UCP1 Rabbit Polyclonal Antibody

UCP1 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

Polyclonal UCP1 Antibody
APR10645G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UCP1 . This antibody is tested and proven to work in the following applications:
UCP1 Polyclonal Antibody
ES11824-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against UCP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
UCP1 Polyclonal Antibody
ES11824-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against UCP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
UCP1 Polyclonal Antibody
ABP60848-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human UCP1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of UCP1 from Human, Mouse, Rat. This UCP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UCP1 protein
UCP1 Polyclonal Antibody
ABP60848-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human UCP1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of UCP1 from Human, Mouse, Rat. This UCP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UCP1 protein
UCP1 Polyclonal Antibody
ABP60848-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human UCP1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of UCP1 from Human, Mouse, Rat. This UCP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UCP1 protein
UCP1 Polyclonal Antibody
A54906 100 µg
EUR 570.55
Description: Ask the seller for details
UCP1 Rabbit pAb
A7236-100ul 100 ul
EUR 384
UCP1 Rabbit pAb
A7236-200ul 200 ul Ask for price
UCP1 Rabbit pAb
A7236-20ul 20 ul
EUR 183
UCP1 Rabbit pAb
A7236-50ul 50 ul
EUR 265
UCP1 Rabbit pAb
A5857-100ul 100 ul
EUR 308
UCP1 Rabbit pAb
A5857-200ul 200 ul
EUR 459
UCP1 Rabbit pAb
A5857-20ul 20 ul
EUR 183
UCP1 Rabbit pAb
A5857-50ul 50 ul
EUR 223
Anti-UCP1/UCP1 Antibody
A00255 100ug/vial
EUR 294
Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
DLR-UCP1-Hu-48T 48T
EUR 517
  • Should the Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Uncoupling Protein 1, Mitochondrial (UCP1) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
DLR-UCP1-Hu-96T 96T
EUR 673
  • Should the Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Uncoupling Protein 1, Mitochondrial (UCP1) in samples from tissue homogenates, cell lysates or other biological fluids.
Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
DLR-UCP1-Mu-48T 48T
EUR 527
  • Should the Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Uncoupling Protein 1, Mitochondrial (UCP1) in samples from tissue homogenates, cell lysates or other biological fluids.
Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
DLR-UCP1-Mu-96T 96T
EUR 688
  • Should the Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Uncoupling Protein 1, Mitochondrial (UCP1) in samples from tissue homogenates, cell lysates or other biological fluids.
Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
DLR-UCP1-Ra-48T 48T
EUR 549
  • Should the Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Uncoupling Protein 1, Mitochondrial (UCP1) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
DLR-UCP1-Ra-96T 96T
EUR 718
  • Should the Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Uncoupling Protein 1, Mitochondrial (UCP1) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
RDR-UCP1-Hu-48Tests 48 Tests
EUR 544
Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
RDR-UCP1-Hu-96Tests 96 Tests
EUR 756
Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
RDR-UCP1-Mu-48Tests 48 Tests
EUR 557
Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
RDR-UCP1-Mu-96Tests 96 Tests
EUR 774
Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
RDR-UCP1-Ra-48Tests 48 Tests
EUR 583
Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
RDR-UCP1-Ra-96Tests 96 Tests
EUR 811
Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
RD-UCP1-Hu-48Tests 48 Tests
EUR 521
Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
RD-UCP1-Hu-96Tests 96 Tests
EUR 723
Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
RD-UCP1-Mu-48Tests 48 Tests
EUR 533
Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
RD-UCP1-Mu-96Tests 96 Tests
EUR 740
Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
RD-UCP1-Ra-48Tests 48 Tests
EUR 557
Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
RD-UCP1-Ra-96Tests 96 Tests
EUR 775
Polyclonal Goat Anti-UCP1 Antibody
AMM05152G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-UCP1 . This antibody is tested and proven to work in the following applications:
UCP1 Polyclonal Antibody, Biotin Conjugated
A54903 100 µg
EUR 570.55
Description: reagents widely cited
UCP1 Polyclonal Antibody, FITC Conjugated
A54904 100 µg
EUR 570.55
Description: Ask the seller for details
UCP1 Polyclonal Antibody, HRP Conjugated
A54905 100 µg
EUR 570.55
Description: The best epigenetics products
UCP1 antibody
70R-UR001 100 ug
EUR 640
Description: Affinity purified Rabbit polyclonal UCP1 antibody
UCP1 Antibody
ABD7720 100 ug
EUR 438
UCP1 antibody
38698-100ul 100ul
EUR 252
UCP1 Antibody
43429-100ul 100ul
EUR 252
UCP1 Antibody
6637-50
EUR 414
UCP1 Antibody
DF7720 200ul
EUR 304
Description: UCP1 Antibody detects endogenous levels of total UCP1.
