P2RX2 Rabbit Polyclonal Antibody

P2RX2 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

P2RX2 Polyclonal Antibody
ES11813-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against P2RX2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
P2RX2 Polyclonal Antibody
ABP59786-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human P2RX2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of P2RX2 from Human. This P2RX2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human P2RX2 protein
P2RX2 Polyclonal Antibody
ABP59786-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human P2RX2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of P2RX2 from Human. This P2RX2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human P2RX2 protein
P2RX2 Polyclonal Antibody
ABP59786-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human P2RX2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of P2RX2 from Human. This P2RX2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human P2RX2 protein
P2RX2 Rabbit pAb
A7078-100ul 100 ul
EUR 308
P2RX2 Rabbit pAb
A7078-200ul 200 ul
EUR 459
P2RX2 Rabbit pAb
A7078-20ul 20 ul
EUR 183
P2RX2 Rabbit pAb
A7078-50ul 50 ul
EUR 223
P2RX2 antibody
70R-5054 50 ug
EUR 467
Description: Rabbit polyclonal P2RX2 antibody raised against the N terminal of P2RX2
P2RX2 antibody
70R-5081 50 ug
EUR 467
Description: Rabbit polyclonal P2RX2 antibody raised against the N terminal of P2RX2
P2RX2 antibody
70R-5086 50 ug
EUR 467
Description: Rabbit polyclonal P2RX2 antibody raised against the N terminal of P2RX2
P2RX2 antibody
70R-5125 50 ug
EUR 467
Description: Rabbit polyclonal P2RX2 antibody raised against the middle region of P2RX2
P2RX2 antibody
70R-5145 50 ug
EUR 467
Description: Rabbit polyclonal P2RX2 antibody raised against the N terminal of P2RX2
P2RX2 antibody
70R-5166 50 ug
EUR 467
Description: Rabbit polyclonal P2RX2 antibody raised against the N terminal of P2RX2
P2RX2 antibody
70R-5171 50 ug
EUR 467
Description: Rabbit polyclonal P2RX2 antibody raised against the N terminal of P2RX2
P2rx2 antibody
70R-8075 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal P2rx2 antibody
P2RX2 Antibody
37788-100ul 100ul
EUR 252
P2RX2 antibody
70R-1518 100 ug
EUR 377
Description: Rabbit polyclonal P2RX2 antibody raised against the N terminal of P2RX2
P2RX2 antibody
70R-1520 100 ug
EUR 377
Description: Rabbit polyclonal P2RX2 antibody raised against the middle region of P2RX2
P2RX2 Antibody
1-CSB-PA244468
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against P2RX2. Recognizes P2RX2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000
P2RX2 Antibody
1-CSB-PA211403
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against P2RX2. Recognizes P2RX2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200
Polyclonal P2RX2 Antibody (N-term)
APR08898G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human P2RX2 (N-term). This antibody is tested and proven to work in the following applications:
P2rx2/ Rat P2rx2 ELISA Kit
ELI-35724r 96 Tests
EUR 886
P2RX2 Conjugated Antibody
C37788 100ul
EUR 397
Anti-P2RX2 antibody
STJ29158 100 µl
EUR 277
Description: The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel. Binding to ATP mediates synaptic transmission between neurons and from neurons to smooth muscle. Multiple transcript variants encoding distinct isoforms have been identified for this gene.
Anti-P2RX2 antibody
STJ13100214 100 µl
EUR 427
Anti-P2RX2 antibody
STJ13100229 100 µl
EUR 427
Anti-P2RX2 antibody
STJ192971 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to P2RX2
P2RX2 siRNA
20-abx903798
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
P2RX2 siRNA
20-abx927526
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
P2RX2 siRNA
20-abx927527
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Anti-P2X2/P2RX2 Antibody
PB9303 100ug/vial
EUR 334
P2RX2 Blocking Peptide
33R-4132 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of P2RX2 antibody, catalog no. 70R-5125
P2RX2 Blocking Peptide
33R-5050 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of P2RX2 antibody, catalog no. 70R-1520
P2RX2 Blocking Peptide
33R-5584 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of P2RX2 antibody, catalog no. 70R-5054
P2RX2 Blocking Peptide
33R-10100 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of P2RX2 antibody, catalog no. 70R-5166
P2rx2 Blocking Peptide
33R-10318 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of P2rx2 antibody, catalog no. 70R-8075
P2RX2 Blocking Peptide
33R-1942 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of P2RX2 antibody, catalog no. 70R-5086
P2RX2 Blocking Peptide
33R-1943 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of P2RX2 antibody, catalog no. 70R-5081
P2RX2 Blocking Peptide
33R-9891 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of P2RX2 antibody, catalog no. 70R-5171
P2RX2 Blocking Peptide
33R-7540 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of P2RX2 antibody, catalog no. 70R-1518
