 1 (LIX1) Antibody (HRP)

20-abx308975
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein Limb Expression 1 (LIX1) Antibody (FITC)

20-abx308976
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein Limb Expression 1 (LIX1) Antibody (Biotin)

20-abx308977
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant human LIX1-like protein

P1205 100ug Ask for price
  • Uniprot ID: Q8IVB5
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human LIX1-like protein

Lix1 ORF Vector (Rat) (pORF)

ORF069429 1.0 ug DNA
EUR 506

LIX1 ORF Vector (Human) (pORF)

ORF005953 1.0 ug DNA
EUR 95

Lix1 ORF Vector (Mouse) (pORF)

ORF049214 1.0 ug DNA
EUR 506

Lix1 sgRNA CRISPR Lentivector set (Mouse)

K4950401 3 x 1.0 ug
EUR 339

Lix1 sgRNA CRISPR Lentivector set (Rat)

K6580901 3 x 1.0 ug
EUR 339

LIX1 sgRNA CRISPR Lentivector set (Human)

K1219801 3 x 1.0 ug
EUR 339

Mouse LIX1- like protein, Lix1l ELISA KIT

ELI-21048m 96 Tests
EUR 865

Human LIX1- like protein, LIX1L ELISA KIT

ELI-31674h 96 Tests
EUR 824

Lix1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4950402 1.0 ug DNA
EUR 154

Lix1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4950403 1.0 ug DNA
EUR 154

Lix1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4950404 1.0 ug DNA
EUR 154

Lix1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6580902 1.0 ug DNA
EUR 154

Lix1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6580903 1.0 ug DNA
EUR 154

Lix1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6580904 1.0 ug DNA
EUR 154

LIX1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1219802 1.0 ug DNA
EUR 154

LIX1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1219803 1.0 ug DNA
EUR 154

LIX1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1219804 1.0 ug DNA
EUR 154

LIX1 Protein Vector (Human) (pPB-C-His)

PV023809 500 ng
EUR 329

LIX1 Protein Vector (Human) (pPB-N-His)

PV023810 500 ng
EUR 329

LIX1 Protein Vector (Human) (pPM-C-HA)

PV023811 500 ng
EUR 329

LIX1 Protein Vector (Human) (pPM-C-His)

PV023812 500 ng
EUR 329

LIX1 Protein Vector (Rat) (pPB-C-His)

PV277714 500 ng
EUR 603

LIX1 Protein Vector (Rat) (pPB-N-His)

PV277715 500 ng
EUR 603

LIX1 Protein Vector (Rat) (pPM-C-HA)

PV277716 500 ng
EUR 603

LIX1 Protein Vector (Rat) (pPM-C-His)

PV277717 500 ng
EUR 603

LIX1 Protein Vector (Mouse) (pPB-C-His)

PV196854 500 ng
EUR 603

LIX1 Protein Vector (Mouse) (pPB-N-His)

PV196855 500 ng
EUR 603

LIX1 Protein Vector (Mouse) (pPM-C-HA)

PV196856 500 ng
EUR 603

LIX1 Protein Vector (Mouse) (pPM-C-His)

PV196857 500 ng
EUR 603

Lix1 3'UTR Luciferase Stable Cell Line

TU111097 1.0 ml Ask for price

Lix1 3'UTR GFP Stable Cell Line

TU161097 1.0 ml Ask for price

Lix1 3'UTR Luciferase Stable Cell Line

TU207116 1.0 ml Ask for price

Lix1 3'UTR GFP Stable Cell Line

TU257116 1.0 ml Ask for price

LIX1 3'UTR GFP Stable Cell Line

TU062512 1.0 ml
EUR 1521

LIX1 3'UTR Luciferase Stable Cell Line

TU012512 1.0 ml
EUR 1521

Chicken Protein limb expression 1, LIX1 ELISA KIT

ELI-08625c 96 Tests
EUR 928

Human Protein Limb Expression 1 (LIX1) ELISA Kit

abx385101-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Protein Limb Expression 1 (Lix1) ELISA Kit

abx389765-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

LIX1 Rabbit Polyclonal Antibody