ABI3 Rabbit Polyclonal Antibody

ABI3 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

ABI3 Polyclonal Antibody

ABP57667-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human ABI3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ABI3 from Human, Mouse. This ABI3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ABI3 protein

ABI3 Polyclonal Antibody

ABP57667-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ABI3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ABI3 from Human, Mouse. This ABI3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ABI3 protein

ABI3 Polyclonal Antibody

ABP57667-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ABI3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ABI3 from Human, Mouse. This ABI3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ABI3 protein

ABI3 Polyclonal Antibody

A57950 100 µg
EUR 570.55
Description: reagents widely cited

ABI3 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ABI3. Recognizes ABI3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

ABI3 Polyclonal Antibody, Biotin Conjugated

A57951 100 µg
EUR 570.55
Description: Ask the seller for details

ABI3 Polyclonal Antibody, FITC Conjugated

A57952 100 µg
EUR 570.55
Description: The best epigenetics products

ABI3 Polyclonal Antibody, HRP Conjugated

A57953 100 µg
EUR 570.55
Description: kits suitable for this type of research

M Abi3 Antibody

abx034928-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

M Abi3 Antibody

abx034928-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Anti-ABI3 antibody

STJ192953 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ABI3


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ABI3 Protein

  • EUR 1609.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 2 µg
  • Shipped within 5-10 working days.

ABI3 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ABI3. Recognizes ABI3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ABI3 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ABI3. Recognizes ABI3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ABI3 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ABI3. Recognizes ABI3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ABI3 cloning plasmid

CSB-CL873732HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1101
  • Sequence: atggcggagctacagcagctgcaggagtttgagatccccactggccgggaggctctgaggggcaaccacagtgccctgctgcgggtcgctgactactgcgaggacaactatgtgcaggccacagacaagcggaaggcgctggaggagaccatggccttcactacccaggcactgg
  • Show more
Description: A cloning plasmid for the ABI3 gene.

Mouse ABI3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ABI3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ABI3 protein (His tag)

80R-2485 100 ug
EUR 322
Description: Purified recombinant ABI3 protein (His tag)

ABI3 Family, Member 3

PR27188 2 ug
EUR 191

ABI3 Recombinant Protein (Human)

RP000154 100 ug Ask for price

ABI3 Recombinant Protein (Rat)

RP188693 100 ug Ask for price

ABI3 Recombinant Protein (Mouse)

RP113516 100 ug Ask for price

ABI3 Recombinant Protein (Mouse)

RP113519 100 ug Ask for price

Rabbit ABL gene family member 3(ABI3) ELISA kit

E04A1158-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ABL gene family member 3(ABI3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit ABL gene family member 3(ABI3) ELISA kit

E04A1158-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ABL gene family member 3(ABI3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit ABL gene family member 3(ABI3) ELISA kit

E04A1158-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ABL gene family member 3(ABI3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ABI Gene Family Member 3 (ABI3) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ABI3 ORF Vector (Human) (pORF)

ORF000052 1.0 ug DNA
EUR 95

Abi3 ORF Vector (Mouse) (pORF)

ORF037840 1.0 ug DNA
EUR 506

Abi3 ORF Vector (Mouse) (pORF)

ORF037841 1.0 ug DNA
EUR 506

Abi3 ORF Vector (Rat) (pORF)

ORF062899 1.0 ug DNA
EUR 506

ABI3 ELISA Kit (Human) (OKEH08036)

OKEH08036 96 Wells
EUR 896
Description: Description of target: This gene encodes a member of an adaptor protein family. Members of this family encode proteins containing a homeobox homology domain, proline rich region and Src-homology 3 (SH3) domain, and are components of the Abi/WAVE complex which regulates actin polymerization. The encoded protein inhibits ectopic metastasis of tumor cells as well as cell migration. This may be accomplished through interaction with p21-activated kinase. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

ABI Gene Family Member 3 (ABI3) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ABI Gene Family Member 3 (ABI3) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ABI Gene Family Member 3 (ABI3) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ABI3 sgRNA CRISPR Lentivector set (Human)

K0023801 3 x 1.0 ug
EUR 339

Abi3 sgRNA CRISPR Lentivector set (Mouse)

K3436701 3 x 1.0 ug
EUR 339

Abi3 sgRNA CRISPR Lentivector set (Rat)

K6538801 3 x 1.0 ug
EUR 339

ABI3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0023802 1.0 ug DNA
EUR 154

ABI3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0023803 1.0 ug DNA
EUR 154

ABI3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0023804 1.0 ug DNA
EUR 154

Abi3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3436702 1.0 ug DNA
EUR 154

