DERL1 Rabbit Polyclonal Antibody
To Order Now: info@poweratlas.org
 DERL1 Polyclonal Antibody |
|
31579-50ul |
SAB |
50ul |
EUR 187 |
|
DERL1 Polyclonal Antibody |
|
ABP58353-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human DERL1 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of DERL1 from Human, Mouse. This DERL1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DERL1 protein |
|
DERL1 Polyclonal Antibody |
|
ABP58353-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human DERL1 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of DERL1 from Human, Mouse. This DERL1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DERL1 protein |
|
DERL1 Polyclonal Antibody |
|
ABP58353-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human DERL1 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of DERL1 from Human, Mouse. This DERL1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DERL1 protein |
|
DERL1 Polyclonal Antibody |
|
ES11967-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against DERL1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
|
DERL1 Polyclonal Antibody |
|
ES11967-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against DERL1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 DERL1 Rabbit pAb |
|
A8508-100ul |
Abclonal |
100 ul |
EUR 308 |
|
DERL1 Rabbit pAb |
|
A8508-200ul |
Abclonal |
200 ul |
EUR 459 |
|
DERL1 Rabbit pAb |
|
A8508-20ul |
Abclonal |
20 ul |
EUR 183 |
|
DERL1 Rabbit pAb |
|
A8508-50ul |
Abclonal |
50 ul |
EUR 223 |
 DERL1 Polyclonal Conjugated Antibody |
|
C31579 |
SAB |
100ul |
EUR 397 |
) Polyclonal DERL1 Antibody (C-term) |
|
APR15722G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DERL1 (C-term). This antibody is tested and proven to work in the following applications: |
 Anti-DERL1 antibody |
|
STJ110806 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: The protein encoded by this gene is a member of the derlin family. Members of this family participate in the ER-associated degradation response and retrotranslocate misfolded or unfolded proteins from the ER lumen to the cytosol for proteasomal degradation. This protein recognizes substrate in the ER and works in a complex to retrotranslocate it across the ER membrane into the cytosol. This protein may select cystic fibrosis transmembrane conductance regulator protein (CFTR) for degradation as well as unfolded proteins in Alzheimer's disease. Alternative splicing results in multiple transcript variants that encode different protein isoforms. |
|
Anti-DERL1 antibody |
|
STJ193125 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to DERL1 |
 DERL1 siRNA |
|
20-abx914020 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
|
DERL1 siRNA |
|
20-abx914021 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Antibody) Derlin-1 (DERL1) Antibody |
|
20-abx005939 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
 DERL1 cloning plasmid |
|
CSB-CL887128HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 756
- Sequence: atgtcggacatcggagactggttcaggagcatcccggcgatcacgcgctattggttcgccgccaccgtcgccgtgcccttggtcggcaaactcggcctcatcagcccggcctacctcttcctctggcccgaagccttcctttatcgctttcagatttggaggccaatcactgccac
- Show more
|
|
Description: A cloning plasmid for the DERL1 gene. |
) Anti-DERL1 (1B9) |
|
YF-MA19309 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to DERL1 |
 Mouse DERL1 shRNA Plasmid |
|
20-abx976335 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human DERL1 shRNA Plasmid |
|
20-abx962321 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) DERL1 Recombinant Protein (Human) |
|
RP009166 |
ABM |
100 ug |
Ask for price |
) DERL1 Recombinant Protein (Rat) |
|
RP197894 |
ABM |
100 ug |
Ask for price |
) DERL1 Recombinant Protein (Mouse) |
|
RP128804 |
ABM |
100 ug |
Ask for price |
 (pORF)) Derl1 ORF Vector (Rat) (pORF) |
|
ORF065966 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) DERL1 ORF Vector (Human) (pORF) |
|
ORF003056 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Derl1 ORF Vector (Mouse) (pORF) |
|
ORF042936 |
ABM |
1.0 ug DNA |
EUR 506 |
) DERL1 sgRNA CRISPR Lentivector set (Human) |
|
K0585201 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Derl1 sgRNA CRISPR Lentivector set (Mouse) |
|
K4819901 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Derl1 sgRNA CRISPR Lentivector set (Rat) |
|
K6438401 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) DERL1 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0585202 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) DERL1 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0585203 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) DERL1 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0585204 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Derl1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4819902 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Derl1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4819903 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Derl1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4819904 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Derl1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6438402 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Derl1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6438403 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Derl1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6438404 |
ABM |
1.0 ug DNA |
EUR 154 |
) ELISA kit for Bovine Derlin-1 (DERL1) |
|
KTE10362-48T |
Abbkine |
48T |
EUR 354 |
- Derlin-1 (DERL1) is a member of the derlin family. Members of this family participate in the ER-associated degradation response and retrotranslocate misfolded or unfolded proteins from the ER lumen to the cytosol for proteasomal degradation. This pro
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Bovine Derlin-1 (DERL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
|
ELISA kit for Bovine Derlin-1 (DERL1) |
|
KTE10362-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- Derlin-1 (DERL1) is a member of the derlin family. Members of this family participate in the ER-associated degradation response and retrotranslocate misfolded or unfolded proteins from the ER lumen to the cytosol for proteasomal degradation. This pro
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Bovine Derlin-1 (DERL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
|
ELISA kit for Bovine Derlin-1 (DERL1) |
|
KTE10362-96T |
Abbkine |
96T |
EUR 572 |
- Derlin-1 (DERL1) is a member of the derlin family. Members of this family participate in the ER-associated degradation response and retrotranslocate misfolded or unfolded proteins from the ER lumen to the cytosol for proteasomal degradation. This pro
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Bovine Derlin-1 (DERL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
) ELISA kit for Mouse Derlin-1 (DERL1) |
|
KTE71309-48T |
Abbkine |
48T |
EUR 332 |
- The protein encoded by DERL1 is a member of the derlin family. Members of this family participate in the ER-associated degradation response and retrotranslocate misfolded or unfolded proteins from the ER lumen to the cytosol for proteasomal degradati
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Mouse Derlin-1 (DERL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
|
ELISA kit for Mouse Derlin-1 (DERL1) |
|
KTE71309-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- The protein encoded by DERL1 is a member of the derlin family. Members of this family participate in the ER-associated degradation response and retrotranslocate misfolded or unfolded proteins from the ER lumen to the cytosol for proteasomal degradati
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Mouse Derlin-1 (DERL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
|
ELISA kit for Mouse Derlin-1 (DERL1) |
|
KTE71309-96T |
Abbkine |
96T |
EUR 539 |
- The protein encoded by DERL1 is a member of the derlin family. Members of this family participate in the ER-associated degradation response and retrotranslocate misfolded or unfolded proteins from the ER lumen to the cytosol for proteasomal degradati
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Mouse Derlin-1 (DERL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
DERL1 Rabbit Polyclonal Antibody
pOTB7-DERL1 
Bovine Derlin- 1, DERL1 ELISA KIT 
Human Derlin- 1, DERL1 ELISA KIT 
Mouse Derlin- 1, Derl1 ELISA KIT ELISA Kit)
Human Derlin 1(DERL1)ELISA Kit