LIX1 Rabbit Polyclonal Antibody
To Order Now: info@poweratlas.org
 LIX1 Polyclonal Antibody |
|
ABP59127-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human LIX1 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of LIX1 from Human, Mouse. This LIX1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LIX1 protein |
LIX1 Polyclonal Antibody |
|
ABP59127-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human LIX1 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of LIX1 from Human, Mouse. This LIX1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LIX1 protein |
LIX1 Polyclonal Antibody |
|
A59638 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: Ask the seller for details |
LIX1 Polyclonal Antibody |
|
27790-100ul |
SAB |
100ul |
EUR 252 |
LIX1 Polyclonal Antibody |
|
27790-50ul |
SAB |
50ul |
EUR 187 |
 LIX1 Rabbit pAb |
|
A12809-100ul |
Abclonal |
100 ul |
EUR 308 |
LIX1 Rabbit pAb |
|
A12809-200ul |
Abclonal |
200 ul |
EUR 459 |
LIX1 Rabbit pAb |
|
A12809-20ul |
Abclonal |
20 ul |
EUR 183 |
LIX1 Rabbit pAb |
|
A12809-50ul |
Abclonal |
50 ul |
EUR 223 |
 LIX1 Polyclonal Conjugated Antibody |
|
C27790 |
SAB |
100ul |
EUR 397 |
 LIX1 antibody |
|
70R-3596 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal LIX1 antibody |
 LIX1 Antibody |
|
1-CSB-PA822702LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against LIX1. Recognizes LIX1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:10-1:100 |
 LIX1 Polyclonal Antibody, Biotin Conjugated |
|
A59639 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 LIX1 Polyclonal Antibody, FITC Conjugated |
|
A59640 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: kits suitable for this type of research |
 LIX1 Polyclonal Antibody, HRP Conjugated |
|
A59641 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: fast delivery possible |
 Anti-LIX1 antibody |
|
STJ192962 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to LIX1 |
 LIX1 siRNA |
|
20-abx922646 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LIX1 siRNA |
|
20-abx922647 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-LIX1 |
|
YF-PA22607 |
Abfrontier |
50 ul |
EUR 363 |
|
Description: Mouse polyclonal to LIX1 |
 LIX1 Antibody, HRP conjugated |
|
1-CSB-PA822702LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against LIX1. Recognizes LIX1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 LIX1 Antibody, FITC conjugated |
|
1-CSB-PA822702LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against LIX1. Recognizes LIX1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 LIX1 Antibody, Biotin conjugated |
|
1-CSB-PA822702LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against LIX1. Recognizes LIX1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 LIX1 Blocking Peptide |
|
33R-9181 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LIX1 antibody, catalog no. 70R-3596 |
 LIX1 cloning plasmid |
|
CSB-CL822702HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 849
- Sequence: atggacataaccttggaatctctgagacacatcattgcccaagtcttgcctcacagagatccggctctagtcttcaaagacttgaacgttgtgtcaatgttacaggaattttgggaaagcaagcagcagcagaaggctgcattcccaagtgaaggtgtggtggtctatgagtcact
- Show more
|
|
Description: A cloning plasmid for the LIX1 gene. |
 Mouse LIX1 shRNA Plasmid |
|
20-abx975718 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human LIX1 shRNA Plasmid |
|
20-abx966057 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) LIX1 Recombinant Protein (Human) |
|
RP017857 |
ABM |
100 ug |
Ask for price |
) LIX1 Recombinant Protein (Rat) |
|
RP208283 |
ABM |
100 ug |
Ask for price |
) LIX1 Recombinant Protein (Mouse) |
|
RP147638 |
ABM |
100 ug |
Ask for price |
 Antibody) Protein Limb Expression 1 (LIX1) Antibody |
|
abx146234-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Protein Limb Expression 1 (LIX1) Antibody |
|
abx025913-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Protein Limb Expression 1 (LIX1) Antibody |
|
abx025913-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Protein Limb Expression 1 (LIX1) Antibody |
|
20-abx318393 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (HRP)) Protein Limb Expression 1 (LIX1) Antibody (HRP) |
|
20-abx308975 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) Protein Limb Expression 1 (LIX1) Antibody (FITC) |
|
20-abx308976 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) Protein Limb Expression 1 (LIX1) Antibody (Biotin) |
|
