LIX1 Rabbit Polyclonal Antibody
To Order Now: info@poweratlas.org
LIX1 Polyclonal Antibody |
ABP59127-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human LIX1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of LIX1 from Human, Mouse. This LIX1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LIX1 protein |
LIX1 Polyclonal Antibody |
ABP59127-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human LIX1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of LIX1 from Human, Mouse. This LIX1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LIX1 protein |
LIX1 Polyclonal Antibody |
ABP59127-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human LIX1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of LIX1 from Human, Mouse. This LIX1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LIX1 protein |
LIX1 Polyclonal Antibody |
ES11804-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against LIX1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
LIX1 Polyclonal Antibody |
ES11804-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against LIX1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
LIX1 Rabbit pAb |
A12809-100ul |
Abclonal |
100 ul |
EUR 308 |
LIX1 Rabbit pAb |
A12809-200ul |
Abclonal |
200 ul |
EUR 459 |
LIX1 Rabbit pAb |
A12809-20ul |
Abclonal |
20 ul |
EUR 183 |
LIX1 Rabbit pAb |
A12809-50ul |
Abclonal |
50 ul |
EUR 223 |
LIX1 Polyclonal Conjugated Antibody |
C27790 |
SAB |
100ul |
EUR 397 |
LIX1 Antibody |
1-CSB-PA822702LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LIX1. Recognizes LIX1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:10-1:100 |
LIX1 antibody |
70R-3596 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal LIX1 antibody |
LIX1 Polyclonal Antibody, Biotin Conjugated |
A59639 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
LIX1 Polyclonal Antibody, FITC Conjugated |
A59640 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
LIX1 Polyclonal Antibody, HRP Conjugated |
A59641 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
Anti-LIX1 antibody |
STJ192962 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to LIX1 |
LIX1 siRNA |
20-abx922646 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LIX1 siRNA |
20-abx922647 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-LIX1 |
YF-PA22607 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to LIX1 |
LIX1 Antibody, HRP conjugated |
1-CSB-PA822702LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LIX1. Recognizes LIX1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
LIX1 Antibody, FITC conjugated |
1-CSB-PA822702LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LIX1. Recognizes LIX1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
LIX1 Antibody, Biotin conjugated |
1-CSB-PA822702LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LIX1. Recognizes LIX1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
LIX1 Blocking Peptide |
33R-9181 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LIX1 antibody, catalog no. 70R-3596 |
LIX1 cloning plasmid |
CSB-CL822702HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 849
- Sequence: atggacataaccttggaatctctgagacacatcattgcccaagtcttgcctcacagagatccggctctagtcttcaaagacttgaacgttgtgtcaatgttacaggaattttgggaaagcaagcagcagcagaaggctgcattcccaagtgaaggtgtggtggtctatgagtcact
- Show more
|
Description: A cloning plasmid for the LIX1 gene. |
Mouse LIX1 shRNA Plasmid |
20-abx975718 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human LIX1 shRNA Plasmid |
20-abx966057 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
LIX1 Recombinant Protein (Human) |
RP017857 |
ABM |
100 ug |
Ask for price |
LIX1 Recombinant Protein (Rat) |
RP208283 |
ABM |
100 ug |
Ask for price |
LIX1 Recombinant Protein (Mouse) |
RP147638 |
ABM |
100 ug |
Ask for price |
Protein Limb Expression 1 (LIX1) Antibody |
abx025913-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Protein Limb Expression 1 (LIX1) Antibody |
