IDH3B Rabbit Polyclonal Antibody

IDH3B Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

IDH3B Polyclonal Antibody

ES11913-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IDH3B from Human/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

IDH3B Polyclonal Antibody

ES11913-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IDH3B from Human/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

IDH3B Rabbit pAb

A13742-100ul 100 ul
EUR 308

IDH3B Rabbit pAb

A13742-200ul 200 ul
EUR 459

IDH3B Rabbit pAb

A13742-20ul 20 ul
EUR 183

IDH3B Rabbit pAb

A13742-50ul 50 ul
EUR 223

IDH3B Antibody

36157-100ul 100ul
EUR 252

IDH3B Antibody

1-CSB-PA05515A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IDH3B. Recognizes IDH3B from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

IDH3B Antibody

1-CSB-PA114986
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against IDH3B. Recognizes IDH3B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

IDH3B Antibody

1-CSB-PA597290
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against IDH3B. Recognizes IDH3B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

IDH3B Antibody

DF8562 200ul
EUR 304
Description: IDH3B Antibody detects endogenous levels of total IDH3B.

IDH3B Antibody

ABD8562 100 ug
EUR 438

Polyclonal IDH3B Antibody (N-term)

APR07935G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IDH3B (N-term). This antibody is tested and proven to work in the following applications:

IDH3B Polyclonal Antibody, Biotin Conjugated

A53683 100 µg
EUR 570.55
Description: Ask the seller for details

IDH3B Polyclonal Antibody, FITC Conjugated

A53684 100 µg
EUR 570.55
Description: The best epigenetics products

IDH3B Polyclonal Antibody, HRP Conjugated

A53685 100 µg
EUR 570.55
Description: kits suitable for this type of research

Polyclonal IDH3B Antibody - N-terminal region

APR07936G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IDH3B - N-terminal region. This antibody is tested and proven to work in the following applications:

IDH3B Antibody (Biotin)

20-abx106325
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

IDH3B Antibody (FITC)

20-abx107738
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

IDH3B Antibody (HRP)

20-abx109156
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

IDH3B Conjugated Antibody

C36157 100ul
EUR 397

Anti-IDH3B antibody

STJ115693 100 µl
EUR 277
Description: Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. NAD(+)-dependent isocitrate dehydrogenases catalyze the allosterically regulated rate-limiting step of the tricarboxylic acid cycle. Each isozyme is a heterotetramer that is composed of two alpha subunits, one beta subunit, and one gamma subunit. The protein encoded by this gene is the beta subunit of one isozyme of NAD(+)-dependent isocitrate dehydrogenase. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene.

Anti-IDH3B antibody

STJ193071 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to IDH3B

Idh3B/ Rat Idh3B ELISA Kit

ELI-43372r 96 Tests
EUR 886

Polyclonal IDH3B (aa369-383) Antibody (C-Term)

APR07933G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human IDH3B (aa369-383) (C-Term). This antibody is tested and proven to work in the following applications:

IDH3B siRNA

20-abx920145
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IDH3B siRNA

20-abx920146
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-IDH3B

YF-PA12530 100 ug
EUR 403
Description: Rabbit polyclonal to IDH3B

IDH3B Antibody, HRP conjugated

1-CSB-PA05515B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IDH3B. Recognizes IDH3B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

IDH3B Antibody, FITC conjugated

1-CSB-PA05515C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IDH3B. Recognizes IDH3B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

IDH3B Antibody, Biotin conjugated

1-CSB-PA05515D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IDH3B. Recognizes IDH3B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Isocitrate dehydrogenase 3 (NAD+) beta (IDH3B) polyclonal antibody

ABP-PAB-01173 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:

IDH3B Blocking Peptide

DF8562-BP 1mg
EUR 195

IDH3B cloning plasmid

CSB-CL010992HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1158
  • Sequence: atggcggcattgagcggagtccgctggctgacccgagcgctggtctccgccgggaaccctggggcatggagaggtctgagtacctcggccgcggcgcacgctgcatcgcggagccaggccgaggacgtgagggtggagggctcctttcccgtgaccatgcttccgggagacggtg
  • Show more
Description: A cloning plasmid for the IDH3B gene.

Anti-IDH3B (3A10)

YF-MA13644 100 ug
EUR 363
Description: Mouse monoclonal to IDH3B

Anti-IDH3B (aa369-383) antibody

STJ72609 100 µg
EUR 359

Anti-IDH3B (aa33-46) antibody

STJ72610 100 µg
EUR 359

Human IDH3B ELISA KIT

ELI-43832h 96 Tests
EUR 824

Rat IDH3B shRNA Plasmid

20-abx987077
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human IDH3B shRNA Plasmid

20-abx952315
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Bovine IDH3B ELISA KIT

ELI-39261b 96 Tests
EUR 928

IDH3B Recombinant Protein (Human)

RP015544 100 ug Ask for price

IDH3B Recombinant Protein (Rat)

RP205454 100 ug Ask for price

IDH3B Recombinant Protein (Mouse)

RP142901 100 ug Ask for price

Polyclonal IDH3B (aa33-46) Antibody (internal region, near N-Term)

APR07932G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human IDH3B (aa33-46) (internal region, near N-Term). This antibody is tested and proven to work in the following applications:

Isocitrate Dehydrogenase 3 (NAD(+)) Beta (IDH3B) Antibody

20-abx214033
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Isocitrate Dehydrogenase 3 (NAD(+)) Beta (IDH3B) Antibody

20-abx214034
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Isocitrate Dehydrogenase 3 (NAD(+)) Beta (IDH3B) Antibody

20-abx110597
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Isocitrate Dehydrogenase 3 (NAD(+)) Beta (IDH3B) Antibody

abx036108-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Monoclonal IDH3B Antibody (monoclonal) (M01), Clone: 3A10

