LIX1 Rabbit Polyclonal Antibody

LIX1 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

LIX1 Polyclonal Antibody

ABP59127-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human LIX1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of LIX1 from Human, Mouse. This LIX1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LIX1 protein

LIX1 Polyclonal Antibody

ABP59127-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human LIX1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of LIX1 from Human, Mouse. This LIX1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LIX1 protein

LIX1 Polyclonal Antibody

A59638 100 µg
EUR 570.55
Description: Ask the seller for details

LIX1 Polyclonal Antibody

27790-100ul 100ul
EUR 252

LIX1 Polyclonal Antibody

27790-50ul 50ul
EUR 187

LIX1 Rabbit pAb

A12809-100ul 100 ul
EUR 308

LIX1 Rabbit pAb

A12809-200ul 200 ul
EUR 459

LIX1 Rabbit pAb

A12809-20ul 20 ul
EUR 183

LIX1 Rabbit pAb

A12809-50ul 50 ul
EUR 223

LIX1 Polyclonal Conjugated Antibody

C27790 100ul
EUR 397

LIX1 antibody

70R-3596 50 ug
EUR 467
Description: Rabbit polyclonal LIX1 antibody

LIX1 Antibody

1-CSB-PA822702LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LIX1. Recognizes LIX1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:10-1:100

LIX1 Polyclonal Antibody, Biotin Conjugated

A59639 100 µg
EUR 570.55
Description: The best epigenetics products

LIX1 Polyclonal Antibody, FITC Conjugated

A59640 100 µg
EUR 570.55
Description: kits suitable for this type of research

LIX1 Polyclonal Antibody, HRP Conjugated

A59641 100 µg
EUR 570.55
Description: fast delivery possible

Anti-LIX1 antibody

STJ114675 100 µl
EUR 277

Anti-LIX1 antibody

STJ192962 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to LIX1

LIX1 siRNA

20-abx922646
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LIX1 siRNA

20-abx922647
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-LIX1

YF-PA22607 50 ul
EUR 363
Description: Mouse polyclonal to LIX1

LIX1 Antibody, HRP conjugated

1-CSB-PA822702LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LIX1. Recognizes LIX1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LIX1 Antibody, FITC conjugated

1-CSB-PA822702LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LIX1. Recognizes LIX1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LIX1 Antibody, Biotin conjugated

1-CSB-PA822702LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LIX1. Recognizes LIX1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

LIX1 Blocking Peptide

33R-9181 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LIX1 antibody, catalog no. 70R-3596

LIX1 cloning plasmid

CSB-CL822702HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 849
  • Sequence: atggacataaccttggaatctctgagacacatcattgcccaagtcttgcctcacagagatccggctctagtcttcaaagacttgaacgttgtgtcaatgttacaggaattttgggaaagcaagcagcagcagaaggctgcattcccaagtgaaggtgtggtggtctatgagtcact
  • Show more
Description: A cloning plasmid for the LIX1 gene.

Mouse LIX1 shRNA Plasmid

20-abx975718
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human LIX1 shRNA Plasmid

20-abx966057
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LIX1 ELISA KIT|Human

EF005212 96 Tests
EUR 689

LIX1 Recombinant Protein (Human)

RP017857 100 ug Ask for price

LIX1 Recombinant Protein (Rat)

RP208283 100 ug Ask for price

LIX1 Recombinant Protein (Mouse)

RP147638 100 ug Ask for price

Protein Limb Expression 1 (LIX1) Antibody

abx146234-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Protein Limb Expression 1 (LIX1) Antibody

abx025913-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Protein Limb Expression 1 (LIX1) Antibody

abx025913-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Protein Limb Expression 1 (LIX1) Antibody

20-abx318393
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein Limb Expression 1 (LIX1) Antibody (HRP)

20-abx308975
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein Limb Expression 1 (LIX1) Antibody (FITC)

20-abx308976
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein Limb Expression 1 (LIX1) Antibody (Biotin)