P2RX2 Blocking Peptide
33R-9779 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of P2RX2 antibody, catalog no. 70R-5145
P2RX2 cloning plasmid
CSB-CL880063HU-10ug 10ug
EUR 404
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1050
  • Sequence: ATGGCCGCCGCCCAGCCCAAGTACCCCGCCGGGGCGACCGCCCGGCGCCTGGCCCGGGGCTGCTGGTCCGCCCTCTGGGACTACGAGACGCCCAAGGTGATCGTGGTGAGGAACCGGCGCCTGGGGGTCCTGTACCGCGCCGTGCAGCTGCTCATCCTGCTCTACTTCGTGTGGT
  • Show more
Description: A cloning plasmid for the P2RX2 gene.
Rat P2RX2 shRNA Plasmid
20-abx987169
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human P2RX2 shRNA Plasmid
20-abx957896
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse P2RX2 shRNA Plasmid
20-abx981893
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
P2RX2 Recombinant Protein (Human)
RP041980 100 ug Ask for price
P2RX2 Recombinant Protein (Rat)
RP219050 100 ug Ask for price
P2RX2 Recombinant Protein (Mouse)
RP159746 100 ug Ask for price
P2RX2 Recombinant Protein (Mouse)
RP159749 100 ug Ask for price
P2RX2 Recombinant Protein (Mouse)
RP159752 100 ug Ask for price
Purinergic Receptor P2X 2 (P2RX2) Antibody
20-abx006888
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Purinergic Receptor P2X 2 (P2RX2) Antibody
abx028529-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Purinergic Receptor P2X 2 (P2RX2) Antibody
abx028529-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Purinergic Receptor P2X 2 (P2RX2) Antibody
20-abx339683
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Purinergic Receptor P2X 2 (P2RX2) Antibody
20-abx213400
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
P2rx2 ORF Vector (Rat) (pORF)
ORF073018 1.0 ug DNA
EUR 506
P2RX2 ORF Vector (Human) (pORF)
ORF013994 1.0 ug DNA
EUR 354
P2rx2 ORF Vector (Mouse) (pORF)
ORF053250 1.0 ug DNA
EUR 506
P2rx2 ORF Vector (Mouse) (pORF)
ORF053251 1.0 ug DNA
EUR 506
P2rx2 ORF Vector (Mouse) (pORF)
ORF053252 1.0 ug DNA
EUR 506
P2RX2 sgRNA CRISPR Lentivector set (Human)
K1581301 3 x 1.0 ug
EUR 339
P2rx2 sgRNA CRISPR Lentivector set (Mouse)
K4261301 3 x 1.0 ug
EUR 339
P2rx2 sgRNA CRISPR Lentivector set (Rat)
K7054701 3 x 1.0 ug
EUR 339
Human P2X purinoceptor 2, P2RX2 ELISA KIT
ELI-12417h 96 Tests
EUR 824
P2RX2 sgRNA CRISPR Lentivector (Human) (Target 1)
K1581302 1.0 ug DNA
EUR 154
P2RX2 sgRNA CRISPR Lentivector (Human) (Target 2)
K1581303 1.0 ug DNA
EUR 154
P2RX2 sgRNA CRISPR Lentivector (Human) (Target 3)
K1581304 1.0 ug DNA
EUR 154
P2rx2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4261302 1.0 ug DNA
EUR 154
P2rx2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4261303 1.0 ug DNA
EUR 154
P2rx2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4261304 1.0 ug DNA
EUR 154
P2rx2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7054702 1.0 ug DNA
EUR 154
P2rx2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7054703 1.0 ug DNA
EUR 154
P2rx2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7054704 1.0 ug DNA
EUR 154
P2RX2 Protein Vector (Human) (pPB-C-His)
PV055973 500 ng
EUR 481
P2RX2 Protein Vector (Human) (pPB-N-His)
PV055974 500 ng
EUR 481
P2RX2 Protein Vector (Human) (pPM-C-HA)
PV055975 500 ng
EUR 481
P2RX2 Protein Vector (Human) (pPM-C-His)
PV055976 500 ng
EUR 481
P2RX2 Protein Vector (Mouse) (pPB-C-His)
PV212998 500 ng
EUR 603
P2RX2 Protein Vector (Mouse) (pPB-N-His)
PV212999 500 ng
EUR 603
P2RX2 Protein Vector (Mouse) (pPM-C-HA)
PV213000 500 ng
EUR 603
P2RX2 Protein Vector (Mouse) (pPM-C-His)
PV213001 500 ng
EUR 603
P2RX2 Protein Vector (Mouse) (pPB-C-His)
PV213002 500 ng
EUR 603
P2RX2 Protein Vector (Mouse) (pPB-N-His)
PV213003 500 ng
EUR 603
P2RX2 Protein Vector (Mouse) (pPM-C-HA)
PV213004 500 ng
EUR 603
P2RX2 Protein Vector (Mouse) (pPM-C-His)
PV213005 500 ng
EUR 603
P2RX2 Protein Vector (Mouse) (pPB-C-His)
PV213006 500 ng
EUR 603
P2RX2 Protein Vector (Mouse) (pPB-N-His)
PV213007 500 ng
EUR 603
P2RX2 Protein Vector (Mouse) (pPM-C-HA)
PV213008 500 ng
EUR 603
P2RX2 Protein Vector (Mouse) (pPM-C-His)
PV213009 500 ng
EUR 603
P2RX2 Protein Vector (Rat) (pPB-C-His)
PV292070 500 ng
EUR 603
P2RX2 Protein Vector (Rat) (pPB-N-His)
PV292071 500 ng
EUR 603
P2RX2 Protein Vector (Rat) (pPM-C-HA)
PV292072 500 ng
EUR 603
P2RX2 Protein Vector (Rat) (pPM-C-His)
PV292073 500 ng
EUR 603
P2rx2 3'UTR GFP Stable Cell Line
TU165807 1.0 ml Ask for price
P2RX2 3'UTR Luciferase Stable Cell Line
TU017247 1.0 ml
EUR 1394
P2rx2 3'UTR Luciferase Stable Cell Line
TU115807 1.0 ml Ask for price
P2RX2 3'UTR GFP Stable Cell Line
TU067247 1.0 ml
EUR 1394
P2rx2 3'UTR GFP Stable Cell Line
TU265722 1.0 ml Ask for price
P2rx2 3'UTR Luciferase Stable Cell Line
TU215722 1.0 ml Ask for price
P2RX2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV658375 1.0 ug DNA
EUR 682
P2RX2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV658379 1.0 ug DNA
EUR 682
P2RX2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV658380 1.0 ug DNA
EUR 682
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

P2RX2 Rabbit Polyclonal Antibody