MATR3 Rabbit Polyclonal Antibody
To Order Now: info@poweratlas.org
MATR3 Polyclonal Antibody |
ABP59230-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human MATR3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of MATR3 from Human. This MATR3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MATR3 protein |
Human Matrin 3 (MATR3) ELISA Kit |
DLR-MATR3-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Matrin 3 (MATR3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Matrin 3 (MATR3) in samples from tissue homogenates or other biological fluids. |
Human Matrin 3 (MATR3) ELISA Kit |
DLR-MATR3-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Matrin 3 (MATR3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Matrin 3 (MATR3) in samples from tissue homogenates or other biological fluids. |
Human Matrin 3 (MATR3) ELISA Kit |
RD-MATR3-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Matrin 3 (MATR3) ELISA Kit |
RD-MATR3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Matrin 3 (MATR3) ELISA Kit |
RDR-MATR3-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Matrin 3 (MATR3) ELISA Kit |
RDR-MATR3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
MATR3 Rabbit pAb |
A5905-100ul |
Abclonal |
100 ul |
EUR 308 |
MATR3 Rabbit pAb |
A5905-200ul |
Abclonal |
200 ul |
EUR 459 |
MATR3 Rabbit pAb |
A5905-20ul |
Abclonal |
20 ul |
EUR 183 |
MATR3 Rabbit pAb |
A5905-50ul |
Abclonal |
50 ul |
EUR 223 |
MATR3 Antibody |
36602-100ul |
SAB |
100ul |
EUR 252 |
MATR3 antibody |
10R-10395 |
Fitzgerald |
100 ug |
EUR 435 |
Description: Mouse monoclonal MATR3 antibody |
MATR3 antibody |
10R-1442 |
Fitzgerald |
50 ug |
EUR 242 |
Description: Mouse monoclonal MATR3 antibody |
MATR3 antibody |
70R-18424 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal MATR3 antibody |
MATR3 Antibody |
1-CSB-PA013525GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against MATR3. Recognizes MATR3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
MATR3 Antibody |
1-CSB-PA272764 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against MATR3. Recognizes MATR3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000 |
MATR3 Antibody |
1-CSB-PA125471 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against MATR3. Recognizes MATR3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000 |
MATR3 Conjugated Antibody |
C36602 |
SAB |
100ul |
EUR 397 |
anti- MATR3 antibody |
FNab05030 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: matrin 3
- Uniprot ID: P43243
- Gene ID: 9782
- Research Area: Neuroscience
|
Description: Antibody raised against MATR3 |
Anti-MATR3 antibody |
STJ117820 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a nuclear matrix protein, which is proposed to stabilize certain messenger RNA species. Mutations of this gene are associated with distal myopathy 2, which often includes vocal cord and pharyngeal weakness. Alternatively spliced transcript variants, including read-through transcripts composed of the upstream small nucleolar RNA host gene 4 (non-protein coding) and matrin 3 gene sequence, have been identified. Pseudogenes of this gene are located on chromosomes 1 and X. |
Anti-MATR3 antibody |
STJ192931 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to MATR3 |
MATR3 siRNA |
20-abx903173 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MATR3 siRNA |
20-abx923628 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MATR3 siRNA |
20-abx923629 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Matrin 3 (MATR3) Antibody |
20-abx113617 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Matrin 3 (MATR3) Antibody |
abx018181-100ug |
Abbexa |
100 ug |
EUR 342 |
- Shipped within 5-10 working days.
|
Matrin 3 (MATR3) Antibody |
20-abx173467 |
Abbexa |
|
|
|
Matrin 3 (MATR3) Antibody |
20-abx177463 |
Abbexa |
|
|
|
Matrin 3 (MATR3) Antibody |
abx235030-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Matrin 3 (MATR3) Antibody |
20-abx213465 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Matrin 3 (MATR3) Antibody |
20-abx213466 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MATR3 cloning plasmid |
CSB-CL013525HU-10ug |
Cusabio |
10ug |
EUR 558 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2544
- Sequence: atgtccaagtcattccagcagtcatctctcagtagggactcacagggtcatgggcgtgacctgtctgcggcaggaataggccttcttgctgctgctacccagtctttaagtatgccagcatctcttggaaggatgaaccagggtactgcacgccttgctagtttaatgaatcttg
- Show more
|
Description: A cloning plasmid for the MATR3 gene. |
Rat MATR3 shRNA Plasmid |
20-abx985315 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human MATR3 shRNA Plasmid |
20-abx956544 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse MATR3 shRNA Plasmid |
20-abx971445 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human Matrin 3 (MATR3) Protein |
20-abx654280 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
MATR3 ORF Vector (Human) (pORF) |
ORF006294 |
ABM |
1.0 ug DNA |
EUR 95 |
Matr3 ORF Vector (Mouse) (pORF) |
ORF049866 |
ABM |
1.0 ug DNA |
EUR 506 |
Matr3 ORF Vector (Rat) (pORF) |
ORF070324 |
ABM |
1.0 ug DNA |
EUR 506 |
MATR3 ELISA Kit (Human) (OKCD01966) |
OKCD01966 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: May play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. In association with the SFPQ-NONO heteromer may play a role in nuclear retention of defective RNAs.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.117 ng/mL |
