MYH9 Rabbit Polyclonal Antibody

MYH9 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

MYH9 Polyclonal Antibody
ABP59367-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human MYH9 protein Applications tips:
Description: A polyclonal antibody for detection of MYH9 from Human, Mouse, Rat. This MYH9 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYH9 protein

MYH9 Polyclonal Antibody
ABP59367-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human MYH9 protein Applications tips:
Description: A polyclonal antibody for detection of MYH9 from Human, Mouse, Rat. This MYH9 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYH9 protein

MYH9 Polyclonal Antibody
A53889	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

MYH9 Rabbit pAb
A0173-100ul	Abclonal	100 ul	EUR 308

MYH9 Rabbit pAb
A0173-200ul	Abclonal	200 ul	EUR 459

MYH9 Rabbit pAb
A0173-20ul	Abclonal	20 ul	EUR 183

MYH9 Rabbit pAb
A0173-50ul	Abclonal	50 ul	EUR 223

MYH9 Rabbit pAb
A16923-100ul	Abclonal	100 ul	EUR 308

MYH9 Rabbit pAb
A16923-200ul	Abclonal	200 ul	EUR 459

MYH9 Rabbit pAb
A16923-20ul	Abclonal	20 ul	EUR 183

MYH9 Rabbit pAb
A16923-50ul	Abclonal	50 ul	EUR 223

Human Myosin Heavy Chain 9, Non Muscle (MYH9) ELISA Kit
DLR-MYH9-Hu-48T	DL Develop	48T	EUR 517
Should the Human Myosin Heavy Chain 9, Non Muscle (MYH9) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Myosin Heavy Chain 9, Non Muscle (MYH9) in samples from serum, plasma or other biological fluids.

Human Myosin Heavy Chain 9, Non Muscle (MYH9) ELISA Kit
DLR-MYH9-Hu-96T	DL Develop	96T	EUR 673
Should the Human Myosin Heavy Chain 9, Non Muscle (MYH9) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Myosin Heavy Chain 9, Non Muscle (MYH9) in samples from serum, plasma or other biological fluids.

Human Myosin Heavy Chain 9, Non Muscle (MYH9) ELISA Kit
RD-MYH9-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Myosin Heavy Chain 9, Non Muscle (MYH9) ELISA Kit
RD-MYH9-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Myosin Heavy Chain 9, Non Muscle (MYH9) ELISA Kit
RDR-MYH9-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Myosin Heavy Chain 9, Non Muscle (MYH9) ELISA Kit
RDR-MYH9-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

MYH9 antibody
70R-51307	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal MYH9 antibody

MYH9 antibody
70R-2739	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal MYH9 antibody raised against the middle region of MYH9

MYH9 Antibody
ABD8574	Lifescience Market	100 ug	EUR 438

MYH9 Antibody
45364-100ul	SAB	100ul	EUR 252

MYH9 Antibody
45364-50ul	SAB	50ul	EUR 187

MYH9 antibody
70R-18705	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal MYH9 antibody

MYH9 Antibody
DF8574	Affbiotech	200ul	EUR 304
Description: MYH9 Antibody detects endogenous levels of total MYH9.

MYH9 Antibody
1-CSB-PA01405A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYH9. Recognizes MYH9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

MYH9 Antibody
1-CSB-PA015303GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MYH9. Recognizes MYH9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

Polyclonal MYH9 Antibody (internal region)
APR17492G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human MYH9 (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal MYH9 Antibody (C-term)
APR17493G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MYH9 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal Phospho-MYH9(Y158) Antibody
APR14366G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Phospho-MYH9(Y158) . This antibody is tested and proven to work in the following applications:

MYH9 Polyclonal Antibody, HRP Conjugated
A53890	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

MYH9 Polyclonal Antibody, FITC Conjugated
A53891	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

MYH9 Polyclonal Antibody, Biotin Conjugated
A53892	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

Polyclonal MYH9 Antibody (N-term Y158)
APR17498G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MYH9 (N-term Y158). This antibody is tested and proven to work in the following applications:

