BIRC2 Rabbit Polyclonal Antibody

BIRC2 Rabbit Polyclonal Antibody

To Order Now:

BIRC2 Polyclonal Antibody

ABP57901-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human BIRC2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of BIRC2 from Human, Mouse. This BIRC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BIRC2 protein

BIRC2 Polyclonal Antibody

ABP57901-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human BIRC2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of BIRC2 from Human, Mouse. This BIRC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BIRC2 protein

BIRC2 Polyclonal Antibody

ABP57901-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human BIRC2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of BIRC2 from Human, Mouse. This BIRC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BIRC2 protein

BIRC2 Rabbit pAb

A0866-100ul 100 ul
EUR 308

BIRC2 Rabbit pAb

A0866-200ul 200 ul
EUR 459

BIRC2 Rabbit pAb

A0866-20ul 20 ul
EUR 183

BIRC2 Rabbit pAb

A0866-50ul 50 ul
EUR 223

BIRC2 Rabbit pAb

A0985-100ul 100 ul
EUR 308

BIRC2 Rabbit pAb

A0985-200ul 200 ul
EUR 459

BIRC2 Rabbit pAb

A0985-20ul 20 ul
EUR 183

BIRC2 Rabbit pAb

A0985-50ul 50 ul
EUR 223

BIRC2 Rabbit mAb

A19688-100ul 100 ul
EUR 410

BIRC2 Rabbit mAb

A19688-200ul 200 ul
EUR 571

BIRC2 Rabbit mAb

A19688-20ul 20 ul
EUR 221

BIRC2 Rabbit mAb

A19688-50ul 50 ul
EUR 287

BIRC2 Antibody

ABD6167 100 ug
EUR 438

BIRC2 antibody

10R-10665 100 ug
EUR 381
Description: Mouse monoclonal BIRC2 antibody

BIRC2 Antibody

32110-100ul 100ul
EUR 252

BIRC2 antibody

70R-15999 50 ul
EUR 435
Description: Rabbit polyclonal BIRC2 antibody

BIRC2 Antibody

DF6167 200ul
EUR 304
Description: BIRC2 Antibody detects endogenous levels of total BIRC2.

BIRC2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

BIRC2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

BIRC2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

BIRC2 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200

BIRC2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

BIRC2 Conjugated Antibody

C32110 100ul
EUR 397

Anti-BIRC2 antibody

STJ22800 100 µl
EUR 277
Description: The protein encoded by this gene is a member of a family of proteins that inhibits apoptosis by binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2, probably by interfering with activation of ICE-like proteases. This encoded protein inhibits apoptosis induced by serum deprivation and menadione, a potent inducer of free radicals. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-BIRC2 antibody

STJ114903 100 µl
EUR 277
Description: The protein encoded by this gene is a member of a family of proteins that inhibits apoptosis by binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2, probably by interfering with activation of ICE-like proteases. This encoded protein inhibits apoptosis induced by serum deprivation and menadione, a potent inducer of free radicals. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-BIRC2 antibody

STJ193113 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to BIRC2


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Anti-cIAP1/BIRC2 Antibody

A01700-1 100ug/vial
EUR 334

BIRC2 recombinant monoclonal antibody

A5797 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human BIRC2 for WB,ELISA

BIRC2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

BIRC2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

BIRC2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-BIRC2 Monoclonal Antibody

M01700 100ug
EUR 397
Description: Rabbit Monoclonal BIRC2 Antibody. Validated in IF, WB and tested in Human.

BIRC2 cloning plasmid

CSB-CL618777HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1857
  • Sequence: atgcacaaaactgcctcccaaagacttttcccaggtccctcgtatcaaaacattaagagtataatggaagatagcacgatcttgtcagattggacaaacagcaacaaacaaaaaatgaagtatgacttttcctgtgaactctacagaatgtctacatattcaactttccccgccg
  • Show more
Description: A cloning plasmid for the BIRC2 gene.

BIRC2 Rabbit Polyclonal Antibody