LIX1 Rabbit Polyclonal Antibody

LIX1 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

LIX1 Polyclonal Antibody
ABP59127-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human LIX1 protein Applications tips:
Description: A polyclonal antibody for detection of LIX1 from Human, Mouse. This LIX1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LIX1 protein

LIX1 Polyclonal Antibody
ABP59127-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human LIX1 protein Applications tips:
Description: A polyclonal antibody for detection of LIX1 from Human, Mouse. This LIX1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LIX1 protein

LIX1 Polyclonal Antibody
ABP59127-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human LIX1 protein Applications tips:
Description: A polyclonal antibody for detection of LIX1 from Human, Mouse. This LIX1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LIX1 protein

LIX1 Polyclonal Antibody
ES11804-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against LIX1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

LIX1 Polyclonal Antibody
ES11804-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against LIX1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

LIX1 Rabbit pAb
A12809-100ul	Abclonal	100 ul	EUR 308

LIX1 Rabbit pAb
A12809-200ul	Abclonal	200 ul	EUR 459

LIX1 Rabbit pAb
A12809-20ul	Abclonal	20 ul	EUR 183

LIX1 Rabbit pAb
A12809-50ul	Abclonal	50 ul	EUR 223

LIX1 Polyclonal Conjugated Antibody
C27790	SAB	100ul	EUR 397

LIX1 Antibody
1-CSB-PA822702LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LIX1. Recognizes LIX1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:10-1:100

LIX1 antibody
70R-3596	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal LIX1 antibody

LIX1 Polyclonal Antibody, Biotin Conjugated
A59639	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

LIX1 Polyclonal Antibody, FITC Conjugated
A59640	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

LIX1 Polyclonal Antibody, HRP Conjugated
A59641	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

Anti-LIX1 antibody
STJ114675	St John's Laboratory	100 µl	EUR 277

Anti-LIX1 antibody
STJ192962	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to LIX1

LIX1 siRNA
20-abx922646	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

LIX1 siRNA
20-abx922647	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-LIX1
YF-PA22607	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to LIX1

LIX1 Antibody, HRP conjugated
1-CSB-PA822702LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LIX1. Recognizes LIX1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LIX1 Antibody, FITC conjugated
1-CSB-PA822702LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LIX1. Recognizes LIX1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LIX1 Antibody, Biotin conjugated
1-CSB-PA822702LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LIX1. Recognizes LIX1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

LIX1 Blocking Peptide
33R-9181	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LIX1 antibody, catalog no. 70R-3596

LIX1 cloning plasmid
CSB-CL822702HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 849 Sequence: atggacataaccttggaatctctgagacacatcattgcccaagtcttgcctcacagagatccggctctagtcttcaaagacttgaacgttgtgtcaatgttacaggaattttgggaaagcaagcagcagcagaaggctgcattcccaagtgaaggtgtggtggtctatgagtcact Show more
Description: A cloning plasmid for the LIX1 gene.

LIX1 ELISA KIT|Human
EF005212	Lifescience Market	96 Tests	EUR 689

Mouse LIX1 shRNA Plasmid
20-abx975718	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human LIX1 shRNA Plasmid
20-abx966057	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

LIX1 Recombinant Protein (Human)
RP017857	ABM	100 ug	Ask for price

LIX1 Recombinant Protein (Rat)
RP208283	ABM	100 ug	Ask for price

LIX1 Recombinant Protein (Mouse)
RP147638	ABM	100 ug	Ask for price

Protein Limb Expression 1 (LIX1) Antibody
abx025913-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Protein Limb Expression 1 (LIX1) Antibody
abx025913-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Protein Limb Expression 1 (LIX1) Antibody
abx146234-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Protein Limb Expression 1 (LIX1) Antibody
20-abx318393	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Protein Limb Expression 1 (LIX1) Antibody (HRP)
20-abx308975	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Protein Limb Expression 1 (LIX1) Antibody (FITC)
20-abx308976	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Protein Limb Expression 1 (LIX1) Antibody (Biotin)
20-abx308977	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Recombinant human LIX1-like protein
P1205	FN Test	100ug	Ask for price
Uniprot ID: Q8IVB5 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human LIX1-like protein

