PANK2 Rabbit Polyclonal Antibody

PANK2 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

PANK2 Polyclonal Antibody
ABP59818-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human PANK2 protein Applications tips:
Description: A polyclonal antibody for detection of PANK2 from Human. This PANK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PANK2 protein

PANK2 Polyclonal Antibody
ES11775-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against PANK2. This antibody is tested and validated for WB, ELISA, WB, ELISA

PANK2 Polyclonal Antibody
ES11775-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against PANK2. This antibody is tested and validated for WB, ELISA, WB, ELISA

PANK2 Rabbit pAb
A18502-100ul	Abclonal	100 ul	EUR 308

PANK2 Rabbit pAb
A18502-200ul	Abclonal	200 ul	EUR 459

PANK2 Rabbit pAb
A18502-20ul	Abclonal	20 ul	EUR 183

PANK2 Rabbit pAb
A18502-50ul	Abclonal	50 ul	EUR 223

PANK2 antibody
70R-19106	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal PANK2 antibody

PANK2 antibody
10R-5154	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal PANK2 antibody

PANK2 antibody
10R-5155	Fitzgerald	100 ul	EUR 726
Description: Mouse monoclonal PANK2 antibody

PANK2 Antibody
45374-100ul	SAB	100ul	EUR 252

PANK2 Antibody
45374-50ul	SAB	50ul	EUR 187

PANK2 Antibody
1-CSB-PA874850LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PANK2. Recognizes PANK2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

PANK2 Antibody
DF8588	Affbiotech	200ul	EUR 304
Description: PANK2 Antibody detects endogenous levels of total PANK2.

PANK2 Antibody
1-CSB-PA017422GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PANK2. Recognizes PANK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PANK2 antibody
70R-51108	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal PANK2 antibody

PANK2 Antibody
ABD8588	Lifescience Market	100 ug	EUR 438

Polyclonal PANK2 Antibody (N-term)
APR08921G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PANK2 (N-term). This antibody is tested and proven to work in the following applications:

Anti-PANK2 Antibody
A02776	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal PANK2 Antibody. Validated in WB and tested in Human.

PANK2 Conjugated Antibody
C45374	SAB	100ul	EUR 397

anti- PANK2 antibody
FNab06134	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:1000 IP: 1:500-1:1000 IHC: 1:10-1:100 IF: 1:10-1:100 Immunogen: pantothenate kinase 2 Uniprot ID: Q9BZ23 Gene ID: 80025 Research Area: Metabolism
Description: Antibody raised against PANK2

Anti-PANK2 antibody
PAab06134	Lifescience Market	100 ug	EUR 355

Anti-PANK2 antibody
STJ11100453	St John's Laboratory	100 µl	EUR 277

Anti-PANK2 antibody
STJ192933	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to PANK2

PANK2 siRNA
20-abx927679	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pOTB7-PANK2
PVT12303	Lifescience Market	2 ug	EUR 391

PANK2 Antibody, HRP conjugated
1-CSB-PA874850LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PANK2. Recognizes PANK2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PANK2 Antibody, FITC conjugated
1-CSB-PA874850LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PANK2. Recognizes PANK2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PANK2 Antibody, Biotin conjugated
1-CSB-PA874850LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PANK2. Recognizes PANK2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PANK2 Blocking Peptide
DF8588-BP	Affbiotech	1mg	EUR 195

PANK2 Blocking Peptide
20-abx063983	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

PANK2 cloning plasmid
CSB-CL874850HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 405 Sequence: atggcatctcgtggagatagcaccaaagtggataaactagtacgagatatttatggaggggactatgagaggtttggactgccaggctgggctgtggcttcaagctttggaaacatgatgagcaaggagaagcgagaggctgtcagtaaagaggacctggccagagcgactttgat Show more
Description: A cloning plasmid for the PANK2 gene.

Anti-PANK2 (2B12)
YF-MA11671	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to PANK2

Pantothenate Kinase 2 (PANK2) Antibody
20-abx008032	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Pantothenate Kinase 2 (PANK2) Antibody
20-abx217632	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Pantothenate Kinase 2 (PANK2) Antibody
20-abx114323	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Pantothenate Kinase 2 (PANK2) Antibody
abx236134-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Pantothenate Kinase 2 (PANK2) Antibody
20-abx318220	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

PANK2 ELISA KIT|Human
EF001546	Lifescience Market	96 Tests	EUR 689

Human PANK2 shRNA Plasmid
20-abx962733	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PANK2 Recombinant Protein (Human)
RP022510	ABM	100 ug	Ask for price

