UCP1 Rabbit Polyclonal Antibody
To Order Now: info@poweratlas.org
Polyclonal UCP1 Antibody |
APR10645G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UCP1 . This antibody is tested and proven to work in the following applications: |
UCP1 Polyclonal Antibody |
ES11824-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against UCP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
UCP1 Polyclonal Antibody |
ES11824-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against UCP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
UCP1 Polyclonal Antibody |
ABP60848-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human UCP1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of UCP1 from Human, Mouse, Rat. This UCP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UCP1 protein |
UCP1 Polyclonal Antibody |
ABP60848-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human UCP1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of UCP1 from Human, Mouse, Rat. This UCP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UCP1 protein |
UCP1 Polyclonal Antibody |
ABP60848-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human UCP1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of UCP1 from Human, Mouse, Rat. This UCP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UCP1 protein |
UCP1 Polyclonal Antibody |
A54906 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
UCP1 Rabbit pAb |
A7236-100ul |
Abclonal |
100 ul |
EUR 384 |
UCP1 Rabbit pAb |
A7236-200ul |
Abclonal |
200 ul |
Ask for price |
UCP1 Rabbit pAb |
A7236-20ul |
Abclonal |
20 ul |
EUR 183 |
UCP1 Rabbit pAb |
A7236-50ul |
Abclonal |
50 ul |
EUR 265 |
UCP1 Rabbit pAb |
A5857-100ul |
Abclonal |
100 ul |
EUR 308 |
UCP1 Rabbit pAb |
A5857-200ul |
Abclonal |
200 ul |
EUR 459 |
UCP1 Rabbit pAb |
A5857-20ul |
Abclonal |
20 ul |
EUR 183 |
UCP1 Rabbit pAb |
A5857-50ul |
Abclonal |
50 ul |
EUR 223 |
Anti-UCP1/UCP1 Antibody |
A00255 |
BosterBio |
100ug/vial |
EUR 294 |
Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit |
DLR-UCP1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Uncoupling Protein 1, Mitochondrial (UCP1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit |
DLR-UCP1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Uncoupling Protein 1, Mitochondrial (UCP1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit |
DLR-UCP1-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Uncoupling Protein 1, Mitochondrial (UCP1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit |
DLR-UCP1-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Uncoupling Protein 1, Mitochondrial (UCP1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit |
DLR-UCP1-Ra-48T |
DL Develop |
48T |
EUR 549 |
- Should the Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Uncoupling Protein 1, Mitochondrial (UCP1) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit |
DLR-UCP1-Ra-96T |
DL Develop |
96T |
EUR 718 |
- Should the Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Uncoupling Protein 1, Mitochondrial (UCP1) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit |
RDR-UCP1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit |
RDR-UCP1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit |
RDR-UCP1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit |
RDR-UCP1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit |
RDR-UCP1-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit |
RDR-UCP1-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit |
RD-UCP1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit |
RD-UCP1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit |
RD-UCP1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit |
RD-UCP1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit |
RD-UCP1-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit |
RD-UCP1-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
Polyclonal Goat Anti-UCP1 Antibody |
AMM05152G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-UCP1 . This antibody is tested and proven to work in the following applications: |
UCP1 Polyclonal Antibody, Biotin Conjugated |
A54903 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
UCP1 Polyclonal Antibody, FITC Conjugated |
A54904 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
UCP1 Polyclonal Antibody, HRP Conjugated |
A54905 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
UCP1 antibody |
70R-UR001 |
Fitzgerald |
100 ug |
EUR 640 |
Description: Affinity purified Rabbit polyclonal UCP1 antibody |
UCP1 antibody |
38698-100ul |
SAB |
100ul |
EUR 252 |
UCP1 Antibody |
43429-100ul |
SAB |
100ul |
EUR 252 |
UCP1 Antibody |
DF7720 |
Affbiotech |
200ul |
EUR 304 |
Description: UCP1 Antibody detects endogenous levels of total UCP1. |
UCP1 Antibody |
1-CSB-PA216676 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150 |
UCP1 Antibody |
1-CSB-PA025554ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
UCP1 Antibody |
1-CSB-PA025554ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200 |
UCP1 Antibody |
1-CSB-PA025554LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
Polyclonal UCP1 antibody - N-terminal region |
APR10648G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UCP1 - N-terminal region. This antibody is tested and proven to work in the following applications: |
UCP1 Conjugated Antibody |
C38698 |
SAB |
100ul |
EUR 397 |
anti- UCP1 antibody |
FNab09227 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:1000
