ABI3 Rabbit Polyclonal Antibody

ABI3 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

ABI3 Polyclonal Antibody

ABP57667-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ABI3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ABI3 from Human, Mouse. This ABI3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ABI3 protein

ABI3 Polyclonal Antibody

ABP57667-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ABI3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ABI3 from Human, Mouse. This ABI3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ABI3 protein

ABI3 Polyclonal Antibody

ES11795-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ABI3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

ABI3 Polyclonal Antibody

ES11795-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ABI3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

ABI3 Antibody

1-CSB-PA873732LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ABI3. Recognizes ABI3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

ABI3 Polyclonal Antibody, Biotin Conjugated

A57951 100 µg
EUR 570.55
Description: Ask the seller for details

ABI3 Polyclonal Antibody, FITC Conjugated

A57952 100 µg
EUR 570.55
Description: The best epigenetics products

ABI3 Polyclonal Antibody, HRP Conjugated

A57953 100 µg
EUR 570.55
Description: kits suitable for this type of research

M Abi3 Antibody

abx034928-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

M Abi3 Antibody

abx034928-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Anti-ABI3 antibody

STJ192953 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ABI3

ABI3 Protein

20-abx263309
  • EUR 1609.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 2 µg
  • Shipped within 5-10 working days.

ABI3 siRNA

20-abx906411
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ABI3 siRNA

20-abx906412
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ABI3 Antibody, HRP conjugated

1-CSB-PA873732LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ABI3. Recognizes ABI3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ABI3 Antibody, FITC conjugated

1-CSB-PA873732LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ABI3. Recognizes ABI3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ABI3 Antibody, Biotin conjugated

1-CSB-PA873732LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ABI3. Recognizes ABI3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ABI3 cloning plasmid

CSB-CL873732HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1101
  • Sequence: atggcggagctacagcagctgcaggagtttgagatccccactggccgggaggctctgaggggcaaccacagtgccctgctgcgggtcgctgactactgcgaggacaactatgtgcaggccacagacaagcggaaggcgctggaggagaccatggccttcactacccaggcactgg
  • Show more
Description: A cloning plasmid for the ABI3 gene.

ABI3 protein (His tag)

80R-2485 100 ug
EUR 322
Description: Purified recombinant ABI3 protein (His tag)

Mouse ABI3 shRNA Plasmid

20-abx975698
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ABI3 shRNA Plasmid

20-abx959616
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ABI3 Family, Member 3

PR27188 2 ug
EUR 191

ABI3 Recombinant Protein (Human)

RP000154 100 ug Ask for price

ABI3 Recombinant Protein (Mouse)

RP113516 100 ug Ask for price

ABI3 Recombinant Protein (Mouse)

RP113519 100 ug Ask for price

ABI3 Recombinant Protein (Rat)

RP188693 100 ug Ask for price

Rabbit ABL gene family member 3(ABI3) ELISA kit

E04A1158-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ABL gene family member 3(ABI3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit ABL gene family member 3(ABI3) ELISA kit

E04A1158-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ABL gene family member 3(ABI3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit ABL gene family member 3(ABI3) ELISA kit

E04A1158-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ABL gene family member 3(ABI3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ABI Gene Family Member 3 (ABI3) Antibody

20-abx318426
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Abi3 ORF Vector (Rat) (pORF)

ORF062899 1.0 ug DNA
EUR 506

ABI3 ORF Vector (Human) (pORF)

ORF000052 1.0 ug DNA
EUR 95

Abi3 ORF Vector (Mouse) (pORF)

ORF037840 1.0 ug DNA
EUR 506

Abi3 ORF Vector (Mouse) (pORF)

ORF037841 1.0 ug DNA
EUR 506

ABI3 ELISA Kit (Human) (OKEH08036)

OKEH08036 96 Wells
EUR 896
Description: Description of target: This gene encodes a member of an adaptor protein family. Members of this family encode proteins containing a homeobox homology domain, proline rich region and Src-homology 3 (SH3) domain, and are components of the Abi/WAVE complex which regulates actin polymerization. The encoded protein inhibits ectopic metastasis of tumor cells as well as cell migration. This may be accomplished through interaction with p21-activated kinase. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

ABI Gene Family Member 3 (ABI3) Antibody (HRP)

20-abx311285
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ABI Gene Family Member 3 (ABI3) Antibody (FITC)

20-abx311286
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ABI Gene Family Member 3 (ABI3) Antibody (Biotin)

20-abx311287
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Abi3 sgRNA CRISPR Lentivector set (Rat)

K6538801 3 x 1.0 ug
EUR 339

Abi3 sgRNA CRISPR Lentivector set (Mouse)

K3436701 3 x 1.0 ug
EUR 339

ABI3 sgRNA CRISPR Lentivector set (Human)

K0023801 3 x 1.0 ug
EUR 339

Abi3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6538802 1.0 ug DNA
EUR 154