PANK2 Recombinant Protein (Mouse)
RP160031	ABM	100 ug	Ask for price

PANK2 Recombinant Protein (Rat)
RP219233	ABM	100 ug	Ask for price

Pantothenate Kinase 2 (PANK2) Antibody (HRP)
20-abx315132	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Pantothenate Kinase 2 (PANK2) Antibody (FITC)
20-abx315133	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Pantothenate Kinase 2 (PANK2) Antibody (Biotin)
20-abx315134	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Pank2 ORF Vector (Rat) (pORF)
ORF073079	ABM	1.0 ug DNA	EUR 506

PANK2 ORF Vector (Human) (pORF)
ORF007504	ABM	1.0 ug DNA	EUR 95

Pank2 ORF Vector (Mouse) (pORF)
ORF053345	ABM	1.0 ug DNA	EUR 506

pECMV-Pank2-m-FLAG Plasmid
PVT14904	Lifescience Market	2 ug	EUR 325

Pank2 sgRNA CRISPR Lentivector set (Rat)
K6058401	ABM	3 x 1.0 ug	EUR 339

Pank2 sgRNA CRISPR Lentivector set (Mouse)
K4027701	ABM	3 x 1.0 ug	EUR 339

PANK2 sgRNA CRISPR Lentivector set (Human)
K1591501	ABM	3 x 1.0 ug	EUR 339

Human Pantothenate Kinase 2 (PANK2) ELISA Kit
abx382044-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Pank2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6058402	ABM	1.0 ug DNA	EUR 154

Pank2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6058403	ABM	1.0 ug DNA	EUR 154

Pank2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6058404	ABM	1.0 ug DNA	EUR 154

Pank2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4027702	ABM	1.0 ug DNA	EUR 154

Pank2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4027703	ABM	1.0 ug DNA	EUR 154

Pank2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4027704	ABM	1.0 ug DNA	EUR 154

PANK2 sgRNA CRISPR Lentivector (Human) (Target 1)
K1591502	ABM	1.0 ug DNA	EUR 154

PANK2 sgRNA CRISPR Lentivector (Human) (Target 2)
K1591503	ABM	1.0 ug DNA	EUR 154

PANK2 sgRNA CRISPR Lentivector (Human) (Target 3)
K1591504	ABM	1.0 ug DNA	EUR 154

PANK2 Protein Vector (Rat) (pPB-C-His)
PV292314	ABM	500 ng	EUR 603

PANK2 Protein Vector (Rat) (pPB-N-His)
PV292315	ABM	500 ng	EUR 603

PANK2 Protein Vector (Rat) (pPM-C-HA)
PV292316	ABM	500 ng	EUR 603

PANK2 Protein Vector (Rat) (pPM-C-His)
PV292317	ABM	500 ng	EUR 603

PANK2 Protein Vector (Mouse) (pPB-C-His)
PV213378	ABM	500 ng	EUR 603

PANK2 Protein Vector (Mouse) (pPB-N-His)
PV213379	ABM	500 ng	EUR 603

PANK2 Protein Vector (Mouse) (pPM-C-HA)
PV213380	ABM	500 ng	EUR 603

PANK2 Protein Vector (Mouse) (pPM-C-His)
PV213381	ABM	500 ng	EUR 603

PANK2 Protein Vector (Human) (pPB-C-His)
PV030013	ABM	500 ng	EUR 329

PANK2 Protein Vector (Human) (pPB-N-His)
PV030014	ABM	500 ng	EUR 329

PANK2 Protein Vector (Human) (pPM-C-HA)
PV030015	ABM	500 ng	EUR 329

PANK2 Protein Vector (Human) (pPM-C-His)
PV030016	ABM	500 ng	EUR 329

Human Pantothenate Kinase 2(PANK2)ELISA Kit
QY-E03648	Qayee Biotechnology	96T	EUR 361

Pank2 3'UTR Luciferase Stable Cell Line
TU115879	ABM	1.0 ml	Ask for price

Pank2 3'UTR GFP Stable Cell Line
TU165879	ABM	1.0 ml	Ask for price

Pank2 3'UTR Luciferase Stable Cell Line
TU215788	ABM	1.0 ml	Ask for price

Pank2 3'UTR GFP Stable Cell Line
TU265788	ABM	1.0 ml	Ask for price

PANK2 3'UTR GFP Stable Cell Line
TU067363	ABM	1.0 ml	EUR 2333

PANK2 3'UTR Luciferase Stable Cell Line
TU017363	ABM	1.0 ml	EUR 2333

Human Pantothenate kinase 2, mitochondrial, PANK2 ELISA KIT
ELI-37781h	Lifescience Market	96 Tests	EUR 824

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

PANK2 Rabbit Polyclonal Antibody