IDH3G Rabbit Polyclonal Antibody

IDH3G Rabbit Polyclonal Antibody

To Order Now:

IDH3G Polyclonal Antibody
ABP58866-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human IDH3G protein
  • Applications tips:
Description: A polyclonal antibody for detection of IDH3G from Human . This IDH3G antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IDH3G protein
IDH3G Polyclonal Antibody
ABP58866-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human IDH3G protein
  • Applications tips:
Description: A polyclonal antibody for detection of IDH3G from Human . This IDH3G antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IDH3G protein
IDH3G Polyclonal Antibody
ABP58866-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human IDH3G protein
  • Applications tips:
Description: A polyclonal antibody for detection of IDH3G from Human . This IDH3G antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IDH3G protein
IDH3G Polyclonal Antibody
ES11914-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IDH3G from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
IDH3G Polyclonal Antibody
ES11914-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IDH3G from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
IDH3G Rabbit pAb
A13745-100ul 100 ul
EUR 308
IDH3G Rabbit pAb
A13745-200ul 200 ul
EUR 459
IDH3G Rabbit pAb
A13745-20ul 20 ul
EUR 183
IDH3G Rabbit pAb
A13745-50ul 50 ul
EUR 223
IDH3G antibody
22354-100ul 100ul
EUR 390
IDH3G antibody
70R-13062 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal IDH3G antibody
IDH3G antibody
70R-13542 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal IDH3G antibody
IDH3G Antibody
36158-100ul 100ul
EUR 252
IDH3G Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against IDH3G. Recognizes IDH3G from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100
IDH3G Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against IDH3G. Recognizes IDH3G from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100
IDH3G Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IDH3G. Recognizes IDH3G from Human. This antibody is Unconjugated. Tested in the following application: ELISA
Polyclonal IDH3G Antibody (C-term)
APR07938G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IDH3G (C-term). This antibody is tested and proven to work in the following applications:
Polyclonal IDH3G Antibody (N-term)
APR07939G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IDH3G (N-term). This antibody is tested and proven to work in the following applications:
IDH3G Polyclonal Antibody, HRP Conjugated
A56027 100 µg
EUR 570.55
Description: fast delivery possible
IDH3G Polyclonal Antibody, FITC Conjugated
A56028 100 µg
EUR 570.55
Description: reagents widely cited
IDH3G Polyclonal Antibody, Biotin Conjugated
A56029 100 µg
EUR 570.55
Description: Ask the seller for details
IDH3G Conjugated Antibody
C36158 100ul
EUR 397
anti- IDH3G antibody
FNab04123 100µg
EUR 548.75
  • Immunogen: isocitrate dehydrogenase 3(NAD+) gamma
  • Uniprot ID: P51553
  • Gene ID: 3421
  • Research Area: Metabolism
Description: Antibody raised against IDH3G
Anti-IDH3G antibody
PAab04123 100 ug
EUR 386
Anti-IDH3G antibody
STJ115696 100 µl
EUR 277
Description: Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. NAD(+)-dependent isocitrate dehydrogenases catalyze the allosterically regulated rate-limiting step of the tricarboxylic acid cycle. Each isozyme is a heterotetramer that is composed of two alpha subunits, one beta subunit, and one gamma subunit. The protein encoded by this gene is the gamma subunit of one isozyme of NAD(+)-dependent isocitrate dehydrogenase. This gene is a candidate gene for periventricular heterotopia. Several alternatively spliced transcript variants of this gene have been described, but only some of their full length natures have been determined.
