ILF2 Rabbit Polyclonal Antibody

ILF2 Rabbit Polyclonal Antibody

To Order Now:

ILF2 Polyclonal Antibody

ABP58929-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ILF2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ILF2 from Human, Mouse, Rat. This ILF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ILF2 protein

ILF2 Polyclonal Antibody

ES11916-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ILF2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

ILF2 Polyclonal Antibody

ES11916-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ILF2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

ILF2 Rabbit pAb

A13320-100ul 100 ul
EUR 308

ILF2 Rabbit pAb

A13320-200ul 200 ul
EUR 459

ILF2 Rabbit pAb

A13320-20ul 20 ul
EUR 183

ILF2 Rabbit pAb

A13320-50ul 50 ul
EUR 223

ILF2 Rabbit pAb

A5882-100ul 100 ul
EUR 308

ILF2 Rabbit pAb

A5882-200ul 200 ul
EUR 459

ILF2 Rabbit pAb

A5882-20ul 20 ul
EUR 183

ILF2 Rabbit pAb

A5882-50ul 50 ul
EUR 223

ILF2 antibody

38706-100ul 100ul
EUR 252

ILF2 antibody

10R-3123 100 ug
EUR 407
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MAGEB2 antibody, catalog no. 70R-4320

ILF2 antibody

10R-4467 100 ul
EUR 726
Description: Mouse monoclonal ILF2 antibody

ILF2 Antibody

49780-100ul 100ul
EUR 333

ILF2 Antibody

49780-50ul 50ul
EUR 239

ILF2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ILF2. Recognizes ILF2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

ILF2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ILF2. Recognizes ILF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

ILF2 Polyclonal Antibody, Biotin Conjugated

A52709 100 µg
EUR 570.55
Description: reagents widely cited

ILF2 Polyclonal Antibody, FITC Conjugated

A52710 100 µg
EUR 570.55
Description: Ask the seller for details

ILF2 Polyclonal Antibody, HRP Conjugated

A52711 100 µg
EUR 570.55
Description: The best epigenetics products

ILF2 antibody (HRP)

60R-1363 100 ug
EUR 327
Description: Rabbit polyclonal ILF2 antibody (HRP)

ILF2 antibody (FITC)

60R-1364 100 ug
EUR 327
Description: Rabbit polyclonal ILF2 antibody (FITC)

ILF2 antibody (biotin)

60R-1365 100 ug
EUR 327
Description: Rabbit polyclonal ILF2 antibody (biotin)

ILF2 Conjugated Antibody

C49780 100ul
EUR 397

ILF2 Conjugated Antibody

C38706 100ul
EUR 397

ILF2 Antibody (Biotin)

abx430158-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Anti-ILF2 antibody

STJ28155 100 µl
EUR 277
Description: The protein encoded by this gene is a transcription factor required for T-cell expression of the interleukin 2 gene. It also binds RNA and is an essential component for encapsidation and protein priming of hepatitis B viral polymerase. The encoded 45 kDa protein (NF45, ILF2) forms a complex with the 90 kDa interleukin enhancer-binding factor 3 (NF90, ILF3), and this complex has been shown to affect the redistribution of nuclear mRNA to the cytoplasm, to repair DNA breaks by nonhomologous end joining, and to negatively regulate the microRNA processing pathway. Knockdown of NF45 or NF90 protein retards cell growth, possibly by inhibition of mRNA stabilization. Alternative splicing results in multiple transcript variants. Related pseudogenes have been found on chromosomes 3 and 14.

Anti-ILF2 antibody

STJ115284 100 µl
EUR 277
Description: The protein encoded by this gene is a transcription factor required for T-cell expression of the interleukin 2 gene. It also binds RNA and is an essential component for encapsidation and protein priming of hepatitis B viral polymerase. The encoded 45 kDa protein (NF45, ILF2) forms a complex with the 90 kDa interleukin enhancer-binding factor 3 (NF90, ILF3), and this complex has been shown to affect the redistribution of nuclear mRNA to the cytoplasm, to repair DNA breaks by nonhomologous end joining, and to negatively regulate the microRNA processing pathway. Knockdown of NF45 or NF90 protein retards cell growth, possibly by inhibition of mRNA stabilization. Alternative splicing results in multiple transcript variants. Related pseudogenes have been found on chromosomes 3 and 14.

Anti-ILF2 antibody

STJ193074 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ILF2


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


PVT18443 2 ug
EUR 231


YF-PA12726 50 ug
EUR 363
Description: Mouse polyclonal to ILF2


YF-PA12727 100 ul
EUR 403
Description: Rabbit polyclonal to ILF2


YF-PA23991 50 ul
EUR 334
Description: Mouse polyclonal to ILF2

ILF2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ILF2. Recognizes ILF2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ILF2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ILF2. Recognizes ILF2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ILF2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ILF2. Recognizes ILF2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-ILF2 / NF45 antibody

STJ71178 100 µg
EUR 359

ILF2 cloning plasmid

CSB-CL614262HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1173
  • Sequence: atgaggggtgacagaggccgtggtcgtggtgggcgctttggttccagaggaggcccaggaggagggttcaggccctttgtaccacatatcccatttgacttctatttgtgtgaaatggcctttccccgggtcaagccagcacctgatgaaacttccttcagtgaggccttgctga
  • Show more
Description: A cloning plasmid for the ILF2 gene.

pDONR223-ILF2 Plasmid

PVTB01057-1 2 ug
EUR 356

pENTR223-ILF2 vector

PVT12024 2 ug
EUR 308

Anti-ILF2 (1E2)

