HMOX2 Rabbit Polyclonal Antibody

HMOX2 Rabbit Polyclonal Antibody

To Order Now:

HMOX2 Polyclonal Antibody
ES11802-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HMOX2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
HMOX2 Polyclonal Antibody
ABP58801-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human HMOX2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of HMOX2 from Human, Mouse, Rat. This HMOX2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HMOX2 protein
HMOX2 Polyclonal Antibody
ABP58801-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human HMOX2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of HMOX2 from Human, Mouse, Rat. This HMOX2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HMOX2 protein
HMOX2 Polyclonal Antibody
ABP58801-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human HMOX2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of HMOX2 from Human, Mouse, Rat. This HMOX2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HMOX2 protein
HMOX2 Rabbit pAb
A12713-100ul 100 ul
EUR 308
HMOX2 Rabbit pAb
A12713-200ul 200 ul
EUR 459
HMOX2 Rabbit pAb
A12713-20ul 20 ul
EUR 183
HMOX2 Rabbit pAb
A12713-50ul 50 ul
EUR 223
HMOX2 Rabbit pAb
A2745-100ul 100 ul
EUR 308
HMOX2 Rabbit pAb
A2745-200ul 200 ul
EUR 459
HMOX2 Rabbit pAb
A2745-20ul 20 ul
EUR 183
HMOX2 Rabbit pAb
A2745-50ul 50 ul
EUR 223
HMOX2 Antibody
ABD7071 100 ug
EUR 438
HMOX2 antibody
38455-100ul 100ul
EUR 252
HMOX2 Antibody
31081-100ul 100ul
EUR 252
HMOX2 Antibody
31081-50ul 50ul
EUR 187
HMOX2 antibody
10R-4361 100 ul
EUR 691
Description: Mouse monoclonal HMOX2 antibody
HMOX2 antibody
10R-4362 100 ul
EUR 726
Description: Mouse monoclonal HMOX2 antibody
HMOX2 antibody
10R-4364 100 ul
EUR 691
Description: Mouse monoclonal HMOX2 antibody
HMOX2 antibody
10R-4365 100 ul
EUR 691
Description: Mouse monoclonal HMOX2 antibody
HMOX2 antibody
10R-4366 100 ul
EUR 691
Description: Mouse monoclonal HMOX2 antibody
HMOX2 antibody
10R-4367 100 ul
EUR 691
Description: Mouse monoclonal HMOX2 antibody
HMOX2 antibody
10R-4368 100 ul
EUR 691
Description: Mouse monoclonal HMOX2 antibody
HMOX2 antibody
20R-1346 100 ug
EUR 377
Description: Rabbit polyclonal HMOX2 antibody
HMOX2 antibody
70R-17767 50 ul
EUR 435
Description: Rabbit polyclonal HMOX2 antibody
HMOX2 antibody
70R-11796 100 ug
EUR 460
Description: Rabbit polyclonal HMOX2 antibody
HMOX2 antibody
70R-10556 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal HMOX2 antibody
HMOX2 Antibody
DF7071 200ul
EUR 304
Description: HMOX2 Antibody detects endogenous levels of total HMOX2.