20-abx308977
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

LIX1 ORF Vector (Human) (pORF)

ORF005953 1.0 ug DNA
EUR 95

Recombinant human LIX1-like protein

P1205 100ug Ask for price
  • Uniprot ID: Q8IVB5
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human LIX1-like protein

Lix1 ORF Vector (Rat) (pORF)

ORF069429 1.0 ug DNA
EUR 506

Lix1 ORF Vector (Mouse) (pORF)

ORF049214 1.0 ug DNA
EUR 506

LIX1 sgRNA CRISPR Lentivector set (Human)

K1219801 3 x 1.0 ug
EUR 339

Lix1 sgRNA CRISPR Lentivector set (Mouse)

K4950401 3 x 1.0 ug
EUR 339

Lix1 sgRNA CRISPR Lentivector set (Rat)

K6580901 3 x 1.0 ug
EUR 339

Mouse LIX1- like protein, Lix1l ELISA KIT

ELI-21048m 96 Tests
EUR 865

Human LIX1- like protein, LIX1L ELISA KIT

ELI-31674h 96 Tests
EUR 824

LIX1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1219802 1.0 ug DNA
EUR 154

LIX1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1219803 1.0 ug DNA
EUR 154

LIX1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1219804 1.0 ug DNA
EUR 154

Lix1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4950402 1.0 ug DNA
EUR 154

Lix1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4950403 1.0 ug DNA
EUR 154

Lix1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4950404 1.0 ug DNA
EUR 154

Lix1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6580902 1.0 ug DNA
EUR 154

Lix1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6580903 1.0 ug DNA
EUR 154

Lix1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6580904 1.0 ug DNA
EUR 154

LIX1 Protein Vector (Human) (pPB-C-His)

PV023809 500 ng
EUR 329

LIX1 Protein Vector (Human) (pPB-N-His)

PV023810 500 ng
EUR 329

LIX1 Protein Vector (Human) (pPM-C-HA)

PV023811 500 ng
EUR 329

LIX1 Protein Vector (Human) (pPM-C-His)

PV023812 500 ng
EUR 329

LIX1 Protein Vector (Rat) (pPB-C-His)

PV277714 500 ng
EUR 603

LIX1 Protein Vector (Rat) (pPB-N-His)

PV277715 500 ng
EUR 603

LIX1 Protein Vector (Rat) (pPM-C-HA)

PV277716 500 ng
EUR 603

LIX1 Protein Vector (Rat) (pPM-C-His)

PV277717 500 ng
EUR 603

LIX1 Protein Vector (Mouse) (pPB-C-His)

PV196854 500 ng
EUR 603

LIX1 Protein Vector (Mouse) (pPB-N-His)

PV196855 500 ng
EUR 603

LIX1 Protein Vector (Mouse) (pPM-C-HA)

PV196856 500 ng
EUR 603

LIX1 Protein Vector (Mouse) (pPM-C-His)

PV196857 500 ng
EUR 603

Lix1 3'UTR Luciferase Stable Cell Line

TU207116 1.0 ml Ask for price

Lix1 3'UTR GFP Stable Cell Line

TU161097 1.0 ml Ask for price

LIX1 3'UTR Luciferase Stable Cell Line

TU012512 1.0 ml
EUR 1521

Lix1 3'UTR Luciferase Stable Cell Line

TU111097 1.0 ml Ask for price

LIX1 3'UTR GFP Stable Cell Line

TU062512 1.0 ml
EUR 1521

Lix1 3'UTR GFP Stable Cell Line

TU257116 1.0 ml Ask for price

Chicken Protein limb expression 1, LIX1 ELISA KIT

ELI-08625c 96 Tests
EUR 928

Human Protein Limb Expression 1 (LIX1) ELISA Kit

abx385101-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Protein Limb Expression 1 (Lix1) ELISA Kit

abx389765-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

LIX1 Rabbit Polyclonal Antibody