CD8B Rabbit Polyclonal Antibody

CD8B Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

CD8B Polyclonal Antibody
ABP58076-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human CD8B protein Applications tips:
Description: A polyclonal antibody for detection of CD8B from Human. This CD8B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD8B protein

CD8B Polyclonal Antibody
ABP58076-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human CD8B protein Applications tips:
Description: A polyclonal antibody for detection of CD8B from Human. This CD8B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD8B protein

CD8B Polyclonal Antibody
ABP58076-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human CD8B protein Applications tips:
Description: A polyclonal antibody for detection of CD8B from Human. This CD8B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD8B protein

CD8B Polyclonal Antibody
30440-100ul	SAB	100ul	EUR 252

CD8B Polyclonal Antibody
30440-50ul	SAB	50ul	EUR 187

CD8B Rabbit pAb
A3286-100ul	Abclonal	100 ul	EUR 308

CD8B Rabbit pAb
A3286-200ul	Abclonal	200 ul	EUR 459

CD8B Rabbit pAb
A3286-20ul	Abclonal	20 ul	EUR 183

CD8B Rabbit pAb
A3286-50ul	Abclonal	50 ul	EUR 223

CD8B Polyclonal Conjugated Antibody
C30440	SAB	100ul	EUR 397

CD8B Antibody
AF5138	Affbiotech	200ul	EUR 304
Description: CD8B Antibody detects endogenous levels of total CD8B.

CD8B Antibody
ABF5138	Lifescience Market	100 ug	EUR 438

CD8b antibody
70R-51260	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal CD8b antibody

CD8B antibody
70R-8544	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal CD8B antibody

CD8B antibody
70R-5987	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal CD8B antibody raised against the middle region of CD8B

CD8B antibody
70R-5988	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal CD8B antibody raised against the N terminal of CD8B

CD8b antibody
10R-6339	Fitzgerald	50 ug	EUR 133
Description: Mouse monoclonal CD8b antibody

CD8b antibody
10R-CD8baCKp	Fitzgerald	500 ug	EUR 403
Description: Mouse monoclonal CD8b antibody

CD8B antibody
70R-16290	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal CD8B antibody

CD8B Antibody
1-CSB-PA004967ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CD8B. Recognizes CD8B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CD8B Antibody
1-CSB-PA004967GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CD8B. Recognizes CD8B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CD8B
PR27298	Neuromics	5 ug	EUR 191

anti- CD8B antibody
FNab01506	FN Test	100µg	EUR 505.25
Immunogen: CD8b molecule Uniprot ID: P10966 Gene ID: 926 Research Area: Immunology
Description: Antibody raised against CD8B

CD8b antibody (FITC)
61R-1045	Fitzgerald	50 ug	EUR 181
Description: Mouse monoclonal CD8b antibody (FITC)

CD8b antibody (PE)
61R-1204	Fitzgerald	100 ug	EUR 354
Description: Mouse monoclonal CD8b antibody (PE)

CD8b antibody (biotin)
61R-CD8baCKBT	Fitzgerald	500 ug	EUR 457
Description: Mouse monoclonal CD8b antibody (biotin)

CD8b antibody (FITC)
61R-CD8baCKFT	Fitzgerald	500 ug	EUR 565
Description: Mouse monoclonal CD8b antibody (FITC)

CD8b antibody (PE)
61R-CD8baCKPE	Fitzgerald	100 ug	EUR 349
Description: Mouse monoclonal CD8b antibody (PE)

Anti-CD8B antibody
PAab01506	Lifescience Market	100 ug	EUR 355

Anti-CD8B antibody
STJ23016	St John's Laboratory	100 µl	EUR 277
Description: The CD8 antigen is a cell surface glycoprotein found on most cytotoxic T lymphocytes that mediates efficient cell-cell interactions within the immune system. The CD8 antigen, acting as a coreceptor, and the T-cell receptor on the T lymphocyte recognize antigens displayed by an antigen presenting cell (APC) in the context of class I MHC molecules. The functional coreceptor is either a homodimer composed of two alpha chains, or a heterodimer composed of one alpha and one beta chain. Both alpha and beta chains share significant homology to immunoglobulin variable light chains. This gene encodes the CD8 beta chain isoforms. Multiple alternatively spliced transcript variants encoding distinct membrane associated or secreted isoforms have been described. A pseudogene, also located on chromosome 2, has been identified.

