DERL2 Rabbit Polyclonal Antibody
To Order Now: info@poweratlas.org
 DERL2 Polyclonal Antibody |
|
ABP58354-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human DERL2 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of DERL2 from Human, Mouse. This DERL2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DERL2 protein |
DERL2 Polyclonal Antibody |
|
ES11968-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against DERL2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
DERL2 Polyclonal Antibody |
|
ES11968-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against DERL2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 Polyclonal DERL2 / Derlin-2 Antibody |
|
APR15723G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DERL2 / Derlin-2 . This antibody is tested and proven to work in the following applications: |
 Anti-DERL2 antibody |
|
STJ193126 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to DERL2 |
 DERL2 siRNA |
|
20-abx914022 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DERL2 siRNA |
|
20-abx914023 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Antibody) Derlin-2 (DERL2) Antibody |
|
abx030935-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Derlin-2 (DERL2) Antibody |
|
abx030935-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
 DERL2 cloning plasmid |
|
CSB-CL880924HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 720
- Sequence: atggcgtaccagagcttgcggctggagtacctgcagatcccaccggtcagccgcgcctacaccactgcctgcgtcctcaccaccgccgccgtgcagttggaattgatcacaccttttcagttgtacttcaatcctgaattaatctttaaacactttcaaatatggagattaatcac
- Show more
|
|
Description: A cloning plasmid for the DERL2 gene. |
 Human DERL2 shRNA Plasmid |
|
20-abx959450 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse DERL2 shRNA Plasmid |
|
20-abx980207 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) DERL2 Recombinant Protein (Human) |
|
RP009169 |
ABM |
100 ug |
Ask for price |
) DERL2 Recombinant Protein (Mouse) |
|
RP128807 |
ABM |
100 ug |
Ask for price |
 (pORF)) DERL2 ORF Vector (Human) (pORF) |
|
ORF003057 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Derl2 ORF Vector (Mouse) (pORF) |
|
ORF042937 |
ABM |
1.0 ug DNA |
EUR 506 |
) DERL2 sgRNA CRISPR Lentivector set (Human) |
|
K0585301 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Derl2 sgRNA CRISPR Lentivector set (Mouse) |
|
K4642101 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) DERL2 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0585302 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) DERL2 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0585303 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) DERL2 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0585304 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Derl2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4642102 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Derl2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4642103 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Derl2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4642104 |
ABM |
1.0 ug DNA |
EUR 154 |
) ELISA kit for Mouse Derlin-2 (DERL2) |
|
KTE71308-48T |
Abbkine |
48T |
EUR 332 |
- Proteins that are unfolded or misfolded in the endoplasmic reticulum (ER) must be refolded or degraded to maintain the homeostasis of the ER. DERL2 is involved in the degradation of misfolded glycoproteins in the ER .
|
|
Description: Quantitative sandwich ELISA for measuring Mouse Derlin-2 (DERL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Derlin-2 (DERL2) |
|
KTE71308-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Proteins that are unfolded or misfolded in the endoplasmic reticulum (ER) must be refolded or degraded to maintain the homeostasis of the ER. DERL2 is involved in the degradation of misfolded glycoproteins in the ER .
|
|
Description: Quantitative sandwich ELISA for measuring Mouse Derlin-2 (DERL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Derlin-2 (DERL2) |
|
KTE71308-96T |
Abbkine |
96T |
EUR 539 |
- Proteins that are unfolded or misfolded in the endoplasmic reticulum (ER) must be refolded or degraded to maintain the homeostasis of the ER. DERL2 is involved in the degradation of misfolded glycoproteins in the ER .
|
|
Description: Quantitative sandwich ELISA for measuring Mouse Derlin-2 (DERL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
) ELISA kit for Human Derlin-2 (DERL2) |
|
KTE62090-48T |
Abbkine |
48T |
EUR 332 |
- Proteins that are unfolded or misfolded in the endoplasmic reticulum (ER) must be refolded or degraded to maintain the homeostasis of the ER. DERL2 is involved in the degradation of misfolded glycoproteins in the ER.
|
|
Description: Quantitative sandwich ELISA for measuring Human Derlin-2 (DERL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Derlin-2 (DERL2) |
|
KTE62090-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Proteins that are unfolded or misfolded in the endoplasmic reticulum (ER) must be refolded or degraded to maintain the homeostasis of the ER. DERL2 is involved in the degradation of misfolded glycoproteins in the ER.
|
|
Description: Quantitative sandwich ELISA for measuring Human Derlin-2 (DERL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Derlin-2 (DERL2) |
|
KTE62090-96T |
Abbkine |
96T |
EUR 539 |
- Proteins that are unfolded or misfolded in the endoplasmic reticulum (ER) must be refolded or degraded to maintain the homeostasis of the ER. DERL2 is involved in the degradation of misfolded glycoproteins in the ER.
|
|
Description: Quantitative sandwich ELISA for measuring Human Derlin-2 (DERL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
 (pPB-C-His)) DERL2 Protein Vector (Mouse) (pPB-C-His) |
|
PV171746 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) DERL2 Protein Vector (Mouse) (pPB-N-His) |
|
PV171747 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) DERL2 Protein Vector (Mouse) (pPM-C-HA) |
|
PV171748 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) DERL2 Protein Vector (Mouse) (pPM-C-His) |
|
PV171749 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) DERL2 Protein Vector (Human) (pPB-C-His) |
|
PV012225 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) DERL2 Protein Vector (Human) (pPB-N-His) |
|
PV012226 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) DERL2 Protein Vector (Human) (pPM-C-HA) |
|
PV012227 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) DERL2 Protein Vector (Human) (pPM-C-His) |
|
PV012228 |
ABM |
500 ng |
EUR 329 |
 Derl2 3'UTR GFP Stable Cell Line |
|
TU155081 |
ABM |
1.0 ml |
Ask for price |
 Derl2 3'UTR Luciferase Stable Cell Line |
|
TU105081 |
ABM |
1.0 ml |
Ask for price |
 DERL2 3'UTR GFP Stable Cell Line |
|
TU055833 |
ABM |
1.0 ml |
EUR 2333 |
 DERL2 3'UTR Luciferase Stable Cell Line |
|
TU005833 |
ABM |
1.0 ml |
EUR 2333 |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
DERL2 Rabbit Polyclonal Antibody
ELISA Kit)