PANK2 Rabbit Polyclonal Antibody
To Order Now: info@poweratlas.org
PANK2 Polyclonal Antibody |
ABP59818-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human PANK2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of PANK2 from Human. This PANK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PANK2 protein |
PANK2 Polyclonal Antibody |
ABP59818-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PANK2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of PANK2 from Human. This PANK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PANK2 protein |
PANK2 Polyclonal Antibody |
ABP59818-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PANK2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of PANK2 from Human. This PANK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PANK2 protein |
PANK2 Rabbit pAb |
A18502-100ul |
Abclonal |
100 ul |
EUR 308 |
PANK2 Rabbit pAb |
A18502-200ul |
Abclonal |
200 ul |
EUR 459 |
PANK2 Rabbit pAb |
A18502-20ul |
Abclonal |
20 ul |
EUR 183 |
PANK2 Rabbit pAb |
A18502-50ul |
Abclonal |
50 ul |
EUR 223 |
PANK2 antibody |
70R-51108 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal PANK2 antibody |
PANK2 Antibody |
45374-100ul |
SAB |
100ul |
EUR 252 |
PANK2 Antibody |
45374-50ul |
SAB |
50ul |
EUR 187 |
PANK2 antibody |
10R-5154 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal PANK2 antibody |
PANK2 antibody |
10R-5155 |
Fitzgerald |
100 ul |
EUR 726 |
Description: Mouse monoclonal PANK2 antibody |
PANK2 antibody |
70R-19106 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal PANK2 antibody |
PANK2 Antibody |
DF8588 |
Affbiotech |
200ul |
EUR 304 |
Description: PANK2 Antibody detects endogenous levels of total PANK2. |
PANK2 Antibody |
1-CSB-PA874850LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PANK2. Recognizes PANK2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200 |
PANK2 Antibody |
1-CSB-PA017422GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against PANK2. Recognizes PANK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
Polyclonal PANK2 Antibody (N-term) |
APR08921G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PANK2 (N-term). This antibody is tested and proven to work in the following applications: |
PANK2 Conjugated Antibody |
C45374 |
SAB |
100ul |
EUR 397 |
anti- PANK2 antibody |
FNab06134 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500-1:1000
- IP: 1:500-1:1000
- IHC: 1:10-1:100
- IF: 1:10-1:100
- Immunogen: pantothenate kinase 2
- Uniprot ID: Q9BZ23
- Gene ID: 80025
- Research Area: Metabolism
|
Description: Antibody raised against PANK2 |
Anti-PANK2 Antibody |
A02776 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal PANK2 Antibody. Validated in WB and tested in Human. |
Anti-PANK2 antibody |
STJ192933 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PANK2 |
PANK2 siRNA |
20-abx927679 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PANK2 Antibody, HRP conjugated |
1-CSB-PA874850LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PANK2. Recognizes PANK2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
PANK2 Antibody, FITC conjugated |
1-CSB-PA874850LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PANK2. Recognizes PANK2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
PANK2 Antibody, Biotin conjugated |
1-CSB-PA874850LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PANK2. Recognizes PANK2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
PANK2 Blocking Peptide |
20-abx063983 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PANK2 cloning plasmid |
CSB-CL874850HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 405
- Sequence: atggcatctcgtggagatagcaccaaagtggataaactagtacgagatatttatggaggggactatgagaggtttggactgccaggctgggctgtggcttcaagctttggaaacatgatgagcaaggagaagcgagaggctgtcagtaaagaggacctggccagagcgactttgat
- Show more
|
Description: A cloning plasmid for the PANK2 gene. |
PANK2 Blocking Peptide |
DF8588-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-PANK2 (2B12) |
YF-MA11671 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PANK2 |
Pantothenate Kinase 2 (PANK2) Antibody |
20-abx114323 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Pantothenate Kinase 2 (PANK2) Antibody |
