HMOX2 Rabbit Polyclonal Antibody

HMOX2 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

HMOX2 Polyclonal Antibody
ES11802-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HMOX2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

HMOX2 Polyclonal Antibody
ABP58801-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human HMOX2 protein Applications tips:
Description: A polyclonal antibody for detection of HMOX2 from Human, Mouse, Rat. This HMOX2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HMOX2 protein

HMOX2 Polyclonal Antibody
ABP58801-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human HMOX2 protein Applications tips:
Description: A polyclonal antibody for detection of HMOX2 from Human, Mouse, Rat. This HMOX2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HMOX2 protein

HMOX2 Polyclonal Antibody
ABP58801-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human HMOX2 protein Applications tips:
Description: A polyclonal antibody for detection of HMOX2 from Human, Mouse, Rat. This HMOX2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HMOX2 protein

HMOX2 Rabbit pAb
A12713-100ul	Abclonal	100 ul	EUR 308

HMOX2 Rabbit pAb
A12713-200ul	Abclonal	200 ul	EUR 459

HMOX2 Rabbit pAb
A12713-20ul	Abclonal	20 ul	EUR 183

HMOX2 Rabbit pAb
A12713-50ul	Abclonal	50 ul	EUR 223

HMOX2 Rabbit pAb
A2745-100ul	Abclonal	100 ul	EUR 308

HMOX2 Rabbit pAb
A2745-200ul	Abclonal	200 ul	EUR 459

HMOX2 Rabbit pAb
A2745-20ul	Abclonal	20 ul	EUR 183

HMOX2 Rabbit pAb
A2745-50ul	Abclonal	50 ul	EUR 223

HMOX2 Antibody
ABD7071	Lifescience Market	100 ug	EUR 438

HMOX2 antibody
38455-100ul	SAB	100ul	EUR 252

HMOX2 Antibody
31081-100ul	SAB	100ul	EUR 252

HMOX2 Antibody
31081-50ul	SAB	50ul	EUR 187

HMOX2 antibody
10R-4361	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal HMOX2 antibody

HMOX2 antibody
10R-4362	Fitzgerald	100 ul	EUR 726
Description: Mouse monoclonal HMOX2 antibody

HMOX2 antibody
10R-4364	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal HMOX2 antibody

HMOX2 antibody
10R-4365	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal HMOX2 antibody

HMOX2 antibody
10R-4366	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal HMOX2 antibody

HMOX2 antibody
10R-4367	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal HMOX2 antibody

HMOX2 antibody
10R-4368	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal HMOX2 antibody

HMOX2 antibody
20R-1346	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal HMOX2 antibody

HMOX2 antibody
70R-17767	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal HMOX2 antibody

HMOX2 antibody
70R-11796	Fitzgerald	100 ug	EUR 460
Description: Rabbit polyclonal HMOX2 antibody

HMOX2 antibody
70R-10556	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal HMOX2 antibody

HMOX2 Antibody
DF7071	Affbiotech	200ul	EUR 304
Description: HMOX2 Antibody detects endogenous levels of total HMOX2.

HMOX2 Antibody
1-CSB-PA010584GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against HMOX2. Recognizes HMOX2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

HMOX2 Antibody
1-CSB-PA204326	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HMOX2. Recognizes HMOX2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:500-1:2000

Polyclonal HMOX2 Antibody (N-term)
APR07778G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HMOX2 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-HMOX2 Antibody
AMM05013G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-HMOX2 . This antibody is tested and proven to work in the following applications:

HMOX2 Conjugated Antibody
C38455	SAB	100ul	EUR 397

HMOX2 Conjugated Antibody
C31081	SAB	100ul	EUR 397

anti- HMOX2 antibody
FNab03938	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:1000 IP: 1:500-1:1000 IHC: 1:50-1:500 IF: 1:50-1:500 Immunogen: heme oxygenase(decycling) 2 Uniprot ID: P30519 Gene ID: 3163 Research Area: Metabolism
Description: Antibody raised against HMOX2

Anti-HMOX2 antibody
PAab03938	Lifescience Market	100 ug	EUR 355

Anti-HMOX2 antibody
STJ71962	St John's Laboratory	100 µg	EUR 359

Anti-HMOX2 antibody
STJ24054	St John's Laboratory	100 µl	EUR 277
Description: Heme oxygenase, an essential enzyme in heme catabolism, cleaves heme to form biliverdin, which is subsequently converted to bilirubin by biliverdin reductase, and carbon monoxide, a putative neurotransmitter. Heme oxygenase activity is induced by its substrate heme and by various nonheme substances. Heme oxygenase occurs as 2 isozymes, an inducible heme oxygenase-1 and a constitutive heme oxygenase-2. HMOX1 and HMOX2 belong to the heme oxygenase family. Several alternatively spliced transcript variants encoding three different isoforms have been found for this gene.

