DERL2 Rabbit Polyclonal Antibody

DERL2 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

DERL2 Polyclonal Antibody

ABP58354-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human DERL2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of DERL2 from Human, Mouse. This DERL2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DERL2 protein

DERL2 Polyclonal Antibody

ES11968-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against DERL2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DERL2 Polyclonal Antibody

ES11968-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DERL2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Polyclonal DERL2 / Derlin-2 Antibody

APR15723G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DERL2 / Derlin-2 . This antibody is tested and proven to work in the following applications:

Anti-DERL2 antibody

STJ193126 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DERL2

DERL2 siRNA

20-abx914022
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DERL2 siRNA

20-abx914023
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Derlin-2 (DERL2) Antibody

abx030935-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Derlin-2 (DERL2) Antibody

abx030935-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

DERL2 cloning plasmid

CSB-CL880924HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 720
  • Sequence: atggcgtaccagagcttgcggctggagtacctgcagatcccaccggtcagccgcgcctacaccactgcctgcgtcctcaccaccgccgccgtgcagttggaattgatcacaccttttcagttgtacttcaatcctgaattaatctttaaacactttcaaatatggagattaatcac
  • Show more
Description: A cloning plasmid for the DERL2 gene.

Human DERL2 shRNA Plasmid

20-abx959450
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse DERL2 shRNA Plasmid

20-abx980207
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DERL2 Recombinant Protein (Human)

RP009169 100 ug Ask for price

DERL2 Recombinant Protein (Mouse)

RP128807 100 ug Ask for price

DERL2 ORF Vector (Human) (pORF)

ORF003057 1.0 ug DNA
EUR 95

Derl2 ORF Vector (Mouse) (pORF)

ORF042937 1.0 ug DNA
EUR 506

Mouse Derlin- 2, Derl2 ELISA KIT

ELI-26518m 96 Tests
EUR 865

Human Derlin- 2, DERL2 ELISA KIT

ELI-48610h 96 Tests
EUR 824

DERL2 sgRNA CRISPR Lentivector set (Human)

K0585301 3 x 1.0 ug
EUR 339

Derl2 sgRNA CRISPR Lentivector set (Mouse)

K4642101 3 x 1.0 ug
EUR 339

Human Derlin 2(DERL2)ELISA Kit

QY-E04983 96T
EUR 361

DERL2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0585302 1.0 ug DNA
EUR 154

DERL2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0585303 1.0 ug DNA
EUR 154

DERL2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0585304 1.0 ug DNA
EUR 154

Derl2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4642102 1.0 ug DNA
EUR 154

Derl2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4642103 1.0 ug DNA
EUR 154

Derl2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4642104 1.0 ug DNA
EUR 154

ELISA kit for Mouse Derlin-2 (DERL2)

KTE71308-48T 48T
EUR 332
  • Proteins that are unfolded or misfolded in the endoplasmic reticulum (ER) must be refolded or degraded to maintain the homeostasis of the ER. DERL2 is involved in the degradation of misfolded glycoproteins in the ER .
Description: Quantitative sandwich ELISA for measuring Mouse Derlin-2 (DERL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Derlin-2 (DERL2)

KTE71308-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Proteins that are unfolded or misfolded in the endoplasmic reticulum (ER) must be refolded or degraded to maintain the homeostasis of the ER. DERL2 is involved in the degradation of misfolded glycoproteins in the ER .
Description: Quantitative sandwich ELISA for measuring Mouse Derlin-2 (DERL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Derlin-2 (DERL2)

KTE71308-96T 96T
EUR 539
  • Proteins that are unfolded or misfolded in the endoplasmic reticulum (ER) must be refolded or degraded to maintain the homeostasis of the ER. DERL2 is involved in the degradation of misfolded glycoproteins in the ER .
Description: Quantitative sandwich ELISA for measuring Mouse Derlin-2 (DERL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Derlin-2 (DERL2)

KTE62090-48T 48T
EUR 332
  • Proteins that are unfolded or misfolded in the endoplasmic reticulum (ER) must be refolded or degraded to maintain the homeostasis of the ER. DERL2 is involved in the degradation of misfolded glycoproteins in the ER.
Description: Quantitative sandwich ELISA for measuring Human Derlin-2 (DERL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Derlin-2 (DERL2)

KTE62090-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Proteins that are unfolded or misfolded in the endoplasmic reticulum (ER) must be refolded or degraded to maintain the homeostasis of the ER. DERL2 is involved in the degradation of misfolded glycoproteins in the ER.
Description: Quantitative sandwich ELISA for measuring Human Derlin-2 (DERL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Derlin-2 (DERL2)

KTE62090-96T 96T
EUR 539
  • Proteins that are unfolded or misfolded in the endoplasmic reticulum (ER) must be refolded or degraded to maintain the homeostasis of the ER. DERL2 is involved in the degradation of misfolded glycoproteins in the ER.
Description: Quantitative sandwich ELISA for measuring Human Derlin-2 (DERL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

DERL2 Protein Vector (Mouse) (pPB-C-His)

PV171746 500 ng
EUR 603

DERL2 Protein Vector (Mouse) (pPB-N-His)

PV171747 500 ng
EUR 603

DERL2 Protein Vector (Mouse) (pPM-C-HA)

PV171748 500 ng
EUR 603

DERL2 Protein Vector (Mouse) (pPM-C-His)

PV171749 500 ng
EUR 603

DERL2 Protein Vector (Human) (pPB-C-His)

PV012225 500 ng
EUR 329

DERL2 Protein Vector (Human) (pPB-N-His)

PV012226 500 ng
EUR 329

DERL2 Protein Vector (Human) (pPM-C-HA)

PV012227 500 ng
EUR 329

DERL2 Protein Vector (Human) (pPM-C-His)

PV012228 500 ng
EUR 329

Derl2 3'UTR GFP Stable Cell Line

TU155081 1.0 ml Ask for price

Derl2 3'UTR Luciferase Stable Cell Line

TU105081 1.0 ml Ask for price

DERL2 3'UTR GFP Stable Cell Line

TU055833 1.0 ml
EUR 2333

DERL2 3'UTR Luciferase Stable Cell Line

TU005833 1.0 ml
EUR 2333

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

DERL2 Rabbit Polyclonal Antibody