UCP1 Antibody
1-CSB-PA216676
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150
UCP1 Antibody
1-CSB-PA025554ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
UCP1 Antibody
1-CSB-PA025554ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200
UCP1 Antibody
1-CSB-PA025554LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
Polyclonal UCP1 antibody - N-terminal region
APR10648G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UCP1 - N-terminal region. This antibody is tested and proven to work in the following applications:
UCP1 Conjugated Antibody
C38698 100ul
EUR 397
anti- UCP1 antibody
FNab09227 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1：20-1:200
  • Immunogen: uncoupling protein 1(mitochondrial, proton carrier)
  • Uniprot ID: P25874
  • Gene ID: 7350
  • Research Area: Metabolism
Description: Antibody raised against UCP1
Anti-UCP1 antibody
PAab09227 100 ug
EUR 386
Anti-UCP1 Antibody
PA1981 100ug/vial
EUR 294
Anti-UCP1 Antibody
PA1982 100ug/vial
EUR 294
Anti-UCP1 antibody
STJ70810 100 µg
EUR 359
Anti-UCP1 antibody
STJ28420 100 µl
EUR 277
Description: Mitochondrial uncoupling proteins (UCP) are members of the family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed only in brown adipose tissue, a specialized tissue which functions to produce heat.
Anti-UCP1 antibody
STJ11100933 100 µl
EUR 393
Description: Mitochondrial uncoupling proteins (UCP) are members of the family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed only in brown adipose tissue, a specialized tissue which functions to produce heat.
Anti-UCP1 antibody
STJ192982 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to UCP1
Ucp1/ Rat Ucp1 ELISA Kit
ELI-06632r 96 Tests
EUR 886
Polyclonal UCP1 / UCP-1 Antibody (C-Terminus)
APR10643G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UCP1 / UCP-1 (C-Terminus). This antibody is tested and proven to work in the following applications:
UCP1 siRNA
20-abx905932
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UCP1 siRNA
20-abx938926
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UCP1 siRNA
20-abx938927
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
pGEM-UCP1
PVT13596 2 ug
EUR 391
anti-UCP1
YF-PA24935 50 ul
EUR 334
Description: Mouse polyclonal to UCP1
UCP1 Antibody, HRP conjugated
1-CSB-PA025554LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
UCP1 Antibody, FITC conjugated
1-CSB-PA025554LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
UCP1 Antibody, Biotin conjugated
1-CSB-PA025554LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse)
4-PAF557Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1)
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat)
4-PAF557Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1)
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat)
4-PAF557Ra02
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1)
UCP1 cloning plasmid
CSB-CL025554HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 924
  • Sequence: ATGGGGGGCCTGACAGCCTCGGACGTACACCCGACCCTGGGGGTCCAGCTCTTCTCAGCTGGAATAGCGGCGTGCTTGGCGGACGTGATCACCTTCCCGCTGGACACGGCCAAAGTCCGGCTCCAGGTCCAAGGTGAATGCCCGACGTCCAGTGTTATTAGGTATAAAGGTGTCCT
  • Show more
Description: A cloning plasmid for the UCP1 gene.
UCP1 Blocking Peptide
DF7720-BP 1mg
EUR 195
Anti-UCP1 (4E5)
YF-MA16016 100 ug
EUR 363
Description: Mouse monoclonal to UCP1
Anti-UCP1 (4B7)
YF-MA16017 50 ug
EUR 363
Description: Mouse monoclonal to UCP1
Anti-UCP1 (4B7)
YF-MA20450 200 ul
EUR 363
Description: Mouse monoclonal to UCP1
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), APC
4-PAF557Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with APC.
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), Biotinylated
4-PAF557Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with Biotin.
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), Cy3
4-PAF557Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with Cy3.
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), FITC
4-PAF557Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with FITC.
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), HRP
4-PAF557Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with HRP.
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), PE
4-PAF557Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with PE.
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), APC
4-PAF557Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with APC.
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), Biotinylated
4-PAF557Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with Biotin.
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), Cy3
4-PAF557Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with Cy3.
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), FITC
4-PAF557Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with FITC.
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), HRP
4-PAF557Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with HRP.
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), PE
4-PAF557Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with PE.