Phospho-MYH9-S1943 Rabbit pAb
AP0802-100ul	Abclonal	100 ul	EUR 384

Phospho-MYH9-S1943 Rabbit pAb
AP0802-200ul	Abclonal	200 ul	EUR 554

Phospho-MYH9-S1943 Rabbit pAb
AP0802-20ul	Abclonal	20 ul	EUR 183

Phospho-MYH9-S1943 Rabbit pAb
AP0802-50ul	Abclonal	50 ul	EUR 265

MYH9 Conjugated Antibody
C45364	SAB	100ul	EUR 397

anti- MYH9 antibody
FNab05479	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:1000 - 1:2000 IHC: 1:50 - 1:100 Immunogen: myosin, heavy chain 9, non-muscle Uniprot ID: P35579 Gene ID: 4627 Research Area: Immunology, Developmental biology
Description: Antibody raised against MYH9

anti- Myh9 antibody
FNab05480	FN Test	100µg	EUR 585
Recommended dilution: WB : 1:500-1:2000 IHC : 1:20-1:200 IF : 1:50-1:500 Immunogen: myosin, heavy polypeptide 9, non-muscle Uniprot ID: P35579 Gene ID: 4627 Research Area: Immunology, Developmental biology
Description: Antibody raised against Myh9

anti- Myh9 antibody
FNab05481	FN Test	100µg	EUR 585
Immunogen: myosin, heavy polypeptide 9, non-muscle Uniprot ID: Q8VDD5 Gene ID: 17886 Research Area: Immunology, Developmental biology
Description: Antibody raised against Myh9

anti- MYH9 antibody
FNab05482	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:1000-1:5000 Immunogen: myosin, heavy chain 9, non-muscle Uniprot ID: P35579 Gene ID: 4627 Research Area: Immunology, Developmental biology
Description: Antibody raised against MYH9

MYH9 (pY158) Antibody
abx032117-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

MYH9 (pY158) Antibody
abx032117-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Anti-MYH9 antibody
PAab05479	Lifescience Market	100 ug	EUR 355

Anti-Myh9 antibody
PAab05480	Lifescience Market	100 ug	EUR 412

Anti-Myh9 antibody
PAab05481	Lifescience Market	100 ug	EUR 412

Anti-MYH9 antibody
STJ73316	St John's Laboratory	100 µg	EUR 359

Anti-MYH9 antibody
STJ24664	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a conventional non-muscle myosin; this protein should not be confused with the unconventional myosin-9a or 9b (MYO9A or MYO9B). The encoded protein is a myosin IIA heavy chain that contains an IQ domain and a myosin head-like domain which is involved in several important functions, including cytokinesis, cell motility and maintenance of cell shape. Defects in this gene have been associated with non-syndromic sensorineural deafness autosomal dominant type 17, Epstein syndrome, Alport syndrome with macrothrombocytopenia, Sebastian syndrome, Fechtner syndrome and macrothrombocytopenia with progressive sensorineural deafness.

Anti-MYH9 antibody
STJ119260	St John's Laboratory	100 µl	EUR 277

Anti-MYH9 antibody
STJ193078	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to MYH9

MYH9 siRNA
20-abx903417	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MYH9 siRNA
20-abx925159	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MYH9 siRNA
20-abx925160	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MYH9 protein
30R-3272	Fitzgerald	50 ug	EUR 257
Description: Purified recombinant MYH9 protein

pOTB7-MYH9
PVT17683	Lifescience Market	2 ug	EUR 231

MYH9 Antibody, HRP conjugated
1-CSB-PA01405B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYH9. Recognizes MYH9 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MYH9 Antibody, FITC conjugated
1-CSB-PA01405C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYH9. Recognizes MYH9 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MYH9 Antibody, Biotin conjugated
1-CSB-PA01405D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYH9. Recognizes MYH9 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MYH9 cloning plasmid
CSB-CL015303HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 429 Sequence: atggcaaagcggatggggctgaggccaaacctgccgaataagcctcttctcctgcagcctgagatggatggacagacagacaccacagcctccccttcccagaccccgcagcacgcctctccccaccttcttgggactgctgtgaacatgcctcctcctgccctccgccccgtccc Show more
Description: A cloning plasmid for the MYH9 gene.