- IHC: 1:20-1:200
- Immunogen: uncoupling protein 1(mitochondrial, proton carrier)
- Uniprot ID: P25874
- Gene ID: 7350
- Research Area: Metabolism
|
Description: Antibody raised against UCP1 |
Anti-UCP1 Antibody |
PA1981 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-UCP1 Antibody |
PA1982 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-UCP1 antibody |
STJ28420 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Mitochondrial uncoupling proteins (UCP) are members of the family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed only in brown adipose tissue, a specialized tissue which functions to produce heat. |
Anti-UCP1 antibody |
STJ11100933 |
St John's Laboratory |
100 µl |
EUR 393 |
Description: Mitochondrial uncoupling proteins (UCP) are members of the family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed only in brown adipose tissue, a specialized tissue which functions to produce heat. |
Anti-UCP1 antibody |
STJ192982 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to UCP1 |
Polyclonal UCP1 / UCP-1 Antibody (C-Terminus) |
APR10643G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UCP1 / UCP-1 (C-Terminus). This antibody is tested and proven to work in the following applications: |
UCP1 siRNA |
20-abx905932 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
UCP1 siRNA |
20-abx938926 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
UCP1 siRNA |
20-abx938927 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-UCP1 |
YF-PA24935 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to UCP1 |
UCP1 Antibody, HRP conjugated |
1-CSB-PA025554LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
UCP1 Antibody, FITC conjugated |
1-CSB-PA025554LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
UCP1 Antibody, Biotin conjugated |
1-CSB-PA025554LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse) |
4-PAF557Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UCP1 (Pro179~Leu296)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1) |
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat) |
4-PAF557Ra01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UCP1 (Pro179~Leu296)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1) |
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat) |
4-PAF557Ra02 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UCP1 (Pro179~Leu296)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1) |
UCP1 cloning plasmid |
CSB-CL025554HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 924
- Sequence: ATGGGGGGCCTGACAGCCTCGGACGTACACCCGACCCTGGGGGTCCAGCTCTTCTCAGCTGGAATAGCGGCGTGCTTGGCGGACGTGATCACCTTCCCGCTGGACACGGCCAAAGTCCGGCTCCAGGTCCAAGGTGAATGCCCGACGTCCAGTGTTATTAGGTATAAAGGTGTCCT
- Show more
|
Description: A cloning plasmid for the UCP1 gene. |
UCP1 Blocking Peptide |
DF7720-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-UCP1 (4E5) |
YF-MA16016 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to UCP1 |
Anti-UCP1 (4B7) |
YF-MA16017 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse monoclonal to UCP1 |
Anti-UCP1 (4B7) |
YF-MA20450 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to UCP1 |
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), APC |
4-PAF557Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UCP1 (Pro179~Leu296)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with APC. |
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), Biotinylated |
4-PAF557Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UCP1 (Pro179~Leu296)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with Biotin. |
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), Cy3 |
4-PAF557Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UCP1 (Pro179~Leu296)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with Cy3. |
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), FITC |
4-PAF557Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UCP1 (Pro179~Leu296)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with FITC. |
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), HRP |
4-PAF557Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UCP1 (Pro179~Leu296)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with HRP. |
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), PE |
4-PAF557Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UCP1 (Pro179~Leu296)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with PE. |
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), APC |
4-PAF557Ra01-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UCP1 (Pro179~Leu296)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with APC. |
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), Biotinylated |
4-PAF557Ra01-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UCP1 (Pro179~Leu296)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with Biotin. |
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), Cy3 |
4-PAF557Ra01-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UCP1 (Pro179~Leu296)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with Cy3. |
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), FITC |
4-PAF557Ra01-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UCP1 (Pro179~Leu296)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with FITC. |
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), HRP |
4-PAF557Ra01-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UCP1 (Pro179~Leu296)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with HRP. |