20-abx008032 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Pantothenate Kinase 2 (PANK2) Antibody |
20-abx217632 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Pantothenate Kinase 2 (PANK2) Antibody |
20-abx318220 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Pantothenate Kinase 2 (PANK2) Antibody |
abx236134-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Human PANK2 shRNA Plasmid |
20-abx962733 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PANK2 Recombinant Protein (Human) |
RP022510 |
ABM |
100 ug |
Ask for price |
PANK2 Recombinant Protein (Rat) |
RP219233 |
ABM |
100 ug |
Ask for price |
PANK2 Recombinant Protein (Mouse) |
RP160031 |
ABM |
100 ug |
Ask for price |
Pantothenate Kinase 2 (PANK2) Antibody (HRP) |
20-abx315132 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Pantothenate Kinase 2 (PANK2) Antibody (FITC) |
20-abx315133 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Pantothenate Kinase 2 (PANK2) Antibody (Biotin) |
20-abx315134 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
PANK2 ORF Vector (Human) (pORF) |
ORF007504 |
ABM |
1.0 ug DNA |
EUR 95 |
Pank2 ORF Vector (Rat) (pORF) |
ORF073079 |
ABM |
1.0 ug DNA |
EUR 506 |
Pank2 ORF Vector (Mouse) (pORF) |
ORF053345 |
ABM |
1.0 ug DNA |
EUR 506 |
PANK2 sgRNA CRISPR Lentivector set (Human) |
K1591501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Pank2 sgRNA CRISPR Lentivector set (Mouse) |
K4027701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Pank2 sgRNA CRISPR Lentivector set (Rat) |
K6058401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Pantothenate Kinase 2 (PANK2) ELISA Kit |
abx382044-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
PANK2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1591502 |
ABM |
1.0 ug DNA |
EUR 154 |
PANK2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1591503 |
ABM |
1.0 ug DNA |
EUR 154 |
PANK2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1591504 |
ABM |
1.0 ug DNA |
EUR 154 |
Pank2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4027702 |
ABM |
1.0 ug DNA |
EUR 154 |
Pank2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4027703 |
ABM |
1.0 ug DNA |
EUR 154 |
Pank2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4027704 |
ABM |
1.0 ug DNA |
EUR 154 |
Pank2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6058402 |
ABM |
1.0 ug DNA |
EUR 154 |
Pank2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6058403 |
ABM |
1.0 ug DNA |
EUR 154 |
Pank2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6058404 |
ABM |
1.0 ug DNA |
EUR 154 |
PANK2 Protein Vector (Human) (pPB-C-His) |
PV030013 |
ABM |
500 ng |
EUR 329 |
PANK2 Protein Vector (Human) (pPB-N-His) |
PV030014 |
ABM |
500 ng |
EUR 329 |
PANK2 Protein Vector (Human) (pPM-C-HA) |
PV030015 |
ABM |
500 ng |
EUR 329 |
PANK2 Protein Vector (Human) (pPM-C-His) |
PV030016 |
ABM |
500 ng |
EUR 329 |
PANK2 Protein Vector (Mouse) (pPB-C-His) |
PV213378 |
ABM |
500 ng |
EUR 603 |
PANK2 Protein Vector (Mouse) (pPB-N-His) |
PV213379 |
ABM |
500 ng |
EUR 603 |
PANK2 Protein Vector (Mouse) (pPM-C-HA) |
PV213380 |
ABM |
500 ng |
EUR 603 |
PANK2 Protein Vector (Mouse) (pPM-C-His) |
PV213381 |
ABM |
500 ng |
EUR 603 |
PANK2 Protein Vector (Rat) (pPB-C-His) |
PV292314 |
ABM |
500 ng |
EUR 603 |
PANK2 Protein Vector (Rat) (pPB-N-His) |
PV292315 |
ABM |
500 ng |
EUR 603 |
PANK2 Protein Vector (Rat) (pPM-C-HA) |
PV292316 |
ABM |
500 ng |
EUR 603 |
PANK2 Protein Vector (Rat) (pPM-C-His) |
PV292317 |
ABM |
500 ng |
EUR 603 |
Pank2 3'UTR GFP Stable Cell Line |
TU165879 |
ABM |
1.0 ml |
Ask for price |
PANK2 3'UTR Luciferase Stable Cell Line |
TU017363 |
ABM |
1.0 ml |
EUR 2333 |
Pank2 3'UTR Luciferase Stable Cell Line |
TU115879 |
ABM |
1.0 ml |
Ask for price |
PANK2 3'UTR GFP Stable Cell Line |
TU067363 |
ABM |
1.0 ml |
EUR 2333 |
Pank2 3'UTR GFP Stable Cell Line |
TU265788 |
ABM |
1.0 ml |
Ask for price |
Pank2 3'UTR Luciferase Stable Cell Line |
TU215788 |
ABM |
1.0 ml |
Ask for price |
Human Pantothenate kinase 2, mitochondrial, PANK2 ELISA KIT |
ELI-37781h |
Lifescience Market |
96 Tests |
EUR 824 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
PANK2 Rabbit Polyclonal Antibody