CD8B Rabbit Polyclonal Antibody

CD8B Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

CD8B Polyclonal Antibody

ABP58076-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human CD8B protein
  • Applications tips:
Description: A polyclonal antibody for detection of CD8B from Human. This CD8B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD8B protein

CD8B Polyclonal Antibody

ABP58076-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CD8B protein
  • Applications tips:
Description: A polyclonal antibody for detection of CD8B from Human. This CD8B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD8B protein

CD8B Polyclonal Antibody

ABP58076-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CD8B protein
  • Applications tips:
Description: A polyclonal antibody for detection of CD8B from Human. This CD8B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD8B protein

CD8B Polyclonal Antibody

30440-100ul 100ul
EUR 252

CD8B Polyclonal Antibody

30440-50ul 50ul
EUR 187

CD8B Rabbit pAb

A3286-100ul 100 ul
EUR 308

CD8B Rabbit pAb

A3286-200ul 200 ul
EUR 459

CD8B Rabbit pAb

A3286-20ul 20 ul
EUR 183

CD8B Rabbit pAb

A3286-50ul 50 ul
EUR 223

CD8B Polyclonal Conjugated Antibody

C30440 100ul
EUR 397

CD8B Antibody

AF5138 200ul
EUR 304
Description: CD8B Antibody detects endogenous levels of total CD8B.

CD8B Antibody

ABF5138 100 ug
EUR 438

CD8b antibody

70R-51260 100 ul
EUR 244
Description: Purified Polyclonal CD8b antibody

CD8B antibody

70R-8544 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CD8B antibody

CD8B antibody

70R-5987 50 ug
EUR 467
Description: Rabbit polyclonal CD8B antibody raised against the middle region of CD8B

CD8B antibody

70R-5988 50 ug
EUR 467
Description: Rabbit polyclonal CD8B antibody raised against the N terminal of CD8B

CD8b antibody

10R-6339 50 ug
EUR 133
Description: Mouse monoclonal CD8b antibody

CD8b antibody

10R-CD8baCKp 500 ug
EUR 403
Description: Mouse monoclonal CD8b antibody

CD8B antibody

70R-16290 50 ul
EUR 435
Description: Rabbit polyclonal CD8B antibody

CD8B Antibody

1-CSB-PA004967ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CD8B. Recognizes CD8B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CD8B Antibody

1-CSB-PA004967GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CD8B. Recognizes CD8B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CD8B

PR27298 5 ug
EUR 191

anti- CD8B antibody

FNab01506 100µg
EUR 505.25
  • Immunogen: CD8b molecule
  • Uniprot ID: P10966
  • Gene ID: 926
  • Research Area: Immunology
Description: Antibody raised against CD8B

CD8b antibody (FITC)

61R-1045 50 ug
EUR 181
Description: Mouse monoclonal CD8b antibody (FITC)

CD8b antibody (PE)

61R-1204 100 ug
EUR 354
Description: Mouse monoclonal CD8b antibody (PE)

CD8b antibody (biotin)

61R-CD8baCKBT 500 ug
EUR 457
Description: Mouse monoclonal CD8b antibody (biotin)

CD8b antibody (FITC)

61R-CD8baCKFT 500 ug
EUR 565
Description: Mouse monoclonal CD8b antibody (FITC)

CD8b antibody (PE)

61R-CD8baCKPE 100 ug
EUR 349
Description: Mouse monoclonal CD8b antibody (PE)

Anti-CD8B antibody

PAab01506 100 ug
EUR 355

Anti-CD8B antibody

STJ23016 100 µl
EUR 277
Description: The CD8 antigen is a cell surface glycoprotein found on most cytotoxic T lymphocytes that mediates efficient cell-cell interactions within the immune system. The CD8 antigen, acting as a coreceptor, and the T-cell receptor on the T lymphocyte recognize antigens displayed by an antigen presenting cell (APC) in the context of class I MHC molecules. The functional coreceptor is either a homodimer composed of two alpha chains, or a heterodimer composed of one alpha and one beta chain. Both alpha and beta chains share significant homology to immunoglobulin variable light chains. This gene encodes the CD8 beta chain isoforms. Multiple alternatively spliced transcript variants encoding distinct membrane associated or secreted isoforms have been described. A pseudogene, also located on chromosome 2, has been identified.