Anti-IDH3G antibody
STJ193072 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to IDH3G
Polyclonal IDH3G (aa337-350) Antibody (internal region)
APR07937G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human IDH3G (aa337-350) (internal region). This antibody is tested and proven to work in the following applications:
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
YF-PA12532 50 ug
EUR 363
Description: Mouse polyclonal to IDH3G
YF-PA12533 100 ug
EUR 403
Description: Rabbit polyclonal to IDH3G
YF-PA23948 50 ul
EUR 334
Description: Mouse polyclonal to IDH3G
IDH3G Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IDH3G. Recognizes IDH3G from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
IDH3G Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IDH3G. Recognizes IDH3G from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
IDH3G Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IDH3G. Recognizes IDH3G from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
IDH3G cloning plasmid
CSB-CL010993HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1182
  • Sequence: atggcgctgaaggtagcgaccgtcgccggcagcgccgcgaaggcggtgctcgggccagcccttctctgccgtccctgggaggttctaggcgcccacgaggtcccctcgaggaacatcttttcagaacaaacaattcctccgtccgctaagtatggcgggcggcacacggtgacca
  • Show more
Description: A cloning plasmid for the IDH3G gene.
IDH3G cloning plasmid
CSB-CL010993HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1182
  • Sequence: atggcgctgaaggtagcgaccgtcgccggcagcgccgcgaaggcggtgctcgggccagcccttctctgccgtccctgggaggttctaggcgcccacgaggtcccctcgaggaacatcttttcagaacaaacaattcctccgtccgctaagtatggcgggcggcacacggtgacca
  • Show more
Description: A cloning plasmid for the IDH3G gene.
PVT12596 2 ug
EUR 391
Anti-IDH3G (aa337-350) antibody
STJ72611 100 µg
EUR 359
IDH3G protein (His tag)
80R-2066 50 ug
EUR 424
Description: Recombinant human IDH3G protein (His tag)
EF010280 96 Tests
EUR 689
Human IDH3G shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse IDH3G shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
IDH3G Recombinant Protein (Human)
RP015547 100 ug Ask for price
IDH3G Recombinant Protein (Human)
RP015550 100 ug Ask for price
IDH3G Recombinant Protein (Rat)
RP205457 100 ug Ask for price
IDH3G Recombinant Protein (Mouse)
RP142904 100 ug Ask for price
Anti-IDH3G (2A2-1D3)
YF-MA13645 100 ug
EUR 363
Description: Mouse monoclonal to IDH3G
Rabbit Isocite dehydrogenase [NAD] subunit gamma, mitochondrial(IDH3G) ELISA kit
E04I0426-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Isocite dehydrogenase [NAD] subunit gamma, mitochondrial(IDH3G) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Isocite dehydrogenase [NAD] subunit gamma, mitochondrial(IDH3G) ELISA kit
E04I0426-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Isocite dehydrogenase [NAD] subunit gamma, mitochondrial(IDH3G) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Isocite dehydrogenase [NAD] subunit gamma, mitochondrial(IDH3G) ELISA kit
E04I0426-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Isocite dehydrogenase [NAD] subunit gamma, mitochondrial(IDH3G) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Idh3g ORF Vector (Rat) (pORF)
ORF068487 1.0 ug DNA
EUR 506
IDH3G ORF Vector (Human) (pORF)
ORF005183 1.0 ug DNA
EUR 95
IDH3G ORF Vector (Human) (pORF)
ORF005184 1.0 ug DNA
EUR 95
Idh3g ORF Vector (Mouse) (pORF)
ORF047636 1.0 ug DNA
EUR 506
Isocitrate Dehydrogenase [NAD] Subunit Gamma, Mitochondrial (IDH3G) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Isocitrate Dehydrogenase [NAD] Subunit Gamma, Mitochondrial (IDH3G) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Isocitrate Dehydrogenase [NAD] Subunit Gamma, Mitochondrial (IDH3G) Antibody