20-abx308977 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 (pORF)) LIX1 ORF Vector (Human) (pORF) |
|
ORF005953 |
ABM |
1.0 ug DNA |
EUR 95 |
 Recombinant human
LIX1-like protein |
|
P1205 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: Q8IVB5
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
|
Description: Recombinant protein for human LIX1-like protein |
 (pORF)) Lix1 ORF Vector (Rat) (pORF) |
|
ORF069429 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Lix1 ORF Vector (Mouse) (pORF) |
|
ORF049214 |
ABM |
1.0 ug DNA |
EUR 506 |
) LIX1 sgRNA CRISPR Lentivector set (Human) |
|
K1219801 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Lix1 sgRNA CRISPR Lentivector set (Mouse) |
|
K4950401 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Lix1 sgRNA CRISPR Lentivector set (Rat) |
|
K6580901 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) LIX1 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1219802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) LIX1 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1219803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) LIX1 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1219804 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Lix1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4950402 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Lix1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4950403 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Lix1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4950404 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Lix1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6580902 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Lix1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6580903 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Lix1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6580904 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) LIX1 Protein Vector (Human) (pPB-C-His) |
|
PV023809 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) LIX1 Protein Vector (Human) (pPB-N-His) |
|
PV023810 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) LIX1 Protein Vector (Human) (pPM-C-HA) |
|
PV023811 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) LIX1 Protein Vector (Human) (pPM-C-His) |
|
PV023812 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) LIX1 Protein Vector (Rat) (pPB-C-His) |
|
PV277714 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) LIX1 Protein Vector (Rat) (pPB-N-His) |
|
PV277715 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) LIX1 Protein Vector (Rat) (pPM-C-HA) |
|
PV277716 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) LIX1 Protein Vector (Rat) (pPM-C-His) |
|
PV277717 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) LIX1 Protein Vector (Mouse) (pPB-C-His) |
|
PV196854 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) LIX1 Protein Vector (Mouse) (pPB-N-His) |
|
PV196855 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) LIX1 Protein Vector (Mouse) (pPM-C-HA) |
|
PV196856 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) LIX1 Protein Vector (Mouse) (pPM-C-His) |
|
PV196857 |
ABM |
500 ng |
EUR 603 |
 Lix1 3'UTR Luciferase Stable Cell Line |
|
TU207116 |
ABM |
1.0 ml |
Ask for price |
 Lix1 3'UTR GFP Stable Cell Line |
|
TU161097 |
ABM |
1.0 ml |
Ask for price |
 LIX1 3'UTR Luciferase Stable Cell Line |
|
TU012512 |
ABM |
1.0 ml |
EUR 1521 |
Lix1 3'UTR Luciferase Stable Cell Line |
|
TU111097 |
ABM |
1.0 ml |
Ask for price |
 LIX1 3'UTR GFP Stable Cell Line |
|
TU062512 |
ABM |
1.0 ml |
EUR 1521 |
Lix1 3'UTR GFP Stable Cell Line |
|
TU257116 |
ABM |
1.0 ml |
Ask for price |
 Chicken Protein limb expression 1, LIX1 ELISA KIT |
|
ELI-08625c |
Lifescience Market |
96 Tests |
EUR 928 |
 ELISA Kit) Human Protein Limb Expression 1 (LIX1) ELISA Kit |
|
abx385101-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Mouse Protein Limb Expression 1 (Lix1) ELISA Kit |
|
abx389765-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
|
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG5 Rabbit Polyclonal Antibody |
|
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
|
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG7 Rabbit Polyclonal Antibody |
|
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
|
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG13 Rabbit Polyclonal Antibody |
|
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
LIX1 Rabbit Polyclonal Antibody