abx025913-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Protein Limb Expression 1 (LIX1) Antibody |
abx146234-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Protein Limb Expression 1 (LIX1) Antibody |
20-abx318393 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Protein Limb Expression 1 (LIX1) Antibody (HRP) |
20-abx308975 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Protein Limb Expression 1 (LIX1) Antibody (FITC) |
20-abx308976 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Protein Limb Expression 1 (LIX1) Antibody (Biotin) |
20-abx308977 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Recombinant human
LIX1-like protein |
P1205 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: Q8IVB5
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
Description: Recombinant protein for human LIX1-like protein |
Lix1 ORF Vector (Rat) (pORF) |
ORF069429 |
ABM |
1.0 ug DNA |
EUR 506 |
LIX1 ORF Vector (Human) (pORF) |
ORF005953 |
ABM |
1.0 ug DNA |
EUR 95 |
Lix1 ORF Vector (Mouse) (pORF) |
ORF049214 |
ABM |
1.0 ug DNA |
EUR 506 |
Lix1 sgRNA CRISPR Lentivector set (Mouse) |
K4950401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Lix1 sgRNA CRISPR Lentivector set (Rat) |
K6580901 |
ABM |
3 x 1.0 ug |
EUR 339 |
LIX1 sgRNA CRISPR Lentivector set (Human) |
K1219801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Lix1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4950402 |
ABM |
1.0 ug DNA |
EUR 154 |
Lix1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4950403 |
ABM |
1.0 ug DNA |
EUR 154 |
Lix1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4950404 |
ABM |
1.0 ug DNA |
EUR 154 |
Lix1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6580902 |
ABM |
1.0 ug DNA |
EUR 154 |
Lix1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6580903 |
ABM |
1.0 ug DNA |
EUR 154 |
Lix1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6580904 |
ABM |
1.0 ug DNA |
EUR 154 |
LIX1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1219802 |
ABM |
1.0 ug DNA |
EUR 154 |
LIX1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1219803 |
ABM |
1.0 ug DNA |
EUR 154 |
LIX1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1219804 |
ABM |
1.0 ug DNA |
EUR 154 |
LIX1 Protein Vector (Human) (pPB-C-His) |
PV023809 |
ABM |
500 ng |
EUR 329 |
LIX1 Protein Vector (Human) (pPB-N-His) |
PV023810 |
ABM |
500 ng |
EUR 329 |
LIX1 Protein Vector (Human) (pPM-C-HA) |
PV023811 |
ABM |
500 ng |
EUR 329 |
LIX1 Protein Vector (Human) (pPM-C-His) |
PV023812 |
ABM |
500 ng |
EUR 329 |
LIX1 Protein Vector (Rat) (pPB-C-His) |
PV277714 |
ABM |
500 ng |
EUR 603 |
LIX1 Protein Vector (Rat) (pPB-N-His) |
PV277715 |
ABM |
500 ng |
EUR 603 |
LIX1 Protein Vector (Rat) (pPM-C-HA) |
PV277716 |
ABM |
500 ng |
EUR 603 |
LIX1 Protein Vector (Rat) (pPM-C-His) |
PV277717 |
ABM |
500 ng |
EUR 603 |
LIX1 Protein Vector (Mouse) (pPB-C-His) |
PV196854 |
ABM |
500 ng |
EUR 603 |
LIX1 Protein Vector (Mouse) (pPB-N-His) |
PV196855 |
ABM |
500 ng |
EUR 603 |
LIX1 Protein Vector (Mouse) (pPM-C-HA) |
PV196856 |
ABM |
500 ng |
EUR 603 |
LIX1 Protein Vector (Mouse) (pPM-C-His) |
PV196857 |
ABM |
500 ng |
EUR 603 |
Lix1 3'UTR Luciferase Stable Cell Line |
TU111097 |
ABM |
1.0 ml |
Ask for price |
Lix1 3'UTR GFP Stable Cell Line |
TU161097 |
ABM |
1.0 ml |
Ask for price |
Lix1 3'UTR Luciferase Stable Cell Line |
TU207116 |
ABM |
1.0 ml |
Ask for price |
Lix1 3'UTR GFP Stable Cell Line |
TU257116 |
ABM |
1.0 ml |
Ask for price |
LIX1 3'UTR GFP Stable Cell Line |
TU062512 |
ABM |
1.0 ml |
EUR 1521 |
LIX1 3'UTR Luciferase Stable Cell Line |
TU012512 |
ABM |
1.0 ml |
EUR 1521 |
Chicken Protein limb expression 1, LIX1 ELISA KIT |
ELI-08625c |
Lifescience Market |
96 Tests |
EUR 928 |
Human Protein Limb Expression 1 (LIX1) ELISA Kit |
abx385101-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Protein Limb Expression 1 (Lix1) ELISA Kit |
abx389765-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
LIX1 Rabbit Polyclonal Antibody