Anti-CD8b antibody

STJ16101131 100 µg
EUR 354

Anti-CD8B antibody

STJ192945 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CD8B

Cd8b/ Rat Cd8b ELISA Kit

ELI-10708r 96 Tests
EUR 886

CD8B siRNA

20-abx900925
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CD8B siRNA

20-abx911091
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CD8B siRNA

20-abx911092
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Mouse)

4-PAQ127Mu01
  • EUR 266.00
  • EUR 2813.00
  • EUR 694.00
  • EUR 337.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD8b (Leu22~Thr175)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cluster Of Differentiation 8b (CD8b)

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Rat)

4-PAQ127Ra01
  • EUR 275.00
  • EUR 2958.00
  • EUR 727.00
  • EUR 350.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD8b (Ala21~Lys208)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Cluster Of Differentiation 8b (CD8b)

CD8B Blocking Peptide

AF5138-BP 1mg
EUR 195

CD8B cloning plasmid

CSB-CL004967HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 732
  • Sequence: ATGCGGCCGCGGCTGTGGCTCCTCCTGGCCGCGCAGCTGACAGTTCTCCATGGCAACTCAGTCCTCCAGCAGACCCCTGCATACATAAAGGTGCAAACCAACAAGATGGTGATGCTGTCCTGCGAGGCTAAAATCTCCCTCAGTAACATGCGCATCTACTGGCTGAGACAGCGCCA
  • Show more
Description: A cloning plasmid for the CD8B gene.

CD8b Blocking Peptide

20-abx064135
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

CD8B, human recombinant

7320-100
EUR 370

CD8B Blocking Peptide

33R-4582 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CD8B antibody, catalog no. 70R-5987

CD8B Blocking Peptide

33R-4815 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CD8B antibody, catalog no. 70R-8544

CD8B Blocking Peptide

33R-7989 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CD8B antibody, catalog no. 70R-5988

CD8A- CD8B Plasmid

PVT7144 2 ug
EUR 266

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Mouse), APC

4-PAQ127Mu01-APC
  • EUR 374.00
  • EUR 3689.00
  • EUR 1016.00
  • EUR 481.00
  • EUR 232.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD8b (Leu22~Thr175)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cluster Of Differentiation 8b (CD8b). This antibody is labeled with APC.

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Mouse), Biotinylated

4-PAQ127Mu01-Biotin
  • EUR 332.00
  • EUR 2763.00
  • EUR 803.00
  • EUR 411.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD8b (Leu22~Thr175)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cluster Of Differentiation 8b (CD8b). This antibody is labeled with Biotin.

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Mouse), Cy3

4-PAQ127Mu01-Cy3
  • EUR 457.00
  • EUR 4877.00
  • EUR 1313.00
  • EUR 600.00
  • EUR 267.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD8b (Leu22~Thr175)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cluster Of Differentiation 8b (CD8b). This antibody is labeled with Cy3.

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Mouse), FITC

4-PAQ127Mu01-FITC
  • EUR 319.00
  • EUR 2971.00
  • EUR 832.00
  • EUR 405.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD8b (Leu22~Thr175)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cluster Of Differentiation 8b (CD8b). This antibody is labeled with FITC.

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Mouse), HRP

4-PAQ127Mu01-HRP
  • EUR 341.00
  • EUR 3213.00
  • EUR 897.00
  • EUR 433.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD8b (Leu22~Thr175)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cluster Of Differentiation 8b (CD8b). This antibody is labeled with HRP.

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Mouse), PE

4-PAQ127Mu01-PE
  • EUR 319.00
  • EUR 2971.00
  • EUR 832.00
  • EUR 405.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD8b (Leu22~Thr175)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cluster Of Differentiation 8b (CD8b). This antibody is labeled with PE.

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Rat), APC

4-PAQ127Ra01-APC
  • EUR 388.00
  • EUR 3887.00
  • EUR 1065.00
  • EUR 501.00
  • EUR 237.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD8b (Ala21~Lys208)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with APC.

