PANK2 Rabbit Polyclonal Antibody

PANK2 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

PANK2 Polyclonal Antibody

ABP59818-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PANK2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of PANK2 from Human. This PANK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PANK2 protein

PANK2 Polyclonal Antibody

ES11775-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PANK2. This antibody is tested and validated for WB, ELISA, WB, ELISA

PANK2 Polyclonal Antibody

ES11775-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PANK2. This antibody is tested and validated for WB, ELISA, WB, ELISA

PANK2 Rabbit pAb

A18502-100ul 100 ul
EUR 308

PANK2 Rabbit pAb

A18502-200ul 200 ul
EUR 459

PANK2 Rabbit pAb

A18502-20ul 20 ul
EUR 183

PANK2 Rabbit pAb

A18502-50ul 50 ul
EUR 223

PANK2 antibody

70R-19106 50 ul
EUR 435
Description: Rabbit polyclonal PANK2 antibody

PANK2 antibody

10R-5154 100 ul
EUR 691
Description: Mouse monoclonal PANK2 antibody

PANK2 antibody

10R-5155 100 ul
EUR 726
Description: Mouse monoclonal PANK2 antibody

PANK2 Antibody

45374-100ul 100ul
EUR 252

PANK2 Antibody

45374-50ul 50ul
EUR 187

PANK2 Antibody

1-CSB-PA874850LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PANK2. Recognizes PANK2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

PANK2 Antibody

DF8588 200ul
EUR 304
Description: PANK2 Antibody detects endogenous levels of total PANK2.

PANK2 Antibody

1-CSB-PA017422GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PANK2. Recognizes PANK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PANK2 antibody

70R-51108 100 ul
EUR 244
Description: Purified Polyclonal PANK2 antibody

PANK2 Antibody

ABD8588 100 ug
EUR 438

Polyclonal PANK2 Antibody (N-term)

APR08921G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PANK2 (N-term). This antibody is tested and proven to work in the following applications:

Anti-PANK2 Antibody

A02776 100ul
EUR 397
Description: Rabbit Polyclonal PANK2 Antibody. Validated in WB and tested in Human.

PANK2 Conjugated Antibody

C45374 100ul
EUR 397

anti- PANK2 antibody

FNab06134 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IP: 1:500-1:1000
  • IHC: 1:10-1:100
  • IF: 1:10-1:100
  • Immunogen: pantothenate kinase 2
  • Uniprot ID: Q9BZ23
  • Gene ID: 80025
  • Research Area: Metabolism
Description: Antibody raised against PANK2

Anti-PANK2 antibody

PAab06134 100 ug
EUR 355

Anti-PANK2 antibody

STJ11100453 100 µl
EUR 277

Anti-PANK2 antibody

STJ192933 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PANK2

PANK2 siRNA

20-abx927679
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pOTB7-PANK2

PVT12303 2 ug
EUR 391

PANK2 Antibody, HRP conjugated

1-CSB-PA874850LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PANK2. Recognizes PANK2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PANK2 Antibody, FITC conjugated

1-CSB-PA874850LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PANK2. Recognizes PANK2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PANK2 Antibody, Biotin conjugated

1-CSB-PA874850LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PANK2. Recognizes PANK2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PANK2 Blocking Peptide

DF8588-BP 1mg
EUR 195

PANK2 Blocking Peptide

20-abx063983
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

PANK2 cloning plasmid

CSB-CL874850HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 405
  • Sequence: atggcatctcgtggagatagcaccaaagtggataaactagtacgagatatttatggaggggactatgagaggtttggactgccaggctgggctgtggcttcaagctttggaaacatgatgagcaaggagaagcgagaggctgtcagtaaagaggacctggccagagcgactttgat
  • Show more
Description: A cloning plasmid for the PANK2 gene.

