DERL1 Rabbit Polyclonal Antibody

DERL1 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

DERL1 Polyclonal Antibody
31579-50ul	SAB	50ul	EUR 187

DERL1 Polyclonal Antibody
ABP58353-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human DERL1 protein Applications tips:
Description: A polyclonal antibody for detection of DERL1 from Human, Mouse. This DERL1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DERL1 protein

DERL1 Polyclonal Antibody
ABP58353-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human DERL1 protein Applications tips:
Description: A polyclonal antibody for detection of DERL1 from Human, Mouse. This DERL1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DERL1 protein

DERL1 Polyclonal Antibody
ABP58353-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human DERL1 protein Applications tips:
Description: A polyclonal antibody for detection of DERL1 from Human, Mouse. This DERL1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DERL1 protein

DERL1 Polyclonal Antibody
ES11967-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against DERL1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DERL1 Polyclonal Antibody
ES11967-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against DERL1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DERL1 Rabbit pAb
A8508-100ul	Abclonal	100 ul	EUR 308

DERL1 Rabbit pAb
A8508-200ul	Abclonal	200 ul	EUR 459

DERL1 Rabbit pAb
A8508-20ul	Abclonal	20 ul	EUR 183

DERL1 Rabbit pAb
A8508-50ul	Abclonal	50 ul	EUR 223

DERL1 Polyclonal Conjugated Antibody
C31579	SAB	100ul	EUR 397

Polyclonal DERL1 Antibody (C-term)
APR15722G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DERL1 (C-term). This antibody is tested and proven to work in the following applications:

Anti-DERL1 antibody
STJ110806	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of the derlin family. Members of this family participate in the ER-associated degradation response and retrotranslocate misfolded or unfolded proteins from the ER lumen to the cytosol for proteasomal degradation. This protein recognizes substrate in the ER and works in a complex to retrotranslocate it across the ER membrane into the cytosol. This protein may select cystic fibrosis transmembrane conductance regulator protein (CFTR) for degradation as well as unfolded proteins in Alzheimer's disease. Alternative splicing results in multiple transcript variants that encode different protein isoforms.

Anti-DERL1 antibody
STJ193125	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to DERL1

DERL1 siRNA
20-abx914020	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DERL1 siRNA
20-abx914021	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pOTB7-DERL1
PVT19105	Lifescience Market	2 ug	EUR 231

Derlin-1 (DERL1) Antibody
20-abx005939	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

DERL1 cloning plasmid
CSB-CL887128HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 756 Sequence: atgtcggacatcggagactggttcaggagcatcccggcgatcacgcgctattggttcgccgccaccgtcgccgtgcccttggtcggcaaactcggcctcatcagcccggcctacctcttcctctggcccgaagccttcctttatcgctttcagatttggaggccaatcactgccac Show more
Description: A cloning plasmid for the DERL1 gene.

Anti-DERL1 (1B9)
YF-MA19309	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to DERL1

Mouse DERL1 shRNA Plasmid
20-abx976335	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human DERL1 shRNA Plasmid
20-abx962321	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

DERL1 Recombinant Protein (Human)
RP009166	ABM	100 ug	Ask for price

DERL1 Recombinant Protein (Rat)
RP197894	ABM	100 ug	Ask for price

DERL1 Recombinant Protein (Mouse)
RP128804	ABM	100 ug	Ask for price

Derl1 ORF Vector (Rat) (pORF)
ORF065966	ABM	1.0 ug DNA	EUR 506

DERL1 ORF Vector (Human) (pORF)
ORF003056	ABM	1.0 ug DNA	EUR 95

Derl1 ORF Vector (Mouse) (pORF)
ORF042936	ABM	1.0 ug DNA	EUR 506

Bovine Derlin- 1, DERL1 ELISA KIT
ELI-28118b	Lifescience Market	96 Tests	EUR 928

Human Derlin- 1, DERL1 ELISA KIT
ELI-46940h	Lifescience Market	96 Tests	EUR 824

Mouse Derlin- 1, Derl1 ELISA KIT
ELI-47007m	Lifescience Market	96 Tests	EUR 865

DERL1 sgRNA CRISPR Lentivector set (Human)
K0585201	ABM	3 x 1.0 ug	EUR 339

Derl1 sgRNA CRISPR Lentivector set (Mouse)
K4819901	ABM	3 x 1.0 ug	EUR 339

Derl1 sgRNA CRISPR Lentivector set (Rat)
K6438401	ABM	3 x 1.0 ug	EUR 339

Human Derlin 1(DERL1)ELISA Kit
QY-E04984	Qayee Biotechnology	96T	EUR 361

DERL1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0585202	ABM	1.0 ug DNA	EUR 154

DERL1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0585203	ABM	1.0 ug DNA	EUR 154

DERL1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0585204	ABM	1.0 ug DNA	EUR 154

Derl1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4819902	ABM	1.0 ug DNA	EUR 154

Derl1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4819903	ABM	1.0 ug DNA	EUR 154

Derl1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4819904	ABM	1.0 ug DNA	EUR 154

Derl1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6438402	ABM	1.0 ug DNA	EUR 154

Derl1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6438403	ABM	1.0 ug DNA	EUR 154

Derl1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6438404	ABM	1.0 ug DNA	EUR 154

ELISA kit for Bovine Derlin-1 (DERL1)
KTE10362-48T	Abbkine	48T	EUR 354
Derlin-1 (DERL1) is a member of the derlin family. Members of this family participate in the ER-associated degradation response and retrotranslocate misfolded or unfolded proteins from the ER lumen to the cytosol for proteasomal degradation. This pro Show more
Description: Quantitative sandwich ELISA for measuring Bovine Derlin-1 (DERL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Derlin-1 (DERL1)
KTE10362-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Derlin-1 (DERL1) is a member of the derlin family. Members of this family participate in the ER-associated degradation response and retrotranslocate misfolded or unfolded proteins from the ER lumen to the cytosol for proteasomal degradation. This pro Show more
Description: Quantitative sandwich ELISA for measuring Bovine Derlin-1 (DERL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Derlin-1 (DERL1)
KTE10362-96T	Abbkine	96T	EUR 572
Derlin-1 (DERL1) is a member of the derlin family. Members of this family participate in the ER-associated degradation response and retrotranslocate misfolded or unfolded proteins from the ER lumen to the cytosol for proteasomal degradation. This pro Show more
Description: Quantitative sandwich ELISA for measuring Bovine Derlin-1 (DERL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Derlin-1 (DERL1)
KTE71309-48T	Abbkine	48T	EUR 332
The protein encoded by DERL1 is a member of the derlin family. Members of this family participate in the ER-associated degradation response and retrotranslocate misfolded or unfolded proteins from the ER lumen to the cytosol for proteasomal degradati Show more
Description: Quantitative sandwich ELISA for measuring Mouse Derlin-1 (DERL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Derlin-1 (DERL1)
KTE71309-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
The protein encoded by DERL1 is a member of the derlin family. Members of this family participate in the ER-associated degradation response and retrotranslocate misfolded or unfolded proteins from the ER lumen to the cytosol for proteasomal degradati Show more
Description: Quantitative sandwich ELISA for measuring Mouse Derlin-1 (DERL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Derlin-1 (DERL1)
KTE71309-96T	Abbkine	96T	EUR 539
The protein encoded by DERL1 is a member of the derlin family. Members of this family participate in the ER-associated degradation response and retrotranslocate misfolded or unfolded proteins from the ER lumen to the cytosol for proteasomal degradati Show more
Description: Quantitative sandwich ELISA for measuring Mouse Derlin-1 (DERL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

DERL1 Rabbit Polyclonal Antibody