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), PE |
4-PAF557Ra01-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UCP1 (Pro179~Leu296)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with PE. |
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), APC |
4-PAF557Ra02-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UCP1 (Pro179~Leu296)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with APC. |
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), Biotinylated |
4-PAF557Ra02-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UCP1 (Pro179~Leu296)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with Biotin. |
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), Cy3 |
4-PAF557Ra02-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UCP1 (Pro179~Leu296)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with Cy3. |
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), FITC |
4-PAF557Ra02-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UCP1 (Pro179~Leu296)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with FITC. |
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), HRP |
4-PAF557Ra02-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UCP1 (Pro179~Leu296)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with HRP. |
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), PE |
4-PAF557Ra02-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UCP1 (Pro179~Leu296)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with PE. |
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAF557Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UCP1 (Pro179~Leu296)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with APC-Cy7. |
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAF557Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 608.00
-
EUR 6970.00
-
EUR 1840.00
-
EUR 814.00
-
EUR 335.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UCP1 (Pro179~Leu296)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with APC-Cy7. |
Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAF557Ra02-APC-Cy7 |
Cloud-Clone |
-
EUR 608.00
-
EUR 6970.00
-
EUR 1840.00
-
EUR 814.00
-
EUR 335.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UCP1 (Pro179~Leu296)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with APC-Cy7. |
Uncoupling Protein 1, Mitochondrial (UCP1) Antibody |
20-abx130224 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Uncoupling Protein 1, Mitochondrial (UCP1) Antibody |
20-abx103784 |
Abbexa |
-
EUR 314.00
-
EUR 133.00
-
EUR 829.00
-
EUR 439.00
-
EUR 272.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Uncoupling Protein 1, Mitochondrial (UCP1) Antibody |
20-abx103785 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Uncoupling Protein 1, Mitochondrial (UCP1) Antibody |
20-abx175033 |
Abbexa |
|
|
|
Uncoupling Protein 1, Mitochondrial (UCP1) Antibody |
20-abx178804 |
Abbexa |
|
|
|
Uncoupling Protein 1, Mitochondrial (UCP1) Antibody |
20-abx178805 |
Abbexa |
|
|
|
Uncoupling Protein 1, Mitochondrial (UCP1) Antibody |
20-abx178806 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Uncoupling Protein 1, Mitochondrial (UCP1) Antibody |
20-abx210311 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Rat UCP1 shRNA Plasmid |
20-abx984681 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human UCP1 shRNA Plasmid |
20-abx955025 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse UCP1 shRNA Plasmid |
20-abx973301 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
UCP1 Recombinant Protein (Human) |
RP044629 |
ABM |
100 ug |
Ask for price |
UCP1 Recombinant Protein (Rat) |
RP235742 |
ABM |
100 ug |
Ask for price |
UCP1 Recombinant Protein (Mouse) |
RP182945 |
ABM |
100 ug |
Ask for price |
Mouse UCP1 ELISA Kit |
STJ150299 |
St John's Laboratory |
1 kit |
EUR 412 |
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of UCP-1 in Mouse serum, plasma and other biological fluids |
Rabbit Mitochondrial brown fat uncoupling protein 1, UCP1 ELISA |
ELI-06631Ra |
Lifescience Market |
96 Tests |
EUR 928 |
Rabbit Anti-Mouse Uncoupling Protein 1 (UCP1) antiserum # 1 |
UCP11-S |
Alpha Diagnostics |
100 ul |
EUR 457 |
Rabbit Anti-Mouse Uncoupling Protein 1 (UCP1) antiserum # 2 |
UCP12-S |
Alpha Diagnostics |
100 ul |
EUR 457 |
Monoclonal UCP1 Antibody (monoclonal) (M01), Clone: 4E6 |
APR10646G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human UCP1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 4E6. This antibody is applicable in WB, E |
Monoclonal UCP1 Antibody (monoclonal) (M03), Clone: 4B7 |
APR10647G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human UCP1 (monoclonal) (M03). The antibodies are raised in mouse and are from clone 4B7. This antibody is applicable in WB, E |
Uncoupling Protein 1, Mitochondrial (UCP1) Antibody (FITC) |
20-abx273880 |
Abbexa |
-
EUR 495.00
-
EUR 258.00
-
EUR 1455.00
-
EUR 676.00
-
EUR 398.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Uncoupling Protein 1, Mitochondrial (UCP1) Antibody (Biotin) |
20-abx272849 |
Abbexa |
-
EUR 467.00
-
EUR 244.00
-
EUR 1344.00
-
EUR 634.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Uncoupling Protein 1, Mitochondrial (UCP1) Antibody (Biotin) |
20-abx273298 |
Abbexa |
-
EUR 481.00
-
EUR 244.00
-
EUR 1414.00
-
EUR 662.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
m UCP1 inducible lentiviral particles |
LVP905 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