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Rat), Biotinylated

4-PAQ127Ra01-Biotin
  • EUR 343.00
  • EUR 2908.00
  • EUR 839.00
  • EUR 425.00
  • EUR 232.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD8b (Ala21~Lys208)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with Biotin.

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Rat), Cy3

4-PAQ127Ra01-Cy3
  • EUR 476.00
  • EUR 5141.00
  • EUR 1379.00
  • EUR 626.00
  • EUR 275.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD8b (Ala21~Lys208)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with Cy3.

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Rat), FITC

4-PAQ127Ra01-FITC
  • EUR 330.00
  • EUR 3129.00
  • EUR 872.00
  • EUR 420.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD8b (Ala21~Lys208)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with FITC.

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Rat), HRP

4-PAQ127Ra01-HRP
  • EUR 353.00
  • EUR 3385.00
  • EUR 940.00
  • EUR 451.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD8b (Ala21~Lys208)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with HRP.

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Rat), PE

4-PAQ127Ra01-PE
  • EUR 330.00
  • EUR 3129.00
  • EUR 872.00
  • EUR 420.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD8b (Ala21~Lys208)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with PE.

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Human, Mouse, Rat)

4-PAQ127Hu01
  • EUR 261.00
  • EUR 2734.00
  • EUR 676.00
  • EUR 330.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD8b (Leu22~Pro170)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Cluster Of Differentiation 8b (CD8b)

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Mouse), APC-Cy7

4-PAQ127Mu01-APC-Cy7
  • EUR 628.00
  • EUR 7258.00
  • EUR 1912.00
  • EUR 842.00
  • EUR 344.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD8b (Leu22~Thr175)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cluster Of Differentiation 8b (CD8b). This antibody is labeled with APC-Cy7.

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Rat), APC-Cy7

4-PAQ127Ra01-APC-Cy7
  • EUR 657.00
  • EUR 7654.00
  • EUR 2011.00
  • EUR 882.00
  • EUR 355.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD8b (Ala21~Lys208)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with APC-Cy7.

Cluster of Differentiation 8b (CD8B) Antibody

20-abx111498
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cluster of Differentiation 8b (CD8b) Antibody

20-abx102989
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Cluster of Differentiation 8b (CD8b) Antibody

20-abx102990
  • EUR 467.00
  • EUR 133.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Cluster of Differentiation 8b (CD8b) Antibody

20-abx102991
  • EUR 481.00
  • EUR 133.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Cluster of Differentiation 8b (CD8b) Antibody

20-abx270089
  • EUR 523.00
  • EUR 606.00
  • EUR 300.00
  • EUR 940.00
  • EUR 384.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-12 working days.

Cluster Of Differentiation 8b (CD8b) Antibody

20-abx171799
  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Rat CD8B shRNA Plasmid

20-abx984715
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Cd8b ELISA KIT

ELI-24836m 96 Tests
EUR 865

Human CD8B ELISA KIT

ELI-25164h 96 Tests
EUR 824

CD8B ELISA KIT|Human

EF008529 96 Tests
EUR 689

Human CD8B shRNA Plasmid

20-abx950654
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CD8B protein (His tag)

80R-3653 100 ug
EUR 327
Description: Purified recombinant CD8B protein (His tag)

Anti-Rt CD8b Purified

11-656-C100 0.1 mg
EUR 131

Anti-Ms CD8b Purified

11-779-C025 0.025 mg
EUR 99

Anti-Ms CD8b Purified

11-779-C100 0.1 mg
EUR 158

Anti-Rt CD8b FITC

1F-656-C025 0.025 mg
EUR 113

Anti-Rt CD8b FITC

1F-656-C100 0.1 mg
EUR 186

Anti-Rt CD8b PE

1P-656-C025 0.025 mg
EUR 122

Anti-Rt CD8b PE

1P-656-C100 0.1 mg
EUR 204

Anti-Ms CD8b PE

1P-779-C025 0.025 mg
EUR 122

Anti-Ms CD8b PE

1P-779-C100 0.1 mg
EUR 204

Mouse CD8B shRNA Plasmid

20-abx969589
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CD8B Human Recombinant Protein

PROTP10966 Regular: 20ug
EUR 317
Description: CD8B Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 172 amino acids (22-170) and having a molecular mass of 19.2 kDa. CD8B is fused to a 23 amino acid His-tag at N-terminus.