MYH9 Blocking Peptide
33R-1860	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MYH9 antibody, catalog no. 70R-2739

MYH9 Blocking Peptide
DF8574-BP	Affbiotech	1mg	EUR 195

anti-MYH9 (3C7)
LF-MA10200	Abfrontier	50 ug	EUR 363
Description: Mouse monoclonal to MYH9

Anti-Phospho-MYH9-(S1943) antibody
STJ117900	St John's Laboratory	100 µl	EUR 393
Description: This gene encodes a conventional non-muscle myosin; this protein should not be confused with the unconventional myosin-9a or 9b (MYO9A or MYO9B). The encoded protein is a myosin IIA heavy chain that contains an IQ domain and a myosin head-like domain which is involved in several important functions, including cytokinesis, cell motility and maintenance of cell shape. Defects in this gene have been associated with non-syndromic sensorineural deafness autosomal dominant type 17, Epstein syndrome, Alport syndrome with macrothrombocytopenia, Sebastian syndrome, Fechtner syndrome and macrothrombocytopenia with progressive sensorineural deafness.

Rat MYH9 shRNA Plasmid
20-abx985273	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human MYH9 ELISA Kit
ELA-E0237h	Lifescience Market	96 Tests	EUR 824

MYH9 ELISA KIT|Human
EF000516	Lifescience Market	96 Tests	EUR 689

Human MYH9 shRNA Plasmid
20-abx953054	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse MYH9 shRNA Plasmid
20-abx971649	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human Myosin-9 (MYH9)
1-CSB-RP014054h	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 54.2 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Myosin-9(MYH9) ,partial expressed in E.coli

Monoclonal MYH9 Antibody (clone 2B3), Clone: 2B3
APR17494G	Leading Biology	0.05mg	EUR 528
Description: A Monoclonal antibody against Human MYH9 (clone 2B3). The antibodies are raised in Mouse and are from clone 2B3. This antibody is applicable in WB and IHC-P, IF, E

Monoclonal MYH9 Antibody (clone 4H3), Clone: 4H3
APR17495G	Leading Biology	0.05mg	EUR 528
Description: A Monoclonal antibody against Human MYH9 (clone 4H3). The antibodies are raised in Mouse and are from clone 4H3. This antibody is applicable in WB and IHC-P, IF, E

Monoclonal MYH9 Antibody (monoclonal) (M05), Clone: 1H6
APR17496G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human MYH9 (monoclonal) (M05). The antibodies are raised in mouse and are from clone 1H6. This antibody is applicable in WB and IF, E

Monoclonal MYH9 Antibody (monoclonal) (M06), Clone: 4H3
APR17497G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human MYH9 (monoclonal) (M06). The antibodies are raised in mouse and are from clone 4H3. This antibody is applicable in WB, IHC and IF, E

Rabbit Myosin Heavy Chain 9, Non Muscle (MYH9) ELISA Kit
abx363683-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

MYH9 ORF Vector (Human) (pORF)
ORF006827	ABM	1.0 ug DNA	EUR 95

Myh9 ORF Vector (Mouse) (pORF)
ORF050865	ABM	1.0 ug DNA	EUR 1572

Myh9 ORF Vector (Rat) (pORF)
ORF070986	ABM	1.0 ug DNA	EUR 2080

MYH9 ELISA Kit (Human) (OKAN06605)
OKAN06605	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes a conventional non-muscle myosin; this protein should not be confused with the unconventional myosin-9a or 9b (MYO9A or MYO9B). The encoded protein is a myosin IIA heavy chain that contains an IQ domain and a myosin head-like domain which is involved in several important functions, including cytokinesis, cell motility and maintenance of cell shape. Defects in this gene have been associated with non-syndromic sensorineural deafness autosomal dominant type 17, Epstein syndrome, Alport syndrome with macrothrombocytopenia, Sebastian syndrome, Fechtner syndrome and macrothrombocytopenia with progressive sensorineural deafness.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.057 ng/mL

