DNMBP Rabbit Polyclonal Antibody
To Order Now: info@poweratlas.org
 DNMBP Polyclonal Antibody |
|
ABP58404-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human DNMBP protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of DNMBP from Human. This DNMBP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DNMBP protein |
 DNMBP antibody |
|
70R-16902 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal DNMBP antibody |
 DNMBP Antibody |
|
1-CSB-PA007081GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
|
Description: A polyclonal antibody against DNMBP. Recognizes DNMBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
 anti- DNMBP antibody |
|
FNab02481 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500-1:3000
- IP: 1:500-1:2000
- Immunogen: dynamin binding protein
- Uniprot ID: Q6XZF7
- Gene ID: 23268
- Research Area: Neuroscience, Signal Transduction
|
|
Description: Antibody raised against DNMBP |
 Anti-DNMBP antibody |
|
STJ192927 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to DNMBP |
 DNMBP siRNA |
|
20-abx914449 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DNMBP siRNA |
|
20-abx914450 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-DNMBP |
|
YF-PA17814 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to DNMBP |
anti-DNMBP |
|
YF-PA17815 |
Abfrontier |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal to DNMBP |
anti-DNMBP |
|
YF-PA27516 |
Abfrontier |
100 ul |
EUR 403 |
|
Description: Rabbit polyclonal to DNMBP |
 DNMBP cloning plasmid |
|
CSB-CL757862HU-10ug |
Cusabio |
10ug |
EUR 801 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2472
- Sequence: atgacgctcctctcctcccagtcttcatcactggtggccccttctgggtctgtgtctgccgaaaatccagagcagaggatgctggagaagagagccaaggtcatagaagaacttcttcagacagaaagagactacattcgggatctggaaatgtgtattgagcggatcatggtac
- Show more
|
|
Description: A cloning plasmid for the DNMBP gene. |
) Anti-DNMBP (1H2) |
|
YF-MA17832 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to DNMBP |
Anti-DNMBP (1H2) |
|
YF-MA17833 |
Abfrontier |
200 ul |
EUR 363 |
|
Description: Mouse monoclonal to DNMBP |
Anti-DNMBP (1H2) |
|
YF-MA17834 |
Abfrontier |
200 ul |
EUR 363 |
|
Description: Mouse monoclonal to DNMBP |
) Anti-DNMBP (3H7) |
|
YF-MA17835 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to DNMBP |
 Antibody) Dynamin Binding Protein (DNMBP) Antibody |
|
20-abx112195 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dynamin Binding Protein (DNMBP) Antibody |
|
abx232481-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
 Mouse DNMBP shRNA Plasmid |
|
20-abx977608 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human DNMBP shRNA Plasmid |
|
20-abx958138 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 (M01), Clone: 1H2) Monoclonal DNMBP Antibody (monoclonal) (M01), Clone: 1H2 |
|
AMM03464G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human DNMBP (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1H2. This antibody is applicable in WB |
 (M03), Clone: 3H7) Monoclonal DNMBP Antibody (monoclonal) (M03), Clone: 3H7 |
|
AMM03465G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human DNMBP (monoclonal) (M03). The antibodies are raised in mouse and are from clone 3H7. This antibody is applicable in WB |
 (pORF)) DNMBP ORF Vector (Human) (pORF) |
|
ORF003221 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Dnmbp ORF Vector (Mouse) (pORF) |
|
ORF043238 |
ABM |
1.0 ug DNA |
EUR 1572 |
) DNMBP sgRNA CRISPR Lentivector set (Human) |
|
K0622401 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Dnmbp sgRNA CRISPR Lentivector set (Mouse) |
|
K4704601 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (pORF)) DNMBP-AS1 ORF Vector (Human) (pORF) |
|
ORF018469 |
ABM |
1.0 ug DNA |
Ask for price |
 Human Dynamin- binding protein, DNMBP ELISA KIT |
|
ELI-26845h |
Lifescience Market |
96 Tests |
EUR 824 |
 Mouse Dynamin- binding protein, Dnmbp ELISA KIT |
|
ELI-31730m |
Lifescience Market |
96 Tests |
EUR 865 |
 (Target 1)) DNMBP sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0622402 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) DNMBP sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0622403 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) DNMBP sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0622404 |
ABM |
1.0 ug DNA |
EUR 154 |
 ELISA Kit) Human Dynamin Binding Protein (DNMBP) ELISA Kit |
|
abx386956-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Mouse Dynamin Binding Protein (DNMBP) ELISA Kit |
|
abx389117-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 (Target 1)) Dnmbp sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4704602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Dnmbp sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4704603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Dnmbp sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4704604 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) DNMBP Protein Vector (Mouse) (pPB-C-His) |
|
PV172950 |
ABM |
500 ng |
EUR 2660 |
 (pPB-N-His)) DNMBP Protein Vector (Mouse) (pPB-N-His) |
|
PV172951 |
ABM |
500 ng |
EUR 2660 |
 (pPM-C-HA)) DNMBP Protein Vector (Mouse) (pPM-C-HA) |
|
PV172952 |
ABM |
500 ng |
EUR 2660 |
 (pPM-C-His)) DNMBP Protein Vector (Mouse) (pPM-C-His) |
|
PV172953 |
ABM |
500 ng |
EUR 2660 |
 (pPB-C-His)) DNMBP Protein Vector (Human) (pPB-C-His) |
|
PV012881 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) DNMBP Protein Vector (Human) (pPB-N-His) |
|
PV012882 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) DNMBP Protein Vector (Human) (pPM-C-HA) |
|
PV012883 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) DNMBP Protein Vector (Human) (pPM-C-His) |
|
PV012884 |
ABM |
500 ng |
EUR 329 |
 Dnmbp 3'UTR Luciferase Stable Cell Line |
|
TU203558 |
ABM |
1.0 ml |
Ask for price |
 Dnmbp 3'UTR GFP Stable Cell Line |
|
TU155303 |
ABM |
1.0 ml |
Ask for price |
 DNMBP 3'UTR Luciferase Stable Cell Line |
|
TU006218 |
ABM |
1.0 ml |
EUR 2333 |
Dnmbp 3'UTR Luciferase Stable Cell Line |
|
TU105303 |
ABM |
1.0 ml |
Ask for price |
 DNMBP 3'UTR GFP Stable Cell Line |
|
TU056218 |
ABM |
1.0 ml |
EUR 2333 |
Dnmbp 3'UTR GFP Stable Cell Line |
|
TU253558 |
ABM |
1.0 ml |
Ask for price |
 Dnmbp ELISA Kit| Mouse Dynamin-binding protein ELISA Kit |
|
EF014747 |
Lifescience Market |
96 Tests |
EUR 689 |
 (CMV) (pLenti-GIII-CMV)) DNMBP-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
|
LV723287 |
ABM |
1.0 ug DNA |
Ask for price |
 (UbC) (pLenti-GIII-UbC)) DNMBP-AS1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
|
LV723291 |
ABM |
1.0 ug DNA |
Ask for price |
 (EF1a) (pLenti-GIII-EF1a)) DNMBP-AS1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
|
LV723292 |
ABM |
1.0 ug DNA |
Ask for price |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
DNMBP Rabbit Polyclonal Antibody