YF-MA13805 100 ug
EUR 363
Description: Mouse monoclonal to ILF2

Anti-ILF2 / NF45, Biotinylated antibody

STJ73229 100 µg
EUR 359


EF008488 96 Tests
EUR 689

Rat ILF2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ILF2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ILF2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Interleukin Enhancer-Binding Factor 2 (ILF2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Interleukin Enhancer-Binding Factor 2 (ILF2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Interleukin Enhancer-Binding Factor 2 (ILF2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Interleukin Enhancer-Binding Factor 2 (ILF2) Antibody

abx031364-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Interleukin Enhancer-Binding Factor 2 (ILF2) Antibody

abx031364-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Interleukin Enhancer-Binding Factor 2 (ILF2) Antibody

abx430157-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Ilf2 ORF Vector (Rat) (pORF)

ORF068654 1.0 ug DNA
EUR 506

ILF2 ORF Vector (Human) (pORF)

ORF005362 1.0 ug DNA
EUR 95

Ilf2 ORF Vector (Mouse) (pORF)

ORF047903 1.0 ug DNA
EUR 506

ILF2 Western Blot kit (AWBK35731)

AWBK35731 10 reactions
EUR 647
  • Description of target:
  • Species reactivity:
  • Application:
  • Assay info:
  • Sensitivity:

ILF2 ELISA Kit (Human) (OKEH08335)

OKEH08335 96 Wells
EUR 896
Description: Description of target: The protein encoded by this gene is a transcription factor required for T-cell expression of the interleukin 2 gene. It also binds RNA and is an essential component for encapsidation and protein priming of hepatitis B viral polymerase. The encoded 45 kDa protein (NF45, ILF2) forms a complex with the 90 kDa interleukin enhancer-binding factor 3 (NF90, ILF3), and this complex has been shown to affect the redistribution of nuclear mRNA to the cytoplasm, to repair DNA breaks by nonhomologous end joining, and to negatively regulate the microRNA processing pathway. Knockdown of NF45 or NF90 protein retards cell growth, possibly by inhibition of mRNA stabilization. Alternative splicing results in multiple transcript variants. Related pseudogenes have been found on chromosomes 3 and 14.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.085ng/mL

Interleukin Enhancer-Binding Factor 2 (ILF2) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Interleukin Enhancer-Binding Factor 2 (ILF2) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Interleukin Enhancer-Binding Factor 2 (ILF2) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Interleukin Enhancer-Binding Factor 2 (ILF2) Antibody Pair

abx117313-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.

Ilf2 sgRNA CRISPR Lentivector set (Mouse)

K5013101 3 x 1.0 ug
EUR 339

Ilf2 sgRNA CRISPR Lentivector set (Rat)

K6354201 3 x 1.0 ug
EUR 339

ILF2 sgRNA CRISPR Lentivector set (Human)

K1084001 3 x 1.0 ug
EUR 339

Human Interleukin enhancer-binding factor 2 (ILF2)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 70.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Interleukin enhancer-binding factor 2(ILF2) expressed in E.coli

Ilf2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K5013102 1.0 ug DNA
EUR 154

Ilf2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K5013103 1.0 ug DNA
EUR 154

Ilf2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K5013104 1.0 ug DNA
EUR 154

Ilf2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6354202 1.0 ug DNA
EUR 154

Ilf2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6354203 1.0 ug DNA
EUR 154

Ilf2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6354204 1.0 ug DNA
EUR 154

ILF2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1084002 1.0 ug DNA
EUR 154

ILF2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1084003 1.0 ug DNA
EUR 154

ILF2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1084004 1.0 ug DNA
EUR 154

ILF2 Protein Vector (Human) (pPB-C-His)

PV021445 500 ng
EUR 329

ILF2 Protein Vector (Human) (pPB-N-His)

PV021446 500 ng
EUR 329

ILF2 Protein Vector (Human) (pPM-C-HA)

PV021447 500 ng
EUR 329

ILF2 Protein Vector (Human) (pPM-C-His)

PV021448 500 ng
EUR 329

ILF2 Protein Vector (Rat) (pPB-C-His)

PV274614 500 ng
EUR 603

ILF2 Protein Vector (Rat) (pPB-N-His)

PV274615 500 ng
EUR 603

ILF2 Protein Vector (Rat) (pPM-C-HA)

PV274616 500 ng
EUR 603

ILF2 Protein Vector (Rat) (pPM-C-His)

PV274617 500 ng
EUR 603

ILF2 Protein Vector (Mouse) (pPB-C-His)

PV191610 500 ng
EUR 603

ILF2 Protein Vector (Mouse) (pPB-N-His)

PV191611 500 ng
EUR 603

ILF2 Protein Vector (Mouse) (pPM-C-HA)

PV191612 500 ng
EUR 603

ILF2 Protein Vector (Mouse) (pPM-C-His)

PV191613 500 ng
EUR 603

Ilf2 3'UTR Luciferase Stable Cell Line

TU110092 1.0 ml Ask for price

Ilf2 3'UTR GFP Stable Cell Line

TU160092 1.0 ml Ask for price

Ilf2 3'UTR Luciferase Stable Cell Line

TU206268 1.0 ml Ask for price

Ilf2 3'UTR GFP Stable Cell Line

TU256268 1.0 ml Ask for price

ILF2 3'UTR GFP Stable Cell Line

TU061116 1.0 ml
EUR 4617

ILF2 3'UTR Luciferase Stable Cell Line

TU011116 1.0 ml
EUR 4617

ILF2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV682225 1.0 ug DNA
EUR 682

ILF2 Rabbit Polyclonal Antibody