MYH9 ELISA Kit (Human) (OKCD08480)
OKCD08480	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: MYH9 is a myosin IIA heavy chain that contains an IQ domain and a myosin head-like domain. The protein is involved in several important functions, including cytokinesis, cell motility and maintenance of cell shape. Defects in MYH9 are the cause of non-syndromic sensorineural deafness autosomal dominant type 17, Epstein syndrome, Alport syndrome with macrothrombocytopenia, Sebastian syndrome, Fechtner syndrome and macrothrombocytopenia with progressive sensorineural deafness.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.057ng/mL

MYH9 ELISA Kit (Dog) (OKEH03958)
OKEH03958	Aviva Systems Biology	96 Wells	EUR 844
Description: Description of target: Cellular myosin that appears to play a role in cytokinesis, cell shape, and specialized functions such as secretion and capping. During cell spreading, plays an important role in cytoskeleton reorganization, focal contacts formation (in the margins but not the central part of spreading cells), and lamellipodial retraction; this function is mechanically antagonized by MYH10 (By similarity).;Species reactivity: Dog;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 10.7 pg/mL

MYH9 ELISA Kit (Human) (OKEH04168)
OKEH04168	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: This gene encodes a conventional non-muscle myosin; this protein should not be confused with the unconventional myosin-9a or 9b (MYO9A or MYO9B). The encoded protein is a myosin IIA heavy chain that contains an IQ domain and a myosin head-like domain which is involved in several important functions, including cytokinesis, cell motility and maintenance of cell shape. Defects in this gene have been associated with non-syndromic sensorineural deafness autosomal dominant type 17, Epstein syndrome, Alport syndrome with macrothrombocytopenia, Sebastian syndrome, Fechtner syndrome and macrothrombocytopenia with progressive sensorineural deafness.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 10 pg/mL

MYH9 ELISA Kit (Mouse) (OKEH05897)
OKEH05897	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: During cell spreading, plays an important role in cytoskeleton reorganization, focal contacts formation (in the margins but not the central part of spreading cells), and lamellipodial retraction; this function is mechanically antagonized by MYH10. Cellular myosin that appears to play a role in cytokinesis, cell shape, and specialized functions such as secretion and capping.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.68 pg/mL

MYH9 ELISA Kit (Rat) (OKEH06324)
OKEH06324	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: During cell spreading, plays an important role in cytoskeleton reorganization, focal contacts formation (in the margins but not the central part of spreading cells), and lamellipodial retraction; this function is mechanically antagonized by MYH10. Cellular myosin that appears to play a role in cytokinesis, cell shape, and specialized functions such as secretion and capping.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.6 pg/mL

Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody
20-abx113947	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody
20-abx110021	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody
20-abx000580	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody
abx030030-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody
abx030030-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody
20-abx173685	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody
20-abx177681	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody
20-abx217007	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody
abx433004-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody
abx235479-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Myosin Heavy Chain 9, Non Muscle (Myh9) Antibody
abx235480-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Myosin Heavy Chain 9, Non Muscle (Myh9) Antibody
abx235481-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody
abx235482-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Human MYH9/ Myosin-9 ELISA Kit
E1692Hu	Sunlong	1 Kit	EUR 571

Human MYH9(Myosin-9) ELISA Kit
EH0791	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: P35579 Alias: MYH9(Myosin Heavy Chain 9, Non Muscle)/MHA/FTNS/EPSTS/Myosin-9/Non-muscle myosin heavy chain Iia/Myosin heavy chain 9/Myosin heavy chain, non-muscle Iia
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Dog MYH9/ Myosin-9 ELISA Kit
E0077Do	Sunlong	1 Kit	EUR 717

MYH9 sgRNA CRISPR Lentivector set (Human)
K1374501	ABM	3 x 1.0 ug	EUR 339

Myh9 sgRNA CRISPR Lentivector set (Mouse)
K4826201	ABM	3 x 1.0 ug	EUR 339

Myh9 sgRNA CRISPR Lentivector set (Rat)
K6807801	ABM	3 x 1.0 ug	EUR 339

pcDNA3.1(+)-MYH9(83-764aa)-HA Plasmid
PVTB00946-2a	Lifescience Market	2 ug	EUR 356

Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody Pair
abx117448-1pair5x96wellplates	Abbexa	1 pair (5x96 well plates)	EUR 1010
Shipped within 5-10 working days.

Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody (HRP)
20-abx108530	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody (Biotin)
20-abx105692	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody (FITC)
20-abx107109	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

MYH9 sgRNA CRISPR Lentivector (Human) (Target 1)
K1374502	ABM	1.0 ug DNA	EUR 154

MYH9 sgRNA CRISPR Lentivector (Human) (Target 2)
K1374503	ABM	1.0 ug DNA	EUR 154

MYH9 sgRNA CRISPR Lentivector (Human) (Target 3)
K1374504	ABM	1.0 ug DNA	EUR 154

Myh9 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4826202	ABM	1.0 ug DNA	EUR 154

Myh9 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4826203	ABM	1.0 ug DNA	EUR 154

Myh9 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4826204	ABM	1.0 ug DNA	EUR 154

Myh9 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6807802	ABM	1.0 ug DNA	EUR 154

Myh9 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6807803	ABM	1.0 ug DNA	EUR 154

Myh9 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6807804	ABM	1.0 ug DNA	EUR 154

MYH9 Protein Vector (Rat) (pPB-C-His)
PV283942	ABM	500 ng	EUR 3240

MYH9 Protein Vector (Rat) (pPB-N-His)
PV283943	ABM	500 ng	EUR 3240

MYH9 Protein Vector (Rat) (pPM-C-HA)
PV283944	ABM	500 ng	EUR 3240

MYH9 Protein Vector (Rat) (pPM-C-His)
PV283945	ABM	500 ng	EUR 3240

MYH9 Protein Vector (Human) (pPB-C-His)
PV027305	ABM	500 ng	EUR 329

MYH9 Protein Vector (Human) (pPB-N-His)
PV027306	ABM	500 ng	EUR 329

MYH9 Protein Vector (Human) (pPM-C-HA)
PV027307	ABM	500 ng	EUR 329

MYH9 Protein Vector (Human) (pPM-C-His)
PV027308	ABM	500 ng	EUR 329

MYH9 Protein Vector (Mouse) (pPB-C-His)
PV203458	ABM	500 ng	EUR 3238

MYH9 Protein Vector (Mouse) (pPB-N-His)
PV203459	ABM	500 ng	EUR 3238

MYH9 Protein Vector (Mouse) (pPM-C-HA)
PV203460	ABM	500 ng	EUR 3238

MYH9 Protein Vector (Mouse) (pPM-C-His)
PV203461	ABM	500 ng	EUR 3238

Myh9 3'UTR GFP Stable Cell Line
TU163711	ABM	1.0 ml	Ask for price

Myh9 3'UTR Luciferase Stable Cell Line
TU213631	ABM	1.0 ml	Ask for price

MYH9 3'UTR Luciferase Stable Cell Line
TU015040	ABM	1.0 ml	EUR 1521

Myh9 3'UTR Luciferase Stable Cell Line
TU113711	ABM	1.0 ml	Ask for price

MYH9 3'UTR GFP Stable Cell Line
TU065040	ABM	1.0 ml	EUR 1521

Myh9 3'UTR GFP Stable Cell Line
TU263631	ABM	1.0 ml	Ask for price

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody
ES8576-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody
ES8576-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8578-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8578-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8579-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8579-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody
ES8580-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody
ES8580-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody
ES8582-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody
ES8582-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody
ES8583-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody
ES8583-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody
ABP57458-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody
ABP57463-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody
ABP57569-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JAK1 Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody
ABP57570-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JAK2 Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JNK2 Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK3 Rabbit Polyclonal Antibody
ABP57572-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody
ABP57572-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody
ABP57572-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of JNK3 Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

MEK2 Rabbit Polyclonal Antibody
ABP57573-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody
ABP57573-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody
ABP57573-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of MEK2 Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK3 Rabbit Polyclonal Antibody
ABP57574-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody
ABP57574-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of MEK3 Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MYH9 Rabbit Polyclonal Antibody