Anti-CD8b antibody
STJ16101131	St John's Laboratory	100 µg	EUR 354

Anti-CD8B antibody
STJ192945	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to CD8B

Cd8b/ Rat Cd8b ELISA Kit
ELI-10708r	Lifescience Market	96 Tests	EUR 886

CD8B siRNA
20-abx900925	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CD8B siRNA
20-abx911091	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CD8B siRNA
20-abx911092	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Mouse)
4-PAQ127Mu01	Cloud-Clone	EUR 266.00 EUR 2813.00 EUR 694.00 EUR 337.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD8b (Leu22~Thr175) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cluster Of Differentiation 8b (CD8b)

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Rat)
4-PAQ127Ra01	Cloud-Clone	EUR 275.00 EUR 2958.00 EUR 727.00 EUR 350.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD8b (Ala21~Lys208) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Cluster Of Differentiation 8b (CD8b)

CD8B Blocking Peptide
AF5138-BP	Affbiotech	1mg	EUR 195

CD8B cloning plasmid
CSB-CL004967HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 732 Sequence: ATGCGGCCGCGGCTGTGGCTCCTCCTGGCCGCGCAGCTGACAGTTCTCCATGGCAACTCAGTCCTCCAGCAGACCCCTGCATACATAAAGGTGCAAACCAACAAGATGGTGATGCTGTCCTGCGAGGCTAAAATCTCCCTCAGTAACATGCGCATCTACTGGCTGAGACAGCGCCA Show more
Description: A cloning plasmid for the CD8B gene.

CD8b Blocking Peptide
20-abx064135	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

CD8B, human recombinant
7320-100	Biovision		EUR 370

CD8B Blocking Peptide
33R-4582	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CD8B antibody, catalog no. 70R-5987

CD8B Blocking Peptide
33R-4815	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CD8B antibody, catalog no. 70R-8544

CD8B Blocking Peptide
33R-7989	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CD8B antibody, catalog no. 70R-5988

CD8A- CD8B Plasmid
PVT7144	Lifescience Market	2 ug	EUR 266

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Mouse), APC
4-PAQ127Mu01-APC	Cloud-Clone	EUR 374.00 EUR 3689.00 EUR 1016.00 EUR 481.00 EUR 232.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD8b (Leu22~Thr175) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cluster Of Differentiation 8b (CD8b). This antibody is labeled with APC.

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Mouse), Biotinylated
4-PAQ127Mu01-Biotin	Cloud-Clone	EUR 332.00 EUR 2763.00 EUR 803.00 EUR 411.00 EUR 228.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD8b (Leu22~Thr175) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cluster Of Differentiation 8b (CD8b). This antibody is labeled with Biotin.

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Mouse), Cy3
4-PAQ127Mu01-Cy3	Cloud-Clone	EUR 457.00 EUR 4877.00 EUR 1313.00 EUR 600.00 EUR 267.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD8b (Leu22~Thr175) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cluster Of Differentiation 8b (CD8b). This antibody is labeled with Cy3.

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Mouse), FITC
4-PAQ127Mu01-FITC	Cloud-Clone	EUR 319.00 EUR 2971.00 EUR 832.00 EUR 405.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD8b (Leu22~Thr175) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cluster Of Differentiation 8b (CD8b). This antibody is labeled with FITC.

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Mouse), HRP
4-PAQ127Mu01-HRP	Cloud-Clone	EUR 341.00 EUR 3213.00 EUR 897.00 EUR 433.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD8b (Leu22~Thr175) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cluster Of Differentiation 8b (CD8b). This antibody is labeled with HRP.

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Mouse), PE
4-PAQ127Mu01-PE	Cloud-Clone	EUR 319.00 EUR 2971.00 EUR 832.00 EUR 405.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD8b (Leu22~Thr175) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cluster Of Differentiation 8b (CD8b). This antibody is labeled with PE.

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Rat), APC
4-PAQ127Ra01-APC	Cloud-Clone	EUR 388.00 EUR 3887.00 EUR 1065.00 EUR 501.00 EUR 237.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD8b (Ala21~Lys208) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with APC.

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Rat), Biotinylated
4-PAQ127Ra01-Biotin	Cloud-Clone	EUR 343.00 EUR 2908.00 EUR 839.00 EUR 425.00 EUR 232.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD8b (Ala21~Lys208) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with Biotin.