APR07934G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human IDH3B (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3A10. This antibody is applicable in E

Isocitrate Dehydrogenase 3 (NAD(+)) Beta (IDH3B) Antibody

abx431403-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Isocitrate Dehydrogenase 3 (NAD(+)) Beta (IDH3B) Antibody

abx431404-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Idh3B ORF Vector (Rat) (pORF)

ORF068486 1.0 ug DNA
EUR 506

IDH3B ORF Vector (Human) (pORF)

ORF005182 1.0 ug DNA
EUR 95

Idh3b ORF Vector (Mouse) (pORF)

ORF047635 1.0 ug DNA
EUR 506

Rabbit Isocite dehydrogenase [NAD] subunit β, mitochondrial(IDH3B) ELISA kit

E04I0425-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Isocite dehydrogenase [NAD] subunit β, mitochondrial(IDH3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Isocite dehydrogenase [NAD] subunit β, mitochondrial(IDH3B) ELISA kit

E04I0425-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Isocite dehydrogenase [NAD] subunit β, mitochondrial(IDH3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Isocite dehydrogenase [NAD] subunit β, mitochondrial(IDH3B) ELISA kit

E04I0425-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Isocite dehydrogenase [NAD] subunit β, mitochondrial(IDH3B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Idh3B sgRNA CRISPR Lentivector set (Rat)

K7043801 3 x 1.0 ug
EUR 339

Idh3b sgRNA CRISPR Lentivector set (Mouse)

K3035201 3 x 1.0 ug
EUR 339

IDH3B sgRNA CRISPR Lentivector set (Human)

K1014901 3 x 1.0 ug
EUR 339

Idh3B sgRNA CRISPR Lentivector (Rat) (Target 1)

K7043802 1.0 ug DNA
EUR 154

Idh3B sgRNA CRISPR Lentivector (Rat) (Target 2)

K7043803 1.0 ug DNA
EUR 154

Idh3B sgRNA CRISPR Lentivector (Rat) (Target 3)

K7043804 1.0 ug DNA
EUR 154

Idh3b sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3035202 1.0 ug DNA
EUR 154

Idh3b sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3035203 1.0 ug DNA
EUR 154

Idh3b sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3035204 1.0 ug DNA
EUR 154

IDH3B sgRNA CRISPR Lentivector (Human) (Target 1)

K1014902 1.0 ug DNA
EUR 154

IDH3B sgRNA CRISPR Lentivector (Human) (Target 2)

K1014903 1.0 ug DNA
EUR 154

IDH3B sgRNA CRISPR Lentivector (Human) (Target 3)

K1014904 1.0 ug DNA
EUR 154

IDH3B Protein Vector (Human) (pPB-C-His)

PV020725 500 ng
EUR 329

IDH3B Protein Vector (Human) (pPB-N-His)

PV020726 500 ng
EUR 329

IDH3B Protein Vector (Human) (pPM-C-HA)

PV020727 500 ng
EUR 329

IDH3B Protein Vector (Human) (pPM-C-His)

PV020728 500 ng
EUR 329

IDH3B Protein Vector (Rat) (pPB-C-His)

PV273942 500 ng
EUR 603

IDH3B Protein Vector (Rat) (pPB-N-His)

PV273943 500 ng
EUR 603

IDH3B Protein Vector (Rat) (pPM-C-HA)

PV273944 500 ng
EUR 603

IDH3B Protein Vector (Rat) (pPM-C-His)

PV273945 500 ng
EUR 603

IDH3B Protein Vector (Mouse) (pPB-C-His)

PV190538 500 ng
EUR 603

IDH3B Protein Vector (Mouse) (pPB-N-His)

PV190539 500 ng
EUR 603

IDH3B Protein Vector (Mouse) (pPM-C-HA)

PV190540 500 ng
EUR 603

IDH3B Protein Vector (Mouse) (pPM-C-His)

PV190541 500 ng
EUR 603

Recombinant Human IDH3B Protein, GST, E.coli-100ug

QP6193-ec-100ug 100ug
EUR 408

Recombinant Human IDH3B Protein, GST, E.coli-10ug

QP6193-ec-10ug 10ug
EUR 200

Recombinant Human IDH3B Protein, GST, E.coli-1mg

QP6193-ec-1mg 1mg
EUR 1632

Recombinant Human IDH3B Protein, GST, E.coli-200ug

QP6193-ec-200ug 200ug
EUR 634

Recombinant Human IDH3B Protein, GST, E.coli-500ug

QP6193-ec-500ug 500ug
EUR 1060

Recombinant Human IDH3B Protein, GST, E.coli-50ug

QP6193-ec-50ug 50ug
EUR 263

Idh3b 3'UTR Luciferase Stable Cell Line

TU109882 1.0 ml Ask for price

Idh3B 3'UTR Luciferase Stable Cell Line

TU206085 1.0 ml Ask for price

Idh3b 3'UTR GFP Stable Cell Line

TU159882 1.0 ml Ask for price

Idh3B 3'UTR GFP Stable Cell Line

TU256085 1.0 ml Ask for price

IDH3B 3'UTR GFP Stable Cell Line

TU060426 1.0 ml
EUR 1394

IDH3B 3'UTR Luciferase Stable Cell Line

TU010426 1.0 ml
EUR 1394

Human Isocitrate dehydrogenase [NAD] subunit beta, mitochondrial (IDH3B)

1-CSB-EP010992HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 65.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Isocitrate dehydrogenase [NAD] subunit beta, mitochondrial(IDH3B) expressed in E.coli

IDH3B Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV675115 1.0 ug DNA
EUR 682

IDH3B Rabbit Polyclonal Antibody