Abi3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3436703 1.0 ug DNA
EUR 154

Abi3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3436704 1.0 ug DNA
EUR 154

Abi3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6538802 1.0 ug DNA
EUR 154

Abi3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6538803 1.0 ug DNA
EUR 154

Abi3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6538804 1.0 ug DNA
EUR 154

ABI3 Protein Vector (Human) (pPB-C-His)

PV000205 500 ng
EUR 329

ABI3 Protein Vector (Human) (pPB-N-His)

PV000206 500 ng
EUR 329

ABI3 Protein Vector (Human) (pPM-C-HA)

PV000207 500 ng
EUR 329

ABI3 Protein Vector (Human) (pPM-C-His)

PV000208 500 ng
EUR 329

Recombinant Human ABI3 Protein, His, E.coli-100ug

QP10928-100ug 100ug
EUR 1261

Recombinant Human ABI3 Protein, His, E.coli-10ug

QP10928-10ug 10ug
EUR 201

Recombinant Human ABI3 Protein, His, E.coli-2ug

QP10928-2ug 2ug
EUR 155

ABI3 Protein Vector (Human) (pPB-His-MBP)

PV318982 500 ng
EUR 329

ABI3 Protein Vector (Human) (pPB-His-GST)

PV318983 500 ng
EUR 329

ABI3 Protein Vector (Mouse) (pPB-C-His)

PV151358 500 ng
EUR 603

ABI3 Protein Vector (Mouse) (pPB-N-His)

PV151359 500 ng
EUR 603

ABI3 Protein Vector (Mouse) (pPM-C-HA)

PV151360 500 ng
EUR 603

ABI3 Protein Vector (Mouse) (pPM-C-His)

PV151361 500 ng
EUR 603

ABI3 Protein Vector (Mouse) (pPB-C-His)

PV151362 500 ng
EUR 603

ABI3 Protein Vector (Mouse) (pPB-N-His)

PV151363 500 ng
EUR 603

ABI3 Protein Vector (Mouse) (pPM-C-HA)

PV151364 500 ng
EUR 603

ABI3 Protein Vector (Mouse) (pPM-C-His)

PV151365 500 ng
EUR 603

ABI3 Protein Vector (Rat) (pPB-C-His)

PV251594 500 ng
EUR 603

ABI3 Protein Vector (Rat) (pPB-N-His)

PV251595 500 ng
EUR 603

ABI3 Protein Vector (Rat) (pPM-C-HA)

PV251596 500 ng
EUR 603

ABI3 Protein Vector (Rat) (pPM-C-His)

PV251597 500 ng
EUR 603

Abi3 3'UTR Luciferase Stable Cell Line

TU200104 1.0 ml Ask for price

Abi3 3'UTR GFP Stable Cell Line

TU151197 1.0 ml Ask for price

for Abl Interactor 3 (ABI3)ELISA kit

SEK183Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Abl Interactor 3 (ABI3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Abl Interactor 3 (ABI3) in Tissue homogenates, cell lysates and other biological fluids.

for Abl Interactor 3 (ABI3)ELISA kit

SEK183Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Abl Interactor 3 (ABI3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Abl Interactor 3 (ABI3) in Tissue homogenates, cell lysates and other biological fluids.

for Abl Interactor 3 (ABI3)ELISA kit

SEK183Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Abl Interactor 3 (ABI3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Abl Interactor 3 (ABI3) in Tissue homogenates, cell lysates and other biological fluids.

for Abl Interactor 3 (ABI3)ELISA kit

SEK183Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Abl Interactor 3 (ABI3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Abl Interactor 3 (ABI3) in Tissue homogenates, cell lysates and other biological fluids.

ELISA Kit for Abl Interactor 3 (ABI3)

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Abl Interactor 3 elisa. Alternative names of the recognized antigen: NESH
  • SSH3BP3
  • New molecule including SH3
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Abl Interactor 3 (ABI3) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

ABI3 3'UTR Luciferase Stable Cell Line

TU000110 1.0 ml
EUR 1394

Abi3 3'UTR Luciferase Stable Cell Line

TU101197 1.0 ml Ask for price

ABI3 3'UTR GFP Stable Cell Line

TU050110 1.0 ml
EUR 1394

Abi3 3'UTR GFP Stable Cell Line

TU250104 1.0 ml Ask for price

ABI3 ABI Family, Member 3 Human Recombinant Protein

PROTQ9P2A4 Regular: 10ug
EUR 317
Description: ABI3 Human Recombinant produced in E. coli is a single polypeptide chain containing 389 amino acids (1-366) and having a molecular mass of 41.4 kDa.;ABI3 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ABI3 Rabbit Polyclonal Antibody