BIRC2 Rabbit Polyclonal Antibody
To Order Now: info@poweratlas.org
BIRC2 Polyclonal Antibody |
ABP57901-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human BIRC2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of BIRC2 from Human, Mouse. This BIRC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BIRC2 protein |
BIRC2 Polyclonal Antibody |
ABP57901-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human BIRC2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of BIRC2 from Human, Mouse. This BIRC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BIRC2 protein |
BIRC2 Polyclonal Antibody |
ABP57901-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human BIRC2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of BIRC2 from Human, Mouse. This BIRC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BIRC2 protein |
BIRC2 Rabbit pAb |
A0866-100ul |
Abclonal |
100 ul |
EUR 308 |
BIRC2 Rabbit pAb |
A0866-200ul |
Abclonal |
200 ul |
EUR 459 |
BIRC2 Rabbit pAb |
A0866-20ul |
Abclonal |
20 ul |
EUR 183 |
BIRC2 Rabbit pAb |
A0866-50ul |
Abclonal |
50 ul |
EUR 223 |
BIRC2 Rabbit pAb |
A0985-100ul |
Abclonal |
100 ul |
EUR 308 |
BIRC2 Rabbit pAb |
A0985-200ul |
Abclonal |
200 ul |
EUR 459 |
BIRC2 Rabbit pAb |
A0985-20ul |
Abclonal |
20 ul |
EUR 183 |
BIRC2 Rabbit pAb |
A0985-50ul |
Abclonal |
50 ul |
EUR 223 |
BIRC2 Rabbit mAb |
A19688-100ul |
Abclonal |
100 ul |
EUR 410 |
BIRC2 Rabbit mAb |
A19688-200ul |
Abclonal |
200 ul |
EUR 571 |
BIRC2 Rabbit mAb |
A19688-20ul |
Abclonal |
20 ul |
EUR 221 |
BIRC2 Rabbit mAb |
A19688-50ul |
Abclonal |
50 ul |
EUR 287 |
BIRC2 antibody |
10R-10665 |
Fitzgerald |
100 ug |
EUR 381 |
Description: Mouse monoclonal BIRC2 antibody |
BIRC2 Antibody |
32110-100ul |
SAB |
100ul |
EUR 252 |
BIRC2 antibody |
70R-15999 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal BIRC2 antibody |
BIRC2 Antibody |
DF6167 |
Affbiotech |
200ul |
EUR 304 |
Description: BIRC2 Antibody detects endogenous levels of total BIRC2. |
BIRC2 Antibody |
1-CSB-PA002703GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
BIRC2 Antibody |
1-CSB-PA830383 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100 |
BIRC2 Antibody |
1-CSB-PA618777EA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000 |
BIRC2 Antibody |
1-CSB-PA618777ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200 |
BIRC2 Antibody |
1-CSB-PA191509 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000 |
BIRC2 Conjugated Antibody |
C32110 |
SAB |
100ul |
EUR 397 |
Anti-BIRC2 antibody |
STJ22800 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a member of a family of proteins that inhibits apoptosis by binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2, probably by interfering with activation of ICE-like proteases. This encoded protein inhibits apoptosis induced by serum deprivation and menadione, a potent inducer of free radicals. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. |
Anti-BIRC2 antibody |
STJ114903 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a member of a family of proteins that inhibits apoptosis by binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2, probably by interfering with activation of ICE-like proteases. This encoded protein inhibits apoptosis induced by serum deprivation and menadione, a potent inducer of free radicals. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. |
Anti-BIRC2 antibody |
STJ193113 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to BIRC2 |
BIRC2 siRNA |
20-abx909114 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
BIRC2 siRNA |
20-abx909115 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Anti-cIAP1/BIRC2 Antibody |
A01700-1 |
BosterBio |
100ug/vial |
EUR 334 |
BIRC2 recombinant monoclonal antibody |
A5797 |
Bimake |
100ul X 3 |
EUR 595 |
- Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
- Show more
|
Description: A recombinant monoclonal antibody from rabbit against human BIRC2 for WB,ELISA |
BIRC2 Antibody, HRP conjugated |
1-CSB-PA618777EB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
BIRC2 Antibody, FITC conjugated |
1-CSB-PA618777EC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
BIRC2 Antibody, Biotin conjugated |
1-CSB-PA618777ED01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Anti-BIRC2 Monoclonal Antibody |
M01700 |
BosterBio |
100ug |
EUR 397 |
Description: Rabbit Monoclonal BIRC2 Antibody. Validated in IF, WB and tested in Human. |
BIRC2 cloning plasmid |
CSB-CL618777HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1857
- Sequence: atgcacaaaactgcctcccaaagacttttcccaggtccctcgtatcaaaacattaagagtataatggaagatagcacgatcttgtcagattggacaaacagcaacaaacaaaaaatgaagtatgacttttcctgtgaactctacagaatgtctacatattcaactttccccgccg
- Show more
|
Description: A cloning plasmid for the BIRC2 gene. |
BIRC2 Rabbit Polyclonal Antibody