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Rat), Cy3
4-PAQ127Ra01-Cy3	Cloud-Clone	EUR 476.00 EUR 5141.00 EUR 1379.00 EUR 626.00 EUR 275.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD8b (Ala21~Lys208) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with Cy3.

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Rat), FITC
4-PAQ127Ra01-FITC	Cloud-Clone	EUR 330.00 EUR 3129.00 EUR 872.00 EUR 420.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD8b (Ala21~Lys208) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with FITC.

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Rat), HRP
4-PAQ127Ra01-HRP	Cloud-Clone	EUR 353.00 EUR 3385.00 EUR 940.00 EUR 451.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD8b (Ala21~Lys208) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with HRP.

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Rat), PE
4-PAQ127Ra01-PE	Cloud-Clone	EUR 330.00 EUR 3129.00 EUR 872.00 EUR 420.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD8b (Ala21~Lys208) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with PE.

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Human, Mouse, Rat)
4-PAQ127Hu01	Cloud-Clone	EUR 261.00 EUR 2734.00 EUR 676.00 EUR 330.00 EUR 220.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD8b (Leu22~Pro170) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Cluster Of Differentiation 8b (CD8b)

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Mouse), APC-Cy7
4-PAQ127Mu01-APC-Cy7	Cloud-Clone	EUR 628.00 EUR 7258.00 EUR 1912.00 EUR 842.00 EUR 344.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD8b (Leu22~Thr175) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cluster Of Differentiation 8b (CD8b). This antibody is labeled with APC-Cy7.

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Rat), APC-Cy7
4-PAQ127Ra01-APC-Cy7	Cloud-Clone	EUR 657.00 EUR 7654.00 EUR 2011.00 EUR 882.00 EUR 355.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD8b (Ala21~Lys208) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with APC-Cy7.

Cluster of Differentiation 8b (CD8B) Antibody
20-abx111498	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Cluster of Differentiation 8b (CD8b) Antibody
20-abx102989	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Cluster of Differentiation 8b (CD8b) Antibody
20-abx102990	Abbexa	EUR 467.00 EUR 133.00 EUR 1344.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Cluster of Differentiation 8b (CD8b) Antibody
20-abx102991	Abbexa	EUR 481.00 EUR 133.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Cluster of Differentiation 8b (CD8b) Antibody
20-abx270089	Abbexa	EUR 523.00 EUR 606.00 EUR 300.00 EUR 940.00 EUR 384.00	100 tests 200 tests 25 tests 500 tests 50 tests
Shipped within 5-12 working days.

Cluster Of Differentiation 8b (CD8b) Antibody
20-abx171799	Abbexa	EUR 926.00 EUR 467.00	1 mg 200 ug
Please enquire.

Rat CD8B shRNA Plasmid
20-abx984715	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse Cd8b ELISA KIT
ELI-24836m	Lifescience Market	96 Tests	EUR 865

Human CD8B ELISA KIT
ELI-25164h	Lifescience Market	96 Tests	EUR 824

CD8B ELISA KIT|Human
EF008529	Lifescience Market	96 Tests	EUR 689

Human CD8B shRNA Plasmid
20-abx950654	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CD8B protein (His tag)
80R-3653	Fitzgerald	100 ug	EUR 327
Description: Purified recombinant CD8B protein (His tag)

Anti-Rt CD8b Purified
11-656-C100	ExBio	0.1 mg	EUR 131

Anti-Ms CD8b Purified
11-779-C025	ExBio	0.025 mg	EUR 99

Anti-Ms CD8b Purified
11-779-C100	ExBio	0.1 mg	EUR 158

Anti-Rt CD8b FITC
1F-656-C025	ExBio	0.025 mg	EUR 113

Anti-Rt CD8b FITC
1F-656-C100	ExBio	0.1 mg	EUR 186

Anti-Rt CD8b PE
1P-656-C025	ExBio	0.025 mg	EUR 122

Anti-Rt CD8b PE
1P-656-C100	ExBio	0.1 mg	EUR 204

Anti-Ms CD8b PE
1P-779-C025	ExBio	0.025 mg	EUR 122

Anti-Ms CD8b PE
1P-779-C100	ExBio	0.1 mg	EUR 204

Mouse CD8B shRNA Plasmid
20-abx969589	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CD8B Human Recombinant Protein
PROTP10966	BosterBio	Regular: 20ug	EUR 317
Description: CD8B Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 172 amino acids (22-170) and having a molecular mass of 19.2 kDa. CD8B is fused to a 23 amino acid His-tag at N-terminus.