Anti-HMOX2 antibody
STJ114586	St John's Laboratory	100 µl	EUR 277
Description: Heme oxygenase, an essential enzyme in heme catabolism, cleaves heme to form biliverdin, which is subsequently converted to bilirubin by biliverdin reductase, and carbon monoxide, a putative neurotransmitter. Heme oxygenase activity is induced by its substrate heme and by various nonheme substances. Heme oxygenase occurs as 2 isozymes, an inducible heme oxygenase-1 and a constitutive heme oxygenase-2. HMOX1 and HMOX2 belong to the heme oxygenase family. Several alternatively spliced transcript variants encoding three different isoforms have been found for this gene.

Anti-HMOX2 antibody
STJ192960	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to HMOX2

HMOX2 protein
30R-1470	Fitzgerald	100 ug	EUR 268
Description: Purified recombinant Human HMOX2 protein

Rabbit Heme Oxygenase 2 (HMOX2) ELISA Kit
abx363763-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Heme oxygenase 2, HMOX2 ELISA KIT
ELI-02122Ra	Lifescience Market	96 Tests	EUR 928

HMOX2 cloning plasmid
CSB-CL010584HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 951 Sequence: atgtcagcggaagtggaaacctcagagggggtagacgagtcagaaaaaaagaactctggggccctagaaaaggagaaccaaatgagaatggctgacctctcggagctcctgaaggaagggaccaaggaagcacacgaccgggcagaaaacacccagtttgtcaaggacttcttgaa Show more
Description: A cloning plasmid for the HMOX2 gene.

HMOX2 Blocking Peptide
33R-6392	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HMOX2 antibody, catalog no. 70R-10556

HMOX2 Blocking Peptide
33R-10740	Fitzgerald	50 ug	EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HMOX2 antibody, catalog no. 70R-11796

HMOX2 Blocking Peptide
DF7071-BP	Affbiotech	1mg	EUR 195

Heme Oxygenase 2 (HMOX2) Antibody
20-abx112961	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Heme Oxygenase 2 (HMOX2) Antibody
20-abx002076	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Heme Oxygenase 2 (HMOX2) Antibody
20-abx009166	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Heme Oxygenase 2 (HMOX2) Antibody
abx030942-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Heme Oxygenase 2 (HMOX2) Antibody
abx030942-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Heme Oxygenase 2 (HMOX2) Antibody
abx449920-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody
abx431325-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Heme Oxygenase 2 (HMOX2) Antibody
abx412240-50ug	Abbexa	50 ug	EUR 509
Shipped within 1 week.

Heme Oxygenase 2 (HMOX2) Antibody
abx448466-100ug	Abbexa	100 ug	EUR 523
Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody
abx233938-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Heme Oxygenase 2, Decycling (HMOX2) Antibody
20-abx214809	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Heme Oxygenase 2 (HMOX2) Antibody (APC)
abx449930-100ug	Abbexa	100 ug	EUR 606
Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (Biotin)
abx449931-100ug	Abbexa	100 ug	EUR 606
Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (FITC)
abx449932-100ug	Abbexa	100 ug	EUR 606
Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (HRP)
abx449933-100ug	Abbexa	100 ug	EUR 592
Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (PerCP)
abx449935-100ug	Abbexa	100 ug	EUR 606
Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (RPE)
abx449936-100ug	Abbexa	100 ug	EUR 606
Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (Streptavidin)
abx449937-100ug	Abbexa	100 ug	EUR 606
Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (ALP)
abx447648-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (APC)
abx447649-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (Biotin)
abx447650-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (FITC)
abx447651-100ug	Abbexa	100 ug	EUR 565
Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (HRP)
abx447652-100ug	Abbexa	100 ug	EUR 565
Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (PerCP)
abx447654-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (RPE)
abx447655-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (Streptavidin)
abx447656-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Anti-Heme oxygenase 2/HMOX2 Antibody
PB9213	BosterBio	100ug/vial	EUR 334

Rat HMOX2 shRNA Plasmid
20-abx986530	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse HMOX2 shRNA Plasmid
20-abx970829	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human HMOX2 shRNA Plasmid
20-abx952159	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