Lix1 ORF Vector (Rat) (pORF)
ORF069429	ABM	1.0 ug DNA	EUR 506

LIX1 ORF Vector (Human) (pORF)
ORF005953	ABM	1.0 ug DNA	EUR 95

Lix1 ORF Vector (Mouse) (pORF)
ORF049214	ABM	1.0 ug DNA	EUR 506

Lix1 sgRNA CRISPR Lentivector set (Mouse)
K4950401	ABM	3 x 1.0 ug	EUR 339

Lix1 sgRNA CRISPR Lentivector set (Rat)
K6580901	ABM	3 x 1.0 ug	EUR 339

LIX1 sgRNA CRISPR Lentivector set (Human)
K1219801	ABM	3 x 1.0 ug	EUR 339

Mouse LIX1- like protein, Lix1l ELISA KIT
ELI-21048m	Lifescience Market	96 Tests	EUR 865

Human LIX1- like protein, LIX1L ELISA KIT
ELI-31674h	Lifescience Market	96 Tests	EUR 824

Lix1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4950402	ABM	1.0 ug DNA	EUR 154

Lix1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4950403	ABM	1.0 ug DNA	EUR 154

Lix1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4950404	ABM	1.0 ug DNA	EUR 154

Lix1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6580902	ABM	1.0 ug DNA	EUR 154

Lix1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6580903	ABM	1.0 ug DNA	EUR 154

Lix1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6580904	ABM	1.0 ug DNA	EUR 154

LIX1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1219802	ABM	1.0 ug DNA	EUR 154

LIX1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1219803	ABM	1.0 ug DNA	EUR 154

LIX1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1219804	ABM	1.0 ug DNA	EUR 154

LIX1 Protein Vector (Human) (pPB-C-His)
PV023809	ABM	500 ng	EUR 329

LIX1 Protein Vector (Human) (pPB-N-His)
PV023810	ABM	500 ng	EUR 329

LIX1 Protein Vector (Human) (pPM-C-HA)
PV023811	ABM	500 ng	EUR 329

LIX1 Protein Vector (Human) (pPM-C-His)
PV023812	ABM	500 ng	EUR 329

LIX1 Protein Vector (Rat) (pPB-C-His)
PV277714	ABM	500 ng	EUR 603

LIX1 Protein Vector (Rat) (pPB-N-His)
PV277715	ABM	500 ng	EUR 603

LIX1 Protein Vector (Rat) (pPM-C-HA)
PV277716	ABM	500 ng	EUR 603

LIX1 Protein Vector (Rat) (pPM-C-His)
PV277717	ABM	500 ng	EUR 603

LIX1 Protein Vector (Mouse) (pPB-C-His)
PV196854	ABM	500 ng	EUR 603

LIX1 Protein Vector (Mouse) (pPB-N-His)
PV196855	ABM	500 ng	EUR 603

LIX1 Protein Vector (Mouse) (pPM-C-HA)
PV196856	ABM	500 ng	EUR 603

LIX1 Protein Vector (Mouse) (pPM-C-His)
PV196857	ABM	500 ng	EUR 603

Lix1 3'UTR Luciferase Stable Cell Line
TU111097	ABM	1.0 ml	Ask for price

Lix1 3'UTR GFP Stable Cell Line
TU161097	ABM	1.0 ml	Ask for price

Lix1 3'UTR Luciferase Stable Cell Line
TU207116	ABM	1.0 ml	Ask for price

Lix1 3'UTR GFP Stable Cell Line
TU257116	ABM	1.0 ml	Ask for price

LIX1 3'UTR GFP Stable Cell Line
TU062512	ABM	1.0 ml	EUR 1521

LIX1 3'UTR Luciferase Stable Cell Line
TU012512	ABM	1.0 ml	EUR 1521

Chicken Protein limb expression 1, LIX1 ELISA KIT
ELI-08625c	Lifescience Market	96 Tests	EUR 928

Human Protein Limb Expression 1 (LIX1) ELISA Kit
abx385101-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Protein Limb Expression 1 (Lix1) ELISA Kit
abx389765-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul	SAB	100ul	EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul	SAB	50ul	EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul	SAB	100ul	EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul	SAB	50ul	EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul	SAB	100ul	EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul	SAB	50ul	EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml	Abbkine	0.05ml	EUR 147
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml	Abbkine	0.2ml	EUR 332
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5	Abbkine	0.2ml×5	EUR 920
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody
ABP57463-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

LIX1 Rabbit Polyclonal Antibody