CD8B Recombinant Protein (Human)
RP037924	ABM	100 ug	Ask for price

CD8B Recombinant Protein (Rat)
RP194051	ABM	100 ug	Ask for price

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Human, Mouse, Rat), APC
4-PAQ127Hu01-APC	Cloud-Clone	EUR 367.00 EUR 3581.00 EUR 989.00 EUR 470.00 EUR 228.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD8b (Leu22~Pro170) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with APC.

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Human, Mouse, Rat), Biotinylated
4-PAQ127Hu01-Biotin	Cloud-Clone	EUR 327.00 EUR 2684.00 EUR 783.00 EUR 403.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD8b (Leu22~Pro170) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with Biotin.

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Human, Mouse, Rat), Cy3
4-PAQ127Hu01-Cy3	Cloud-Clone	EUR 447.00 EUR 4733.00 EUR 1277.00 EUR 585.00 EUR 263.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD8b (Leu22~Pro170) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with Cy3.

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Human, Mouse, Rat), FITC
4-PAQ127Hu01-FITC	Cloud-Clone	EUR 313.00 EUR 2884.00 EUR 811.00 EUR 396.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD8b (Leu22~Pro170) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with FITC.

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Human, Mouse, Rat), HRP
4-PAQ127Hu01-HRP	Cloud-Clone	EUR 334.00 EUR 3120.00 EUR 873.00 EUR 424.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD8b (Leu22~Pro170) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with HRP.

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Human, Mouse, Rat), PE
4-PAQ127Hu01-PE	Cloud-Clone	EUR 313.00 EUR 2884.00 EUR 811.00 EUR 396.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD8b (Leu22~Pro170) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with PE.

Cluster of Differentiation 8b (CD8b) Antibody (FITC)
20-abx270387	Abbexa	EUR 592.00 EUR 704.00 EUR 328.00 EUR 1107.00 EUR 439.00	100 tests 200 tests 25 tests 500 tests 50 tests
Shipped within 5-15 working days.

Cluster of Differentiation 8b (CD8b) Antibody (APC)
20-abx270619	Abbexa	EUR 815.00 EUR 968.00 EUR 411.00 EUR 1567.00 EUR 565.00	100 tests 200 tests 25 tests 500 tests 50 tests
Shipped within 5-15 working days.

Cluster of Differentiation 8b (CD8b) Antibody (PE)
20-abx270851	Abbexa	EUR 704.00 EUR 829.00 EUR 370.00 EUR 1330.00 EUR 495.00	100 tests 200 tests 25 tests 500 tests 50 tests
Shipped within 5-15 working days.

Human CellExp? CD8b, Human Recombinant
P1244-10	Biovision		EUR 240

Human CellExp? CD8b, Human Recombinant
P1244-1000	Biovision		Ask for price

Human CellExp? CD8b, Human Recombinant
P1244-250	Biovision		Ask for price

Human CellExp? CD8b, Human Recombinant
P1244-50	Biovision		EUR 805

CD8B ORF Vector (Human) (pORF)
ORF012642	ABM	1.0 ug DNA	EUR 354

Cd8b ORF Vector (Rat) (pORF)
ORF064685	ABM	1.0 ug DNA	EUR 506

CD8B ELISA Kit (Human) (OKCD00721)
OKCD00721	Aviva Systems Biology	96 Wells	EUR 909
Description: Description of target: Identifies cytotoxic/suppressor T-cells that interact with MHC class I bearing targets. CD8 is thought to play a role in the process of T-cell mediated killing. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.58 ng/mL

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Human, Mouse, Rat), APC-Cy7
4-PAQ127Hu01-APC-Cy7	Cloud-Clone	EUR 614.00 EUR 7042.00 EUR 1858.00 EUR 821.00 EUR 337.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CD8b (Leu22~Pro170) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with APC-Cy7.

Rat Monoclonal Anti-Mouse CD8b (Ly 3), APC (Clone CT-CD8b) (rat IgG2a)
MCD008B-APC	Alpha Diagnostics	50 tests	EUR 408

CD8B Rabbit Polyclonal Antibody