HMOX2 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against HMOX2. Recognizes HMOX2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF
HMOX2 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HMOX2. Recognizes HMOX2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:500-1:2000
Polyclonal HMOX2 Antibody (N-term)
APR07778G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HMOX2 (N-term). This antibody is tested and proven to work in the following applications:
Polyclonal Goat Anti-HMOX2 Antibody
AMM05013G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-HMOX2 . This antibody is tested and proven to work in the following applications:
HMOX2 Conjugated Antibody
C38455 100ul
EUR 397
HMOX2 Conjugated Antibody
C31081 100ul
EUR 397
anti- HMOX2 antibody
FNab03938 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IP: 1:500-1:1000 IHC: 1:50-1:500
  • IF: 1:50-1:500
  • Immunogen: heme oxygenase(decycling) 2
  • Uniprot ID: P30519
  • Gene ID: 3163
  • Research Area: Metabolism
Description: Antibody raised against HMOX2
Anti-HMOX2 antibody
PAab03938 100 ug
EUR 355
Anti-HMOX2 antibody
STJ71962 100 µg
EUR 359
Anti-HMOX2 antibody
STJ24054 100 µl
EUR 277
Description: Heme oxygenase, an essential enzyme in heme catabolism, cleaves heme to form biliverdin, which is subsequently converted to bilirubin by biliverdin reductase, and carbon monoxide, a putative neurotransmitter. Heme oxygenase activity is induced by its substrate heme and by various nonheme substances. Heme oxygenase occurs as 2 isozymes, an inducible heme oxygenase-1 and a constitutive heme oxygenase-2. HMOX1 and HMOX2 belong to the heme oxygenase family. Several alternatively spliced transcript variants encoding three different isoforms have been found for this gene.
Anti-HMOX2 antibody
STJ114586 100 µl
EUR 277
Description: Heme oxygenase, an essential enzyme in heme catabolism, cleaves heme to form biliverdin, which is subsequently converted to bilirubin by biliverdin reductase, and carbon monoxide, a putative neurotransmitter. Heme oxygenase activity is induced by its substrate heme and by various nonheme substances. Heme oxygenase occurs as 2 isozymes, an inducible heme oxygenase-1 and a constitutive heme oxygenase-2. HMOX1 and HMOX2 belong to the heme oxygenase family. Several alternatively spliced transcript variants encoding three different isoforms have been found for this gene.
Anti-HMOX2 antibody
STJ192960 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to HMOX2
HMOX2 protein
30R-1470 100 ug
EUR 268
Description: Purified recombinant Human HMOX2 protein
Rabbit Heme Oxygenase 2 (HMOX2) ELISA Kit
abx363763-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rabbit Heme oxygenase 2, HMOX2 ELISA KIT
ELI-02122Ra 96 Tests
EUR 928
HMOX2 cloning plasmid
CSB-CL010584HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 951
  • Sequence: atgtcagcggaagtggaaacctcagagggggtagacgagtcagaaaaaaagaactctggggccctagaaaaggagaaccaaatgagaatggctgacctctcggagctcctgaaggaagggaccaaggaagcacacgaccgggcagaaaacacccagtttgtcaaggacttcttgaa
  • Show more
Description: A cloning plasmid for the HMOX2 gene.
HMOX2 Blocking Peptide
33R-6392 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HMOX2 antibody, catalog no. 70R-10556
HMOX2 Blocking Peptide
33R-10740 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HMOX2 antibody, catalog no. 70R-11796
HMOX2 Blocking Peptide
DF7071-BP 1mg
EUR 195
Heme Oxygenase 2 (HMOX2) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Heme Oxygenase 2 (HMOX2) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Heme Oxygenase 2 (HMOX2) Antibody
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Heme Oxygenase 2 (HMOX2) Antibody
abx030942-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Heme Oxygenase 2 (HMOX2) Antibody
abx030942-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Heme Oxygenase 2 (HMOX2) Antibody
abx449920-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Heme Oxygenase 2 (HMOX2) Antibody
abx431325-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Heme Oxygenase 2 (HMOX2) Antibody
abx412240-50ug 50 ug
EUR 509
  • Shipped within 1 week.
Heme Oxygenase 2 (HMOX2) Antibody
abx448466-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.
Heme Oxygenase 2 (HMOX2) Antibody
abx233938-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Heme Oxygenase 2, Decycling (HMOX2) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Heme Oxygenase 2 (HMOX2) Antibody (APC)
abx449930-100ug 100 ug
EUR 606
  • Shipped within 5-12 working days.
Heme Oxygenase 2 (HMOX2) Antibody (Biotin)
abx449931-100ug 100 ug
EUR 606
  • Shipped within 5-12 working days.
Heme Oxygenase 2 (HMOX2) Antibody (FITC)
abx449932-100ug 100 ug
EUR 606
  • Shipped within 5-12 working days.