Human Matrin 3 (MATR3) ELISA Kit |
20-abx152280 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Matrin 3 (MATR3) CLIA Kit |
20-abx495516 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Mouse Matrin 3 (MATR3) ELISA Kit |
abx389823-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat Matrin 3 (MATR3) ELISA Kit |
abx391583-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
MATR3 sgRNA CRISPR Lentivector set (Human) |
K1273601 |
ABM |
3 x 1.0 ug |
EUR 339 |
MATR3 sgRNA CRISPR Lentivector set (Human) |
K2822501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Matr3 sgRNA CRISPR Lentivector set (Mouse) |
K4726501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Matrin-3(MATR3) ELISA kit |
CSB-EL013525HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Matrin-3 (MATR3) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Matrin-3(MATR3) ELISA kit |
1-CSB-EL013525HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Matrin-3(MATR3) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Matr3 sgRNA CRISPR Lentivector set (Rat) |
K6863001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Matrin 3 (MATR3) ELISA Kit |
SEH678Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Matrin 3 (MATR3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Matrin 3 (MATR3) in Tissue homogenates and other biological fluids. |
Human Matrin 3 (MATR3) ELISA Kit |
SEH678Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Matrin 3 (MATR3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Matrin 3 (MATR3) in Tissue homogenates and other biological fluids. |
Human Matrin 3 (MATR3) ELISA Kit |
SEH678Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Matrin 3 (MATR3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Matrin 3 (MATR3) in Tissue homogenates and other biological fluids. |
Human Matrin 3 (MATR3) ELISA Kit |
SEH678Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Matrin 3 (MATR3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Matrin 3 (MATR3) in Tissue homogenates and other biological fluids. |
Human Matrin 3 (MATR3) ELISA Kit |
4-SEH678Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Matrin 3 elisa. Alternative names of the recognized antigen: n/a
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Matrin 3 (MATR3) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
ELISA kit for Human MATR3 (Matrin 3) |
ELK4592 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Matrin 3 (MATR3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Matrin 3 (MATR3).
- Show more
|
Description: A sandwich ELISA kit for detection of Matrin 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
MATR3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1273602 |
ABM |
1.0 ug DNA |
EUR 154 |
MATR3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1273603 |
ABM |
1.0 ug DNA |
EUR 154 |
MATR3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1273604 |
ABM |
1.0 ug DNA |
EUR 154 |
MATR3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2822502 |
ABM |
1.0 ug DNA |
EUR 154 |
MATR3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2822503 |
ABM |
1.0 ug DNA |
EUR 154 |
MATR3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2822504 |
ABM |
1.0 ug DNA |
EUR 154 |
Matr3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4726502 |
ABM |
1.0 ug DNA |
EUR 154 |
Matr3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4726503 |
ABM |
1.0 ug DNA |
EUR 154 |
Matr3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4726504 |
ABM |
1.0 ug DNA |
EUR 154 |
ELISA kit for Rat Matrin-3 (MATR3) |
KTE100657-48T |
Abbkine |
48T |
EUR 332 |
- Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Matrin-3 (MATR3) |
KTE100657-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Matrin-3 (MATR3) |
KTE100657-96T |
Abbkine |
96T |
EUR 539 |
- Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Matr3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6863002 |
ABM |
1.0 ug DNA |
EUR 154 |
Matr3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6863003 |
ABM |
1.0 ug DNA |
EUR 154 |
Matr3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6863004 |
ABM |
1.0 ug DNA |
EUR 154 |
ELISA kit for Human Matrin-3 (MATR3) |
KTE61708-48T |
Abbkine |
48T |
EUR 332 |
- Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Matrin-3 (MATR3) |
KTE61708-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Matrin-3 (MATR3) |
KTE61708-96T |
Abbkine |
96T |
EUR 539 |
- Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Matrin-3 (MATR3) |
KTE71110-48T |
Abbkine |
48T |
EUR 332 |
- Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Matrin-3 (MATR3) |
KTE71110-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Matrin-3 (MATR3) |
KTE71110-96T |
Abbkine |
96T |
EUR 539 |
- Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
MATR3 Protein Vector (Rat) (pPB-C-His) |
PV281294 |
ABM |
500 ng |
EUR 1166 |
MATR3 Protein Vector (Rat) (pPB-N-His) |
PV281295 |
ABM |
500 ng |
EUR 1166 |
MATR3 Protein Vector (Rat) (pPM-C-HA) |
PV281296 |
ABM |
500 ng |
EUR 1166 |
MATR3 Protein Vector (Rat) (pPM-C-His) |
PV281297 |
ABM |
500 ng |
EUR 1166 |
MATR3 Protein Vector (Human) (pPB-C-His) |
PV025173 |
ABM |
500 ng |
EUR 329 |
MATR3 Rabbit Polyclonal Antibody