abx145605-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Isocitrate Dehydrogenase [NAD] Subunit Gamma, Mitochondrial (IDH3G) Antibody
abx034520-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Isocitrate Dehydrogenase [NAD] Subunit Gamma, Mitochondrial (IDH3G) Antibody
abx034520-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Isocitrate Dehydrogenase [NAD] Subunit Gamma, Mitochondrial (IDH3G) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Isocitrate Dehydrogenase [NAD] Subunit Gamma, Mitochondrial (IDH3G) Antibody
abx234123-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Isocitrate Dehydrogenase [NAD] Subunit Gamma, Mitochondrial (IDH3G) Antibody
abx431348-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Idh3g sgRNA CRISPR Lentivector set (Mouse)
K4940501 3 x 1.0 ug
EUR 339
Idh3g sgRNA CRISPR Lentivector set (Rat)
K6801901 3 x 1.0 ug
EUR 339
IDH3G sgRNA CRISPR Lentivector set (Human)
K1015001 3 x 1.0 ug
EUR 339
Isocitrate Dehydrogenase [NAD] Subunit Gamma, Mitochondrial (IDH3G) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Isocitrate Dehydrogenase [NAD] Subunit Gamma, Mitochondrial (IDH3G) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Isocitrate Dehydrogenase [NAD] Subunit Gamma, Mitochondrial (IDH3G) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Idh3g sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4940502 1.0 ug DNA
EUR 154
Idh3g sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4940503 1.0 ug DNA
EUR 154
Idh3g sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4940504 1.0 ug DNA
EUR 154
Idh3g sgRNA CRISPR Lentivector (Rat) (Target 1)
K6801902 1.0 ug DNA
EUR 154
Idh3g sgRNA CRISPR Lentivector (Rat) (Target 2)
K6801903 1.0 ug DNA
EUR 154
Idh3g sgRNA CRISPR Lentivector (Rat) (Target 3)
K6801904 1.0 ug DNA
EUR 154
IDH3G sgRNA CRISPR Lentivector (Human) (Target 1)
K1015002 1.0 ug DNA
EUR 154
IDH3G sgRNA CRISPR Lentivector (Human) (Target 2)
K1015003 1.0 ug DNA
EUR 154
IDH3G sgRNA CRISPR Lentivector (Human) (Target 3)
K1015004 1.0 ug DNA
EUR 154
IDH3G Protein Vector (Human) (pPB-C-His)
PV020729 500 ng
EUR 329
IDH3G Protein Vector (Human) (pPB-N-His)
PV020730 500 ng
EUR 329
IDH3G Protein Vector (Human) (pPM-C-HA)
PV020731 500 ng
EUR 329
IDH3G Protein Vector (Human) (pPM-C-His)
PV020732 500 ng
EUR 329
IDH3G Protein Vector (Human) (pPB-C-His)
PV020733 500 ng
EUR 329
IDH3G Protein Vector (Human) (pPB-N-His)
PV020734 500 ng
EUR 329
IDH3G Protein Vector (Human) (pPM-C-HA)
PV020735 500 ng
EUR 329
IDH3G Protein Vector (Human) (pPM-C-His)
PV020736 500 ng
EUR 329
IDH3G Protein Vector (Rat) (pPB-C-His)
PV273946 500 ng
EUR 603
IDH3G Protein Vector (Rat) (pPB-N-His)
PV273947 500 ng
EUR 603
IDH3G Protein Vector (Rat) (pPM-C-HA)
PV273948 500 ng
EUR 603
IDH3G Protein Vector (Rat) (pPM-C-His)
PV273949 500 ng
EUR 603
IDH3G Protein Vector (Mouse) (pPB-C-His)
PV190542 500 ng
EUR 603
IDH3G Protein Vector (Mouse) (pPB-N-His)
PV190543 500 ng
EUR 603
IDH3G Protein Vector (Mouse) (pPM-C-HA)
PV190544 500 ng
EUR 603
IDH3G Protein Vector (Mouse) (pPM-C-His)
PV190545 500 ng
EUR 603
Recombinant Human IDH3G, His-SUMO, E.coli-100ug
QP6194-ec-100ug 100ug
EUR 408
Recombinant Human IDH3G, His-SUMO, E.coli-10ug
QP6194-ec-10ug 10ug
EUR 200
Recombinant Human IDH3G, His-SUMO, E.coli-1mg
QP6194-ec-1mg 1mg
EUR 1632
Recombinant Human IDH3G, His-SUMO, E.coli-200ug
QP6194-ec-200ug 200ug
EUR 634
Recombinant Human IDH3G, His-SUMO, E.coli-500ug
QP6194-ec-500ug 500ug
EUR 1060

IDH3G Rabbit Polyclonal Antibody