Heme Oxygenase 2 (HMOX2) Antibody (HRP)
abx449933-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.
Heme Oxygenase 2 (HMOX2) Antibody (PerCP)
abx449935-100ug 100 ug
EUR 606
  • Shipped within 5-12 working days.
Heme Oxygenase 2 (HMOX2) Antibody (RPE)
abx449936-100ug 100 ug
EUR 606
  • Shipped within 5-12 working days.
Heme Oxygenase 2 (HMOX2) Antibody (Streptavidin)
abx449937-100ug 100 ug
EUR 606
  • Shipped within 5-12 working days.
Heme Oxygenase 2 (HMOX2) Antibody (ALP)
abx447648-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Heme Oxygenase 2 (HMOX2) Antibody (APC)
abx447649-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Heme Oxygenase 2 (HMOX2) Antibody (Biotin)
abx447650-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Heme Oxygenase 2 (HMOX2) Antibody (FITC)
abx447651-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.
Heme Oxygenase 2 (HMOX2) Antibody (HRP)
abx447652-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.
Heme Oxygenase 2 (HMOX2) Antibody (PerCP)
abx447654-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Heme Oxygenase 2 (HMOX2) Antibody (RPE)
abx447655-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Heme Oxygenase 2 (HMOX2) Antibody (Streptavidin)
abx447656-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Anti-Heme oxygenase 2/HMOX2 Antibody
PB9213 100ug/vial
EUR 334
Rat HMOX2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse HMOX2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human HMOX2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
HMOX2 Recombinant Protein (Human)
RP015019 100 ug Ask for price
HMOX2 Recombinant Protein (Rat)
RP204779 100 ug Ask for price
HMOX2 Recombinant Protein (Mouse)
RP141929 100 ug Ask for price
HMOX2 Recombinant Protein (Mouse)
RP141932 100 ug Ask for price
Heme Oxygenase 2 (HMOX2) Antibody (ATTO 390)
abx449921-100ug 100 ug
EUR 606
  • Shipped within 5-12 working days.
Heme Oxygenase 2 (HMOX2) Antibody (ATTO 488)
abx449922-100ug 100 ug
EUR 606
  • Shipped within 5-12 working days.
Heme Oxygenase 2 (HMOX2) Antibody (ATTO 565)
abx449923-100ug 100 ug
EUR 606
  • Shipped within 5-12 working days.
Heme Oxygenase 2 (HMOX2) Antibody (ATTO 594)
abx449924-100ug 100 ug
EUR 606
  • Shipped within 5-12 working days.
Heme Oxygenase 2 (HMOX2) Antibody (ATTO 633)
abx449925-100ug 100 ug
EUR 606
  • Shipped within 5-12 working days.
Heme Oxygenase 2 (HMOX2) Antibody (ATTO 655)
abx449926-100ug 100 ug
EUR 606
  • Shipped within 5-12 working days.
Heme Oxygenase 2 (HMOX2) Antibody (ATTO 680)
abx449927-100ug 100 ug
EUR 606
  • Shipped within 5-12 working days.
Heme Oxygenase 2 (HMOX2) Antibody (ATTO 700)
abx449928-100ug 100 ug
EUR 606
  • Shipped within 5-12 working days.
Heme Oxygenase 2 (HMOX2) Antibody (Alkaline Phosphatase)
abx449929-100ug 100 ug
EUR 606
  • Shipped within 5-12 working days.