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), APC
4-PAF557Ra02-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with APC.
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), Biotinylated
4-PAF557Ra02-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with Biotin.
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), Cy3
4-PAF557Ra02-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with Cy3.
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), FITC
4-PAF557Ra02-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with FITC.
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), HRP
4-PAF557Ra02-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with HRP.
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), PE
4-PAF557Ra02-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with PE.
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), APC-Cy7
4-PAF557Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with APC-Cy7.
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), APC-Cy7
4-PAF557Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with APC-Cy7.
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), APC-Cy7
4-PAF557Ra02-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UCP1 (Pro179~Leu296)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with APC-Cy7.
Uncoupling Protein 1, Mitochondrial (UCP1) Antibody
20-abx130224
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Uncoupling Protein 1, Mitochondrial (UCP1) Antibody
20-abx103784
  • EUR 314.00
  • EUR 133.00
  • EUR 829.00
  • EUR 439.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Uncoupling Protein 1, Mitochondrial (UCP1) Antibody
20-abx103785
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Uncoupling Protein 1, Mitochondrial (UCP1) Antibody
20-abx175033
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Uncoupling Protein 1, Mitochondrial (UCP1) Antibody
20-abx178804
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.
Uncoupling Protein 1, Mitochondrial (UCP1) Antibody
20-abx178805
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.
Uncoupling Protein 1, Mitochondrial (UCP1) Antibody
20-abx178806
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Uncoupling Protein 1, Mitochondrial (UCP1) Antibody
20-abx210311
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Rat UCP1 shRNA Plasmid
20-abx984681
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human UCP1 ELISA Kit
ELA-E2067h 96 Tests
EUR 824
Bovine UCP1 ELISA KIT
ELI-06629b 96 Tests
EUR 928
Mouse Ucp1 ELISA KIT
ELI-06630m 96 Tests
EUR 865
Canine UCP1 ELISA KIT
ELI-06633d 96 Tests
EUR 928
Human UCP1 ELISA KIT
ELI-06634h 96 Tests
EUR 824
UCP1 ELISA KIT|Human
EF006166 96 Tests
EUR 689
Human UCP1 shRNA Plasmid
20-abx955025
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse UCP1 shRNA Plasmid
20-abx973301
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
UCP1 Recombinant Protein (Human)
RP044629 100 ug Ask for price
UCP1 Recombinant Protein (Rat)
RP235742 100 ug Ask for price
UCP1 Recombinant Protein (Mouse)
RP182945 100 ug Ask for price
pGEM-Ucp1-A8G-m
PVT14024 2 ug
EUR 391
Mouse UCP1 ELISA Kit
STJ150299 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of UCP-1 in Mouse serum, plasma and other biological fluids
Rabbit Mitochondrial brown fat uncoupling protein 1, UCP1 ELISA
ELI-06631Ra 96 Tests
EUR 928
Rabbit Anti-Mouse Uncoupling Protein 1 (UCP1) antiserum # 1
UCP11-S 100 ul
EUR 457
Rabbit Anti-Mouse Uncoupling Protein 1 (UCP1) antiserum # 2
UCP12-S 100 ul
EUR 457
Monoclonal UCP1 Antibody (monoclonal) (M01), Clone: 4E6
APR10646G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human UCP1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 4E6. This antibody is applicable in WB, E
Monoclonal UCP1 Antibody (monoclonal) (M03), Clone: 4B7
APR10647G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human UCP1 (monoclonal) (M03). The antibodies are raised in mouse and are from clone 4B7. This antibody is applicable in WB, E
Uncoupling Protein 1, Mitochondrial (UCP1) Antibody (FITC)
20-abx273880
  • EUR 495.00
  • EUR 258.00
  • EUR 1455.00
  • EUR 676.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Uncoupling Protein 1, Mitochondrial (UCP1) Antibody (Biotin)
20-abx272849
  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Uncoupling Protein 1, Mitochondrial (UCP1) Antibody (Biotin)
20-abx273298
  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
m UCP1 inducible lentiviral particles
LVP905 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made over-expression lentivirus for expressing mouse target: UCP1 (uncoupling protein 1, mitochondrial, proton carrier), [alternative names: AI385626; Slc25a7; Ucp]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_009463. It also contains a RFP-Blasticidin dual selection marker.