Anti-PANK2 (2B12)

YF-MA11671 100 ug
EUR 363
Description: Mouse monoclonal to PANK2

Pantothenate Kinase 2 (PANK2) Antibody

20-abx008032
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Pantothenate Kinase 2 (PANK2) Antibody

20-abx217632
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Pantothenate Kinase 2 (PANK2) Antibody

20-abx114323
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Pantothenate Kinase 2 (PANK2) Antibody

abx236134-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Pantothenate Kinase 2 (PANK2) Antibody

20-abx318220
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PANK2 ELISA KIT|Human

EF001546 96 Tests
EUR 689

Human PANK2 shRNA Plasmid

20-abx962733
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PANK2 Recombinant Protein (Human)

RP022510 100 ug Ask for price

PANK2 Recombinant Protein (Mouse)

RP160031 100 ug Ask for price

PANK2 Recombinant Protein (Rat)

RP219233 100 ug Ask for price

Pantothenate Kinase 2 (PANK2) Antibody (HRP)

20-abx315132
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Pantothenate Kinase 2 (PANK2) Antibody (FITC)

20-abx315133
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Pantothenate Kinase 2 (PANK2) Antibody (Biotin)

20-abx315134
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Pank2 ORF Vector (Rat) (pORF)

ORF073079 1.0 ug DNA
EUR 506

PANK2 ORF Vector (Human) (pORF)

ORF007504 1.0 ug DNA
EUR 95

Pank2 ORF Vector (Mouse) (pORF)

ORF053345 1.0 ug DNA
EUR 506

pECMV-Pank2-m-FLAG Plasmid

PVT14904 2 ug
EUR 325

Pank2 sgRNA CRISPR Lentivector set (Rat)

K6058401 3 x 1.0 ug
EUR 339

Pank2 sgRNA CRISPR Lentivector set (Mouse)

K4027701 3 x 1.0 ug
EUR 339

PANK2 sgRNA CRISPR Lentivector set (Human)

K1591501 3 x 1.0 ug
EUR 339

Human Pantothenate Kinase 2 (PANK2) ELISA Kit

abx382044-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Pank2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6058402 1.0 ug DNA
EUR 154

Pank2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6058403 1.0 ug DNA
EUR 154

Pank2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6058404 1.0 ug DNA
EUR 154

Pank2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4027702 1.0 ug DNA
EUR 154

Pank2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4027703 1.0 ug DNA
EUR 154

Pank2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4027704 1.0 ug DNA
EUR 154

PANK2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1591502 1.0 ug DNA
EUR 154

PANK2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1591503 1.0 ug DNA
EUR 154

PANK2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1591504 1.0 ug DNA
EUR 154

PANK2 Protein Vector (Rat) (pPB-C-His)

PV292314 500 ng
EUR 603

PANK2 Protein Vector (Rat) (pPB-N-His)

PV292315 500 ng
EUR 603

PANK2 Protein Vector (Rat) (pPM-C-HA)

PV292316 500 ng
EUR 603

PANK2 Protein Vector (Rat) (pPM-C-His)

PV292317 500 ng
EUR 603

PANK2 Protein Vector (Mouse) (pPB-C-His)

PV213378 500 ng
EUR 603

PANK2 Protein Vector (Mouse) (pPB-N-His)

PV213379 500 ng
EUR 603

PANK2 Protein Vector (Mouse) (pPM-C-HA)

PV213380 500 ng
EUR 603

PANK2 Protein Vector (Mouse) (pPM-C-His)

PV213381 500 ng
EUR 603

PANK2 Protein Vector (Human) (pPB-C-His)

PV030013 500 ng
EUR 329

PANK2 Protein Vector (Human) (pPB-N-His)

PV030014 500 ng
EUR 329

PANK2 Protein Vector (Human) (pPM-C-HA)

PV030015 500 ng
EUR 329

PANK2 Protein Vector (Human) (pPM-C-His)

PV030016 500 ng
EUR 329

Human Pantothenate Kinase 2(PANK2)ELISA Kit

QY-E03648 96T
EUR 361

Pank2 3'UTR Luciferase Stable Cell Line

TU115879 1.0 ml Ask for price

Pank2 3'UTR GFP Stable Cell Line

TU165879 1.0 ml Ask for price

Pank2 3'UTR Luciferase Stable Cell Line

TU215788 1.0 ml Ask for price

Pank2 3'UTR GFP Stable Cell Line

TU265788 1.0 ml Ask for price

PANK2 3'UTR GFP Stable Cell Line

TU067363 1.0 ml
EUR 2333

PANK2 3'UTR Luciferase Stable Cell Line

TU017363 1.0 ml
EUR 2333

Human Pantothenate kinase 2, mitochondrial, PANK2 ELISA KIT

ELI-37781h 96 Tests
EUR 824

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

PANK2 Rabbit Polyclonal Antibody