Heme Oxygenase 2 (HMOX2) Antibody (ATTO 390)
abx447640-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Heme Oxygenase 2 (HMOX2) Antibody (ATTO 488)
abx447641-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Heme Oxygenase 2 (HMOX2) Antibody (ATTO 565)
abx447642-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Heme Oxygenase 2 (HMOX2) Antibody (ATTO 594)
abx447643-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Heme Oxygenase 2 (HMOX2) Antibody (ATTO 633)
abx447644-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Heme Oxygenase 2 (HMOX2) Antibody (ATTO 655)
abx447645-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Heme Oxygenase 2 (HMOX2) Antibody (ATTO 680)
abx447646-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
Heme Oxygenase 2 (HMOX2) Antibody (ATTO 700)
abx447647-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
HMOX2 ORF Vector (Human) (pORF)
ORF005007 1.0 ug DNA
EUR 95
Hmox2 ORF Vector (Rat) (pORF)
ORF068261 1.0 ug DNA
EUR 506
Hmox2 ORF Vector (Mouse) (pORF)
ORF047311 1.0 ug DNA
EUR 506
Hmox2 ORF Vector (Mouse) (pORF)
ORF047312 1.0 ug DNA
EUR 506
HMOX2 ELISA Kit (Human) (OKCD06551)
OKCD06551 96 Wells
EUR 753
Description: Description of target: HEME oxygenase cleaves the heme ring at the alpha methene bridge to form biliverdin. Biliverdin is subsequently converted to bilirubin by biliverdin reductase. Under physiological conditions, the activity of heme oxygenase is highest in the spleen, where senescent erythrocytes are sequestrated and destroyed.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL
HMOX2 ELISA Kit (Rat) (OKEH03158)
OKEH03158 96 Wells
EUR 662
Description: Description of target: Heme oxygenase cleaves the heme ring at the alpha methene bridge to form biliverdin. Biliverdin is subsequently converted to bilirubin by biliverdin reductase. Under physiological conditions, the activity of heme oxygenase is highest in the spleen, where senescent erythrocytes are sequestrated and destroyed. Heme oxygenase 2 could be implicated in the production of carbon monoxide in brain where it could act as a neurotransmitter.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.78U/L
HMOX2 ELISA Kit (Human) (OKCA02278)
OKCA02278 96 Wells
EUR 930
Description: Description of target: Heme oxygenase cleaves the heme ring at the alpha methene bridge to form biliverdin. Biliverdin is subsequently converted to bilirubin by biliverdin reductase. Under physiological conditions, the activity of heme oxygenase is highest in the spleen, where senescent erythrocytes are sequestrated and destroyed. Heme oxygenase 2 could be implicated in the production of carbon monoxide in brain where it could act as a neurotransmitter. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 0.08 ng/mL
Monoclonal HMOX2 Antibody (monoclonal) (M01), Clone: 1D8-1A8
APR07777G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human HMOX2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1D8-1A8. This antibody is applicable in WB and IF, E
Heme Oxygenase 2 (HMOX2) Antibody (PE/ATTO 594)
abx449934-100ug 100 ug
EUR 620
  • Shipped within 5-12 working days.
Heme Oxygenase 2 (HMOX2) Antibody (PE/ATTO 594)
abx447653-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.
Hmox2 sgRNA CRISPR Lentivector set (Mouse)
K4408701 3 x 1.0 ug
EUR 339
HMOX2 sgRNA CRISPR Lentivector set (Human)
K0974601 3 x 1.0 ug
EUR 339
Hmox2 sgRNA CRISPR Lentivector set (Rat)
K6761001 3 x 1.0 ug
EUR 339
Pig Heme Oxygenase 2 (HMOX2) ELISA Kit
abx360647-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Human Heme Oxygenase 2 (HMOX2) ELISA Kit
abx513440-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Mouse Heme Oxygenase 2 (HMOX2) ELISA Kit
abx513441-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Rat Heme Oxygenase 2 (HMOX2) ELISA Kit
abx574071-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rat Hmox2/ Heme oxygenase 2 ELISA Kit
E0459Ra 1 Kit
EUR 571
Mouse Hmox2/ Heme oxygenase 2 ELISA Kit
E0685Mo 1 Kit
EUR 571
Human HMOX2/ Heme oxygenase 2 ELISA Kit
E1150Hu 1 Kit
EUR 571
Human Heme oxygenase 2, HMOX2 ELISA KIT
ELI-02119h 96 Tests
EUR 824

HMOX2 Rabbit Polyclonal Antibody