Description: Pre-made over-expression lentivirus for expressing mouse target: UCP1 (uncoupling protein 1, mitochondrial, proton carrier), [alternative names: AI385626; Slc25a7; Ucp]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_009463. It also contains a RFP-Blasticidin dual selection marker. |
Ucp1 ORF Vector (Rat) (pORF) |
ORF078582 |
ABM |
1.0 ug DNA |
EUR 506 |
UCP1 ORF Vector (Human) (pORF) |
ORF014877 |
ABM |
1.0 ug DNA |
EUR 95 |
Ucp1 ORF Vector (Mouse) (pORF) |
ORF060983 |
ABM |
1.0 ug DNA |
EUR 506 |
UCP1 ELISA Kit (Rat) (OKAN05217) |
OKAN05217 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: plays a role in heat production by uncoupling oxidative phosphorylation from the respiratory chain [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.119 ng/mL |
UCP1 ELISA Kit (Human) (OKAN05445) |
OKAN05445 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: Mitochondrial uncoupling proteins (UCP) are members of the family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed only in brown adipose tissue, a specialized tissue which functions to produce heat.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.064 ng/mL |
UCP1 ELISA Kit (Mouse) (OKAN05870) |
OKAN05870 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.057 ng/mL |
UCP1 ELISA Kit (Mouse) (OKCD02970) |
OKCD02970 |
Aviva Systems Biology |
96 Wells |
EUR 857 |
Description: Description of target: Mitochondrial protein responsible for thermogenic respiration, a specialized capacity of brown adipose tissue and beige fat that participates to non-shivering adaptive thermogenesis to temperature and diet variations and more generally to the regulation of energy balance. Functions as a long-chain fatty acid/LCFA and proton symporter, simultaneously transporting one LCFA and one proton through the inner mitochondrial membrane. However, LCFAs remaining associated with the transporter via their hydrophobic tails, it results in an apparent transport of protons activated by LCFAs. Thereby, dissipates the mitochondrial proton gradient and converts the energy of substrate oxydation into heat instead of ATP. Regulates the production of reactive oxygen species/ROS by mitochondria.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.057 ng/mL |
UCP1 ELISA Kit (Human) (OKCD08810) |
OKCD08810 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: Mitochondrial uncoupling proteins (UCP) are members of the family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed only in brown adipose tissue, a specialized tissue which functions to produce heat.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.064ng/mL |
UCP1 ELISA Kit (Rat) (OKCD08811) |
OKCD08811 |
Aviva Systems Biology |
96 Wells |
EUR 1053 |
Description: Description of target: plays a role in heat production by uncoupling oxidative phosphorylation from the respiratory chain.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.119ng/mL |
UCP1 ELISA Kit (Rat) (OKEH03446) |
OKEH03446 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: UCP are mitochondrial transporter proteins that create proton leaks across the inner mitochondrial membrane, thus uncoupling oxidative phosphorylation from ATP synthesis. As a result, energy is dissipated in the form of heat.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.091 ng/mL |
UCP1 ELISA Kit (Rat) (OKCA01905) |
OKCA01905 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
Description: Description of target: Mitochondrial protein responsible for thermogenic respiration, a specialized capacity of brown adipose tissue and beige fat that participates to non-shivering adaptive thermogenesis to temperature and diet variations and more generally to the regulation of energy balance. Functions as a long-chain fatty acid/LCFA and proton symporter, simultaneously transporting one LCFA and one proton through the inner mitochondrial membrane. However, LCFAs remaining associated with the transporter via their hydrophobic tails, it results in an apparent transport of protons activated by LCFAs. Thereby, dissipates the mitochondrial proton gradient and converts the energy of substrate oxydation into heat instead of ATP. Regulates the production of reactive oxygen species/ROS by mitochondria.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 7.81 pg/mL |
UCP1 ELISA Kit (Mouse) (OKEH07201) |
OKEH07201 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Mitochondrial protein responsible for thermogenic respiration, a specialized capacity of brown adipose tissue and beige fat that participates to non-shivering adaptive thermogenesis to temperature and diet variations and more generally to the regulation of energy balance. Functions as a long-chain fatty acid/LCFA and proton symporter, simultaneously transporting one LCFA and one proton through the inner mitochondrial membrane. However, LCFAs remaining associated with the transporter via their hydrophobic tails, it results in an apparent transport of protons activated by LCFAs. Thereby, dissipates the mitochondrial proton gradient and converts the energy of substrate oxydation into heat instead of ATP. Regulates the production of reactive oxygen species/ROS by mitochondria.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 40.5 pg/mL |
UCP1 ELISA Kit (Dog) (OKEH08476) |
OKEH08476 |
Aviva Systems Biology |
96 Wells |
EUR 1184 |
Description: Description of target: ;Species reactivity: Dog;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 34pg/mL |
UCP1 Rabbit Polyclonal Antibody