Abi3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6538803 1.0 ug DNA
EUR 154

Abi3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6538804 1.0 ug DNA
EUR 154

Abi3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3436702 1.0 ug DNA
EUR 154

Abi3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3436703 1.0 ug DNA
EUR 154

Abi3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3436704 1.0 ug DNA
EUR 154

ABI3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0023802 1.0 ug DNA
EUR 154

ABI3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0023803 1.0 ug DNA
EUR 154

ABI3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0023804 1.0 ug DNA
EUR 154

ABI3 Protein Vector (Mouse) (pPB-C-His)

PV151358 500 ng
EUR 603

ABI3 Protein Vector (Mouse) (pPB-N-His)

PV151359 500 ng
EUR 603

ABI3 Protein Vector (Mouse) (pPM-C-HA)

PV151360 500 ng
EUR 603

ABI3 Protein Vector (Mouse) (pPM-C-His)

PV151361 500 ng
EUR 603

ABI3 Protein Vector (Mouse) (pPB-C-His)

PV151362 500 ng
EUR 603

ABI3 Protein Vector (Mouse) (pPB-N-His)

PV151363 500 ng
EUR 603

ABI3 Protein Vector (Mouse) (pPM-C-HA)

PV151364 500 ng
EUR 603

ABI3 Protein Vector (Mouse) (pPM-C-His)

PV151365 500 ng
EUR 603

ABI3 Protein Vector (Rat) (pPB-C-His)

PV251594 500 ng
EUR 603

ABI3 Protein Vector (Rat) (pPB-N-His)

PV251595 500 ng
EUR 603

ABI3 Protein Vector (Rat) (pPM-C-HA)

PV251596 500 ng
EUR 603

ABI3 Protein Vector (Rat) (pPM-C-His)

PV251597 500 ng
EUR 603

ABI3 Protein Vector (Human) (pPB-His-MBP)

PV318982 500 ng
EUR 329

ABI3 Protein Vector (Human) (pPB-His-GST)

PV318983 500 ng
EUR 329

ABI3 Protein Vector (Human) (pPB-C-His)

PV000205 500 ng
EUR 329

ABI3 Protein Vector (Human) (pPB-N-His)

PV000206 500 ng
EUR 329

ABI3 Protein Vector (Human) (pPM-C-HA)

PV000207 500 ng
EUR 329

ABI3 Protein Vector (Human) (pPM-C-His)

PV000208 500 ng
EUR 329

Recombinant Human ABI3 Protein, His, E.coli-100ug

QP10928-100ug 100ug
EUR 1261

Recombinant Human ABI3 Protein, His, E.coli-10ug

QP10928-10ug 10ug
EUR 201

Recombinant Human ABI3 Protein, His, E.coli-2ug

QP10928-2ug 2ug
EUR 155

Abi3 3'UTR Luciferase Stable Cell Line

TU101197 1.0 ml Ask for price

Abi3 3'UTR GFP Stable Cell Line

TU151197 1.0 ml Ask for price

for Abl Interactor 3 (ABI3)ELISA kit

SEK183Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Abl Interactor 3 (ABI3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Abl Interactor 3 (ABI3) in Tissue homogenates, cell lysates and other biological fluids.

for Abl Interactor 3 (ABI3)ELISA kit

SEK183Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Abl Interactor 3 (ABI3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Abl Interactor 3 (ABI3) in Tissue homogenates, cell lysates and other biological fluids.

for Abl Interactor 3 (ABI3)ELISA kit

SEK183Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Abl Interactor 3 (ABI3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Abl Interactor 3 (ABI3) in Tissue homogenates, cell lysates and other biological fluids.

for Abl Interactor 3 (ABI3)ELISA kit

SEK183Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Abl Interactor 3 (ABI3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Abl Interactor 3 (ABI3) in Tissue homogenates, cell lysates and other biological fluids.

ELISA Kit for Abl Interactor 3 (ABI3)

4-SEK183Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Abl Interactor 3 elisa. Alternative names of the recognized antigen: NESH
  • SSH3BP3
  • New molecule including SH3
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Abl Interactor 3 (ABI3) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Abi3 3'UTR Luciferase Stable Cell Line

TU200104 1.0 ml Ask for price

Abi3 3'UTR GFP Stable Cell Line

TU250104 1.0 ml Ask for price

ABI3 3'UTR GFP Stable Cell Line

TU050110 1.0 ml
EUR 1394

ABI3 3'UTR Luciferase Stable Cell Line

TU000110 1.0 ml
EUR 1394

ABI3 ABI Family, Member 3 Human Recombinant Protein

PROTQ9P2A4 Regular: 10ug
EUR 317
Description: ABI3 Human Recombinant produced in E. coli is a single polypeptide chain containing 389 amino acids (1-366) and having a molecular mass of 41.4 kDa.;ABI3 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

ABI3 Rabbit Polyclonal Antibody