DNMBP Rabbit Polyclonal Antibody

DNMBP Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

DNMBP Polyclonal Antibody

ES11769-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DNMBP. This antibody is tested and validated for WB, ELISA, WB, ELISA

DNMBP antibody

70R-16902 50 ul
EUR 435
Description: Rabbit polyclonal DNMBP antibody

DNMBP Antibody

1-CSB-PA007081GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against DNMBP. Recognizes DNMBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

anti- DNMBP antibody

FNab02481 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:3000
  • IP: 1:500-1:2000
  • Immunogen: dynamin binding protein
  • Uniprot ID: Q6XZF7
  • Gene ID: 23268
  • Research Area: Neuroscience, Signal Transduction
Description: Antibody raised against DNMBP

Anti-DNMBP antibody

PAab02481 100 ug
EUR 355

Anti-DNMBP antibody

STJ192927 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DNMBP

DNMBP siRNA

20-abx914449
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DNMBP siRNA

20-abx914450
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-DNMBP

YF-PA17814 50 ug
EUR 363
Description: Mouse polyclonal to DNMBP

anti-DNMBP

YF-PA17815 100 ug
EUR 403
Description: Rabbit polyclonal to DNMBP

anti-DNMBP

YF-PA27516 100 ul
EUR 403
Description: Rabbit polyclonal to DNMBP

DNMBP cloning plasmid

CSB-CL757862HU-10ug 10ug
EUR 801
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2472
  • Sequence: atgacgctcctctcctcccagtcttcatcactggtggccccttctgggtctgtgtctgccgaaaatccagagcagaggatgctggagaagagagccaaggtcatagaagaacttcttcagacagaaagagactacattcgggatctggaaatgtgtattgagcggatcatggtac
  • Show more
Description: A cloning plasmid for the DNMBP gene.

Anti-DNMBP (1H2)

YF-MA17832 100 ug
EUR 363
Description: Mouse monoclonal to DNMBP

Anti-DNMBP (1H2)

YF-MA17833 200 ul
EUR 363
Description: Mouse monoclonal to DNMBP

Anti-DNMBP (1H2)

YF-MA17834 200 ul
EUR 363
Description: Mouse monoclonal to DNMBP

Anti-DNMBP (3H7)

YF-MA17835 100 ug
EUR 363
Description: Mouse monoclonal to DNMBP

Dynamin Binding Protein (DNMBP) Antibody

20-abx112195
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dynamin Binding Protein (DNMBP) Antibody

abx232481-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

DNMBP ELISA KIT|Human

EF009184 96 Tests
EUR 689

Mouse DNMBP shRNA Plasmid

20-abx977608
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DNMBP shRNA Plasmid

20-abx958138
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Monoclonal DNMBP Antibody (monoclonal) (M01), Clone: 1H2

AMM03464G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human DNMBP (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1H2. This antibody is applicable in WB

Monoclonal DNMBP Antibody (monoclonal) (M03), Clone: 3H7

AMM03465G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human DNMBP (monoclonal) (M03). The antibodies are raised in mouse and are from clone 3H7. This antibody is applicable in WB

DNMBP ORF Vector (Human) (pORF)

ORF003221 1.0 ug DNA
EUR 95

Dnmbp ORF Vector (Mouse) (pORF)

ORF043238 1.0 ug DNA
EUR 1572

DNMBP sgRNA CRISPR Lentivector set (Human)

K0622401 3 x 1.0 ug
EUR 339

Dnmbp sgRNA CRISPR Lentivector set (Mouse)

K4704601 3 x 1.0 ug
EUR 339

DNMBP-AS1 ORF Vector (Human) (pORF)

ORF018469 1.0 ug DNA Ask for price

Human Dynamin- binding protein, DNMBP ELISA KIT

ELI-26845h 96 Tests
EUR 824

Human Dynamin Binding Protein (DNMBP) ELISA Kit

abx386956-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Dynamin Binding Protein (DNMBP) ELISA Kit

abx389117-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Dynamin- binding protein, Dnmbp ELISA KIT

ELI-31730m 96 Tests
EUR 865

DNMBP sgRNA CRISPR Lentivector (Human) (Target 1)

K0622402 1.0 ug DNA
EUR 154

DNMBP sgRNA CRISPR Lentivector (Human) (Target 2)

K0622403 1.0 ug DNA
EUR 154

DNMBP sgRNA CRISPR Lentivector (Human) (Target 3)

K0622404 1.0 ug DNA
EUR 154

Dnmbp sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4704602 1.0 ug DNA
EUR 154

Dnmbp sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4704603 1.0 ug DNA
EUR 154

Dnmbp sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4704604 1.0 ug DNA
EUR 154

DNMBP Protein Vector (Mouse) (pPB-C-His)

PV172950 500 ng
EUR 2660

DNMBP Protein Vector (Mouse) (pPB-N-His)

PV172951 500 ng
EUR 2660

DNMBP Protein Vector (Mouse) (pPM-C-HA)

PV172952 500 ng
EUR 2660

DNMBP Protein Vector (Mouse) (pPM-C-His)

PV172953 500 ng
EUR 2660

DNMBP Protein Vector (Human) (pPB-C-His)

PV012881 500 ng
EUR 329

DNMBP Protein Vector (Human) (pPB-N-His)

PV012882 500 ng
EUR 329

DNMBP Protein Vector (Human) (pPM-C-HA)

PV012883 500 ng
EUR 329

DNMBP Protein Vector (Human) (pPM-C-His)

PV012884 500 ng
EUR 329

Dnmbp 3'UTR GFP Stable Cell Line

TU155303 1.0 ml Ask for price

Dnmbp 3'UTR Luciferase Stable Cell Line

TU105303 1.0 ml Ask for price

Dnmbp 3'UTR Luciferase Stable Cell Line

TU203558 1.0 ml Ask for price

Dnmbp 3'UTR GFP Stable Cell Line

TU253558 1.0 ml Ask for price

DNMBP 3'UTR GFP Stable Cell Line

TU056218 1.0 ml
EUR 2333

DNMBP 3'UTR Luciferase Stable Cell Line

TU006218 1.0 ml
EUR 2333

Dnmbp ELISA Kit| Mouse Dynamin-binding protein ELISA Kit

EF014747 96 Tests
EUR 689

DNMBP-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723287 1.0 ug DNA Ask for price

DNMBP-AS1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723291 1.0 ug DNA Ask for price

DNMBP-AS1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723292 1.0 ug DNA Ask for price

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

DNMBP Rabbit Polyclonal Antibody