HMOX2 Recombinant Protein (Human)
RP015019	ABM	100 ug	Ask for price

HMOX2 Recombinant Protein (Rat)
RP204779	ABM	100 ug	Ask for price

HMOX2 Recombinant Protein (Mouse)
RP141929	ABM	100 ug	Ask for price

HMOX2 Recombinant Protein (Mouse)
RP141932	ABM	100 ug	Ask for price

Heme Oxygenase 2 (HMOX2) Antibody (ATTO 390)
abx449921-100ug	Abbexa	100 ug	EUR 606
Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (ATTO 488)
abx449922-100ug	Abbexa	100 ug	EUR 606
Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (ATTO 565)
abx449923-100ug	Abbexa	100 ug	EUR 606
Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (ATTO 594)
abx449924-100ug	Abbexa	100 ug	EUR 606
Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (ATTO 633)
abx449925-100ug	Abbexa	100 ug	EUR 606
Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (ATTO 655)
abx449926-100ug	Abbexa	100 ug	EUR 606
Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (ATTO 680)
abx449927-100ug	Abbexa	100 ug	EUR 606
Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (ATTO 700)
abx449928-100ug	Abbexa	100 ug	EUR 606
Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (Alkaline Phosphatase)
abx449929-100ug	Abbexa	100 ug	EUR 606
Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (ATTO 390)
abx447640-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (ATTO 488)
abx447641-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (ATTO 565)
abx447642-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (ATTO 594)
abx447643-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (ATTO 633)
abx447644-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (ATTO 655)
abx447645-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (ATTO 680)
abx447646-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (ATTO 700)
abx447647-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

HMOX2 ORF Vector (Human) (pORF)
ORF005007	ABM	1.0 ug DNA	EUR 95

Hmox2 ORF Vector (Rat) (pORF)
ORF068261	ABM	1.0 ug DNA	EUR 506

Hmox2 ORF Vector (Mouse) (pORF)
ORF047311	ABM	1.0 ug DNA	EUR 506

Hmox2 ORF Vector (Mouse) (pORF)
ORF047312	ABM	1.0 ug DNA	EUR 506

HMOX2 ELISA Kit (Human) (OKCD06551)
OKCD06551	Aviva Systems Biology	96 Wells	EUR 753
Description: Description of target: HEME oxygenase cleaves the heme ring at the alpha methene bridge to form biliverdin. Biliverdin is subsequently converted to bilirubin by biliverdin reductase. Under physiological conditions, the activity of heme oxygenase is highest in the spleen, where senescent erythrocytes are sequestrated and destroyed.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL

HMOX2 ELISA Kit (Rat) (OKEH03158)
OKEH03158	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Heme oxygenase cleaves the heme ring at the alpha methene bridge to form biliverdin. Biliverdin is subsequently converted to bilirubin by biliverdin reductase. Under physiological conditions, the activity of heme oxygenase is highest in the spleen, where senescent erythrocytes are sequestrated and destroyed. Heme oxygenase 2 could be implicated in the production of carbon monoxide in brain where it could act as a neurotransmitter.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.78U/L

HMOX2 ELISA Kit (Human) (OKCA02278)
OKCA02278	Aviva Systems Biology	96 Wells	EUR 930
Description: Description of target: Heme oxygenase cleaves the heme ring at the alpha methene bridge to form biliverdin. Biliverdin is subsequently converted to bilirubin by biliverdin reductase. Under physiological conditions, the activity of heme oxygenase is highest in the spleen, where senescent erythrocytes are sequestrated and destroyed. Heme oxygenase 2 could be implicated in the production of carbon monoxide in brain where it could act as a neurotransmitter. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 0.08 ng/mL

Monoclonal HMOX2 Antibody (monoclonal) (M01), Clone: 1D8-1A8
APR07777G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human HMOX2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1D8-1A8. This antibody is applicable in WB and IF, E

Heme Oxygenase 2 (HMOX2) Antibody (PE/ATTO 594)
abx449934-100ug	Abbexa	100 ug	EUR 620
Shipped within 5-12 working days.

Heme Oxygenase 2 (HMOX2) Antibody (PE/ATTO 594)
abx447653-100ug	Abbexa	100 ug	EUR 592
Shipped within 5-12 working days.

Hmox2 sgRNA CRISPR Lentivector set (Mouse)
K4408701	ABM	3 x 1.0 ug	EUR 339

HMOX2 sgRNA CRISPR Lentivector set (Human)
K0974601	ABM	3 x 1.0 ug	EUR 339

Hmox2 sgRNA CRISPR Lentivector set (Rat)
K6761001	ABM	3 x 1.0 ug	EUR 339

Pig Heme Oxygenase 2 (HMOX2) ELISA Kit
abx360647-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Heme Oxygenase 2 (HMOX2) ELISA Kit
abx513440-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse Heme Oxygenase 2 (HMOX2) ELISA Kit
abx513441-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Heme Oxygenase 2 (HMOX2) ELISA Kit
abx574071-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rat Hmox2/ Heme oxygenase 2 ELISA Kit
E0459Ra	Sunlong	1 Kit	EUR 571

Mouse Hmox2/ Heme oxygenase 2 ELISA Kit
E0685Mo	Sunlong	1 Kit	EUR 571

Human HMOX2/ Heme oxygenase 2 ELISA Kit
E1150Hu	Sunlong	1 Kit	EUR 571

Human Heme oxygenase 2, HMOX2 ELISA KIT
ELI-02119h	Lifescience Market	96 Tests	EUR 824

HMOX2 Rabbit Polyclonal Antibody