Ucp1 ORF Vector (Rat) (pORF)
ORF078582 1.0 ug DNA
EUR 506
UCP1 ORF Vector (Human) (pORF)
ORF014877 1.0 ug DNA
EUR 95
Ucp1 ORF Vector (Mouse) (pORF)
ORF060983 1.0 ug DNA
EUR 506
UCP1 ELISA Kit (Rat) (OKAN05217)
OKAN05217 96 Wells
EUR 792
Description: Description of target: plays a role in heat production by uncoupling oxidative phosphorylation from the respiratory chain [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.119 ng/mL
UCP1 ELISA Kit (Human) (OKAN05445)
OKAN05445 96 Wells
EUR 792
Description: Description of target: Mitochondrial uncoupling proteins (UCP) are members of the family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed only in brown adipose tissue, a specialized tissue which functions to produce heat.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.064 ng/mL
UCP1 ELISA Kit (Mouse) (OKAN05870)
OKAN05870 96 Wells
EUR 792
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.057 ng/mL
UCP1 ELISA Kit (Mouse) (OKCD02970)
OKCD02970 96 Wells
EUR 857
Description: Description of target: Mitochondrial protein responsible for thermogenic respiration, a specialized capacity of brown adipose tissue and beige fat that participates to non-shivering adaptive thermogenesis to temperature and diet variations and more generally to the regulation of energy balance. Functions as a long-chain fatty acid/LCFA and proton symporter, simultaneously transporting one LCFA and one proton through the inner mitochondrial membrane. However, LCFAs remaining associated with the transporter via their hydrophobic tails, it results in an apparent transport of protons activated by LCFAs. Thereby, dissipates the mitochondrial proton gradient and converts the energy of substrate oxydation into heat instead of ATP. Regulates the production of reactive oxygen species/ROS by mitochondria.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.057 ng/mL
UCP1 ELISA Kit (Human) (OKCD08810)
OKCD08810 96 Wells
EUR 975
Description: Description of target: Mitochondrial uncoupling proteins (UCP) are members of the family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed only in brown adipose tissue, a specialized tissue which functions to produce heat.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.064ng/mL
UCP1 ELISA Kit (Rat) (OKCD08811)
OKCD08811 96 Wells
EUR 1053
Description: Description of target: plays a role in heat production by uncoupling oxidative phosphorylation from the respiratory chain.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.119ng/mL
UCP1 ELISA Kit (Rat) (OKEH03446)
OKEH03446 96 Wells
EUR 662
Description: Description of target: UCP are mitochondrial transporter proteins that create proton leaks across the inner mitochondrial membrane, thus uncoupling oxidative phosphorylation from ATP synthesis. As a result, energy is dissipated in the form of heat.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.091 ng/mL
UCP1 ELISA Kit (Rat) (OKCA01905)
OKCA01905 96 Wells
EUR 846
Description: Description of target: Mitochondrial protein responsible for thermogenic respiration, a specialized capacity of brown adipose tissue and beige fat that participates to non-shivering adaptive thermogenesis to temperature and diet variations and more generally to the regulation of energy balance. Functions as a long-chain fatty acid/LCFA and proton symporter, simultaneously transporting one LCFA and one proton through the inner mitochondrial membrane. However, LCFAs remaining associated with the transporter via their hydrophobic tails, it results in an apparent transport of protons activated by LCFAs. Thereby, dissipates the mitochondrial proton gradient and converts the energy of substrate oxydation into heat instead of ATP. Regulates the production of reactive oxygen species/ROS by mitochondria.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 7.81 pg/mL
UCP1 ELISA Kit (Mouse) (OKEH07201)
OKEH07201 96 Wells
EUR 662
Description: Description of target: Mitochondrial protein responsible for thermogenic respiration, a specialized capacity of brown adipose tissue and beige fat that participates to non-shivering adaptive thermogenesis to temperature and diet variations and more generally to the regulation of energy balance. Functions as a long-chain fatty acid/LCFA and proton symporter, simultaneously transporting one LCFA and one proton through the inner mitochondrial membrane. However, LCFAs remaining associated with the transporter via their hydrophobic tails, it results in an apparent transport of protons activated by LCFAs. Thereby, dissipates the mitochondrial proton gradient and converts the energy of substrate oxydation into heat instead of ATP. Regulates the production of reactive oxygen species/ROS by mitochondria.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 40.5 pg/mL
UCP1 ELISA Kit (Dog) (OKEH08476)
OKEH08476 96 Wells
EUR 1184
Description: Description of target: ;Species reactivity: Dog;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 34pg/mL

UCP1 Rabbit Polyclonal Antibody