CD8B Recombinant Protein (Human)

RP037924 100 ug Ask for price

CD8B Recombinant Protein (Rat)

RP194051 100 ug Ask for price

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Human, Mouse, Rat), APC

4-PAQ127Hu01-APC
  • EUR 367.00
  • EUR 3581.00
  • EUR 989.00
  • EUR 470.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD8b (Leu22~Pro170)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with APC.

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Human, Mouse, Rat), Biotinylated

4-PAQ127Hu01-Biotin
  • EUR 327.00
  • EUR 2684.00
  • EUR 783.00
  • EUR 403.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD8b (Leu22~Pro170)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with Biotin.

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Human, Mouse, Rat), Cy3

4-PAQ127Hu01-Cy3
  • EUR 447.00
  • EUR 4733.00
  • EUR 1277.00
  • EUR 585.00
  • EUR 263.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD8b (Leu22~Pro170)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with Cy3.

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Human, Mouse, Rat), FITC

4-PAQ127Hu01-FITC
  • EUR 313.00
  • EUR 2884.00
  • EUR 811.00
  • EUR 396.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD8b (Leu22~Pro170)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with FITC.

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Human, Mouse, Rat), HRP

4-PAQ127Hu01-HRP
  • EUR 334.00
  • EUR 3120.00
  • EUR 873.00
  • EUR 424.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD8b (Leu22~Pro170)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with HRP.

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Human, Mouse, Rat), PE

4-PAQ127Hu01-PE
  • EUR 313.00
  • EUR 2884.00
  • EUR 811.00
  • EUR 396.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD8b (Leu22~Pro170)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with PE.

Cluster of Differentiation 8b (CD8b) Antibody (FITC)

20-abx270387
  • EUR 592.00
  • EUR 704.00
  • EUR 328.00
  • EUR 1107.00
  • EUR 439.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-15 working days.

Cluster of Differentiation 8b (CD8b) Antibody (APC)

20-abx270619
  • EUR 815.00
  • EUR 968.00
  • EUR 411.00
  • EUR 1567.00
  • EUR 565.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-15 working days.

Cluster of Differentiation 8b (CD8b) Antibody (PE)

20-abx270851
  • EUR 704.00
  • EUR 829.00
  • EUR 370.00
  • EUR 1330.00
  • EUR 495.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-15 working days.

Human CellExp? CD8b, Human Recombinant

P1244-10
EUR 240

Human CellExp? CD8b, Human Recombinant

P1244-1000 Ask for price

Human CellExp? CD8b, Human Recombinant

P1244-250 Ask for price

Human CellExp? CD8b, Human Recombinant

P1244-50
EUR 805

CD8B ORF Vector (Human) (pORF)

ORF012642 1.0 ug DNA
EUR 354

Cd8b ORF Vector (Rat) (pORF)

ORF064685 1.0 ug DNA
EUR 506

CD8B ELISA Kit (Human) (OKCD00721)

OKCD00721 96 Wells
EUR 909
Description: Description of target: Identifies cytotoxic/suppressor T-cells that interact with MHC class I bearing targets. CD8 is thought to play a role in the process of T-cell mediated killing. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.58 ng/mL

Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Human, Mouse, Rat), APC-Cy7

4-PAQ127Hu01-APC-Cy7
  • EUR 614.00
  • EUR 7042.00
  • EUR 1858.00
  • EUR 821.00
  • EUR 337.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CD8b (Leu22~Pro170)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with APC-Cy7.

Rat Monoclonal Anti-Mouse CD8b (Ly 3), APC (Clone CT-CD8b) (rat IgG2a)

MCD008B-APC 50 tests
EUR 408

CD8B Rabbit Polyclonal Antibody