DERL1 Rabbit Polyclonal Antibody

DERL1 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

DERL1 Polyclonal Antibody
ES11967-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DERL1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
DERL1 Polyclonal Antibody
ABP58353-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human DERL1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of DERL1 from Human, Mouse. This DERL1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DERL1 protein
DERL1 Polyclonal Antibody
ABP58353-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human DERL1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of DERL1 from Human, Mouse. This DERL1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DERL1 protein
DERL1 Polyclonal Antibody
ABP58353-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human DERL1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of DERL1 from Human, Mouse. This DERL1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DERL1 protein
DERL1 Polyclonal Antibody
31579-100ul 100ul
EUR 252
DERL1 Polyclonal Antibody
31579-50ul 50ul
EUR 187
DERL1 Rabbit pAb
A8508-100ul 100 ul
EUR 308
DERL1 Rabbit pAb
A8508-200ul 200 ul
EUR 459
DERL1 Rabbit pAb
A8508-20ul 20 ul
EUR 183
DERL1 Rabbit pAb
A8508-50ul 50 ul
EUR 223
DERL1 Polyclonal Conjugated Antibody
C31579 100ul
EUR 397
Polyclonal DERL1 Antibody (C-term)
APR15722G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DERL1 (C-term). This antibody is tested and proven to work in the following applications:
Anti-DERL1 antibody
STJ110806 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the derlin family. Members of this family participate in the ER-associated degradation response and retrotranslocate misfolded or unfolded proteins from the ER lumen to the cytosol for proteasomal degradation. This protein recognizes substrate in the ER and works in a complex to retrotranslocate it across the ER membrane into the cytosol. This protein may select cystic fibrosis transmembrane conductance regulator protein (CFTR) for degradation as well as unfolded proteins in Alzheimer's disease. Alternative splicing results in multiple transcript variants that encode different protein isoforms.
Anti-DERL1 antibody
STJ193125 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DERL1
DERL1 siRNA
20-abx914020
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
DERL1 siRNA
20-abx914021
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
pOTB7-DERL1
PVT19105 2 ug
EUR 231
Derlin-1 (DERL1) Antibody
20-abx005939
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
DERL1 cloning plasmid
CSB-CL887128HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 756
  • Sequence: atgtcggacatcggagactggttcaggagcatcccggcgatcacgcgctattggttcgccgccaccgtcgccgtgcccttggtcggcaaactcggcctcatcagcccggcctacctcttcctctggcccgaagccttcctttatcgctttcagatttggaggccaatcactgccac
  • Show more
Description: A cloning plasmid for the DERL1 gene.
Anti-DERL1 (1B9)
YF-MA19309 100 ug
EUR 363
Description: Mouse monoclonal to DERL1
Mouse DERL1 shRNA Plasmid
20-abx976335
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human DERL1 shRNA Plasmid
20-abx962321
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
DERL1 Recombinant Protein (Human)
RP009166 100 ug Ask for price
DERL1 Recombinant Protein (Rat)
RP197894 100 ug Ask for price
DERL1 Recombinant Protein (Mouse)
RP128804 100 ug Ask for price
DERL1 ORF Vector (Human) (pORF)
ORF003056 1.0 ug DNA
EUR 95
Derl1 ORF Vector (Rat) (pORF)
ORF065966 1.0 ug DNA
EUR 506
Derl1 ORF Vector (Mouse) (pORF)
ORF042936 1.0 ug DNA
EUR 506
Bovine Derlin- 1, DERL1 ELISA KIT
ELI-28118b 96 Tests
EUR 928
Human Derlin- 1, DERL1 ELISA KIT
ELI-46940h 96 Tests
EUR 824
Mouse Derlin- 1, Derl1 ELISA KIT
ELI-47007m 96 Tests
EUR 865
DERL1 sgRNA CRISPR Lentivector set (Human)
K0585201 3 x 1.0 ug
EUR 339
Derl1 sgRNA CRISPR Lentivector set (Rat)
K6438401 3 x 1.0 ug
EUR 339
Derl1 sgRNA CRISPR Lentivector set (Mouse)
K4819901 3 x 1.0 ug
EUR 339
Human Derlin 1(DERL1)ELISA Kit
QY-E04984 96T
EUR 361
DERL1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0585202 1.0 ug DNA
EUR 154
DERL1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0585203 1.0 ug DNA
EUR 154
DERL1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0585204 1.0 ug DNA
EUR 154
Derl1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6438402 1.0 ug DNA
EUR 154
Derl1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6438403 1.0 ug DNA
EUR 154
Derl1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6438404 1.0 ug DNA
EUR 154
Derl1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4819902 1.0 ug DNA
EUR 154
Derl1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4819903 1.0 ug DNA
EUR 154
Derl1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4819904 1.0 ug DNA
EUR 154
ELISA kit for Mouse Derlin-1 (DERL1)
KTE71309-48T 48T
EUR 332
  • The protein encoded by DERL1 is a member of the derlin family. Members of this family participate in the ER-associated degradation response and retrotranslocate misfolded or unfolded proteins from the ER lumen to the cytosol for proteasomal degradati
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Derlin-1 (DERL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Derlin-1 (DERL1)
KTE71309-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The protein encoded by DERL1 is a member of the derlin family. Members of this family participate in the ER-associated degradation response and retrotranslocate misfolded or unfolded proteins from the ER lumen to the cytosol for proteasomal degradati
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Derlin-1 (DERL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse Derlin-1 (DERL1)
KTE71309-96T 96T
EUR 539
  • The protein encoded by DERL1 is a member of the derlin family. Members of this family participate in the ER-associated degradation response and retrotranslocate misfolded or unfolded proteins from the ER lumen to the cytosol for proteasomal degradati
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Derlin-1 (DERL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Bovine Derlin-1 (DERL1)
KTE10362-48T 48T
EUR 354
  • Derlin-1 (DERL1) is a member of the derlin family. Members of this family participate in the ER-associated degradation response and retrotranslocate misfolded or unfolded proteins from the ER lumen to the cytosol for proteasomal degradation. This pro
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Derlin-1 (DERL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Bovine Derlin-1 (DERL1)
KTE10362-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Derlin-1 (DERL1) is a member of the derlin family. Members of this family participate in the ER-associated degradation response and retrotranslocate misfolded or unfolded proteins from the ER lumen to the cytosol for proteasomal degradation. This pro
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Derlin-1 (DERL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Bovine Derlin-1 (DERL1)
KTE10362-96T 96T
EUR 572
  • Derlin-1 (DERL1) is a member of the derlin family. Members of this family participate in the ER-associated degradation response and retrotranslocate misfolded or unfolded proteins from the ER lumen to the cytosol for proteasomal degradation. This pro
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Derlin-1 (DERL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

DERL1 Rabbit Polyclonal Antibody