DNMBP Rabbit Polyclonal Antibody

DNMBP Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

DNMBP Polyclonal Antibody

ABP58404-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human DNMBP protein
  • Applications tips:
Description: A polyclonal antibody for detection of DNMBP from Human. This DNMBP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DNMBP protein

DNMBP antibody

70R-16902 50 ul
EUR 435
Description: Rabbit polyclonal DNMBP antibody

DNMBP Antibody

1-CSB-PA007081GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against DNMBP. Recognizes DNMBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

anti- DNMBP antibody

FNab02481 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:3000
  • IP: 1:500-1:2000
  • Immunogen: dynamin binding protein
  • Uniprot ID: Q6XZF7
  • Gene ID: 23268
  • Research Area: Neuroscience, Signal Transduction
Description: Antibody raised against DNMBP

Anti-DNMBP antibody

PAab02481 100 ug
EUR 355

Anti-DNMBP antibody

STJ192927 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DNMBP

DNMBP siRNA

20-abx914449
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DNMBP siRNA

20-abx914450
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-DNMBP

YF-PA17814 50 ug
EUR 363
Description: Mouse polyclonal to DNMBP

anti-DNMBP

YF-PA17815 100 ug
EUR 403
Description: Rabbit polyclonal to DNMBP

anti-DNMBP

YF-PA27516 100 ul
EUR 403
Description: Rabbit polyclonal to DNMBP

DNMBP cloning plasmid

CSB-CL757862HU-10ug 10ug
EUR 801
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2472
  • Sequence: atgacgctcctctcctcccagtcttcatcactggtggccccttctgggtctgtgtctgccgaaaatccagagcagaggatgctggagaagagagccaaggtcatagaagaacttcttcagacagaaagagactacattcgggatctggaaatgtgtattgagcggatcatggtac
  • Show more
Description: A cloning plasmid for the DNMBP gene.

Anti-DNMBP (1H2)

YF-MA17832 100 ug
EUR 363
Description: Mouse monoclonal to DNMBP

Anti-DNMBP (1H2)

YF-MA17833 200 ul
EUR 363
Description: Mouse monoclonal to DNMBP

Anti-DNMBP (1H2)

YF-MA17834 200 ul
EUR 363
Description: Mouse monoclonal to DNMBP

Anti-DNMBP (3H7)

YF-MA17835 100 ug
EUR 363
Description: Mouse monoclonal to DNMBP

Dynamin Binding Protein (DNMBP) Antibody

20-abx112195
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dynamin Binding Protein (DNMBP) Antibody

abx232481-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Mouse DNMBP shRNA Plasmid

20-abx977608
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DNMBP ELISA KIT|Human

EF009184 96 Tests
EUR 689

Human DNMBP shRNA Plasmid

20-abx958138
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Monoclonal DNMBP Antibody (monoclonal) (M01), Clone: 1H2

AMM03464G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human DNMBP (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1H2. This antibody is applicable in WB

Monoclonal DNMBP Antibody (monoclonal) (M03), Clone: 3H7

AMM03465G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human DNMBP (monoclonal) (M03). The antibodies are raised in mouse and are from clone 3H7. This antibody is applicable in WB

DNMBP ORF Vector (Human) (pORF)

ORF003221 1.0 ug DNA
EUR 95

Dnmbp ORF Vector (Mouse) (pORF)

ORF043238 1.0 ug DNA
EUR 1572

DNMBP sgRNA CRISPR Lentivector set (Human)

K0622401 3 x 1.0 ug
EUR 339

Dnmbp sgRNA CRISPR Lentivector set (Mouse)

K4704601 3 x 1.0 ug
EUR 339

DNMBP-AS1 ORF Vector (Human) (pORF)

ORF018469 1.0 ug DNA Ask for price

Human Dynamin- binding protein, DNMBP ELISA KIT

ELI-26845h 96 Tests
EUR 824

Mouse Dynamin- binding protein, Dnmbp ELISA KIT

ELI-31730m 96 Tests
EUR 865

DNMBP sgRNA CRISPR Lentivector (Human) (Target 1)

K0622402 1.0 ug DNA
EUR 154

DNMBP sgRNA CRISPR Lentivector (Human) (Target 2)

K0622403 1.0 ug DNA
EUR 154

DNMBP sgRNA CRISPR Lentivector (Human) (Target 3)

K0622404 1.0 ug DNA
EUR 154

Human Dynamin Binding Protein (DNMBP) ELISA Kit

abx386956-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Dynamin Binding Protein (DNMBP) ELISA Kit

abx389117-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Dnmbp sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4704602 1.0 ug DNA
EUR 154

Dnmbp sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4704603 1.0 ug DNA
EUR 154

Dnmbp sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4704604 1.0 ug DNA
EUR 154

DNMBP Protein Vector (Mouse) (pPB-C-His)

PV172950 500 ng
EUR 2660

DNMBP Protein Vector (Mouse) (pPB-N-His)

PV172951 500 ng
EUR 2660

DNMBP Protein Vector (Mouse) (pPM-C-HA)

PV172952 500 ng
EUR 2660

DNMBP Protein Vector (Mouse) (pPM-C-His)

PV172953 500 ng
EUR 2660

DNMBP Protein Vector (Human) (pPB-C-His)

PV012881 500 ng
EUR 329

DNMBP Protein Vector (Human) (pPB-N-His)

PV012882 500 ng
EUR 329

DNMBP Protein Vector (Human) (pPM-C-HA)

PV012883 500 ng
EUR 329

DNMBP Protein Vector (Human) (pPM-C-His)

PV012884 500 ng
EUR 329

Dnmbp 3'UTR Luciferase Stable Cell Line

TU203558 1.0 ml Ask for price

Dnmbp 3'UTR GFP Stable Cell Line

TU155303 1.0 ml Ask for price

DNMBP 3'UTR Luciferase Stable Cell Line

TU006218 1.0 ml
EUR 2333

Dnmbp 3'UTR Luciferase Stable Cell Line

TU105303 1.0 ml Ask for price

DNMBP 3'UTR GFP Stable Cell Line

TU056218 1.0 ml
EUR 2333

Dnmbp 3'UTR GFP Stable Cell Line

TU253558 1.0 ml Ask for price

Dnmbp ELISA Kit| Mouse Dynamin-binding protein ELISA Kit

EF014747 96 Tests
EUR 689

DNMBP-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723287 1.0 ug DNA Ask for price

DNMBP-AS1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723291 1.0 ug DNA Ask for price

DNMBP-AS1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723292 1.0 ug DNA Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

DNMBP Rabbit Polyclonal Antibody