GNB1L Rabbit Polyclonal Antibody

GNB1L Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

GNB1L Polyclonal Antibody

ABP58656-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human GNB1L protein
  • Applications tips:
Description: A polyclonal antibody for detection of GNB1L from Human, Mouse. This GNB1L antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GNB1L protein

GNB1L Polyclonal Antibody

ES11904-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GNB1L from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

GNB1L Polyclonal Antibody

ES11904-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GNB1L from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

GNB1L Rabbit pAb

A7810-100ul 100 ul
EUR 308

GNB1L Rabbit pAb

A7810-200ul 200 ul
EUR 459

GNB1L Rabbit pAb

A7810-20ul 20 ul
EUR 183

GNB1L Rabbit pAb

A7810-50ul 50 ul
EUR 223

GNB1L antibody

70R-1642 100 ug
EUR 377
Description: Rabbit polyclonal GNB1L antibody

GNB1L Antibody

47128-100ul 100ul
EUR 252

GNB1L Antibody

1-CSB-PA866315ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GNB1L. Recognizes GNB1L from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

GNB1L Antibody

1-CSB-PA866315ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GNB1L. Recognizes GNB1L from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

GNB1L Conjugated Antibody

C47128 100ul
EUR 397

Anti-GNB1L antibody

STJ110120 100 µl
EUR 277
Description: This gene encodes a G-protein beta-subunit-like polypeptide which is a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein contains 6 WD repeats and is highly expressed in the heart. The gene maps to the region on chromosome 22q11, which is deleted in DiGeorge syndrome, trisomic in derivative 22 syndrome and tetrasomic in cat-eye syndrome. Therefore, this gene may contribute to the etiology of those disorders. Transcripts from this gene share exons with some transcripts from the C22orf29 gene.

Anti-GNB1L antibody

STJ193062 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GNB1L

GNB1L siRNA

20-abx918170
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNB1L siRNA

20-abx918171
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNB1L Blocking Peptide

33R-8245 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNB1L antibody, catalog no. 70R-1642

GNB1L cloning plasmid

CSB-CL866315HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 984
  • Sequence: atgacggccccctgcccgccgccacctccagacccccagtttgtcctccgaggcacccagtcaccggtgcatgcgctgcacttctgcgaaggagcccaggctcaggggcgcccgctcctcttctcagggtctcagagtggcctggtacacatctggagcctgcagacgcggagagc
  • Show more
Description: A cloning plasmid for the GNB1L gene.

pENTR223-GNB1L vector

PVT11722 2 ug
EUR 304

Mouse Gnb1l ELISA KIT

ELI-09738m 96 Tests
EUR 865

Human GNB1L ELISA KIT

ELI-27253h 96 Tests
EUR 824

Human GNB1L shRNA Plasmid

20-abx960145
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GNB1L shRNA Plasmid

20-abx970227
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pECMV-3-FLAG-GNB1L

PVT13573 2 ug
EUR 599

GNB1L Recombinant Protein (Human)

RP013507 100 ug Ask for price

GNB1L Recombinant Protein (Mouse)

RP138965 100 ug Ask for price

GNB1L Recombinant Protein (Mouse)

RP138968 100 ug Ask for price

GNB1L ORF Vector (Human) (pORF)

ORF004503 1.0 ug DNA
EUR 95

Gnb1l ORF Vector (Mouse) (pORF)

ORF046323 1.0 ug DNA
EUR 506

Gnb1l ORF Vector (Mouse) (pORF)

ORF046324 1.0 ug DNA
EUR 506

GNB1L Western Blot kit (AWBK41328)

AWBK41328 10 reactions
EUR 647
Description:
  • Description of target:
  • Species reactivity:
  • Application:
  • Assay info:
  • Sensitivity:

Gnb1l sgRNA CRISPR Lentivector set (Mouse)

K4819201 3 x 1.0 ug
EUR 339

GNB1L sgRNA CRISPR Lentivector set (Human)

K0876001 3 x 1.0 ug
EUR 339

Gnb1l sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4819202 1.0 ug DNA
EUR 154

Gnb1l sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4819203 1.0 ug DNA
EUR 154

Gnb1l sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4819204 1.0 ug DNA
EUR 154

GNB1L sgRNA CRISPR Lentivector (Human) (Target 1)

K0876002 1.0 ug DNA
EUR 154

GNB1L sgRNA CRISPR Lentivector (Human) (Target 2)

K0876003 1.0 ug DNA
EUR 154

GNB1L sgRNA CRISPR Lentivector (Human) (Target 3)

K0876004 1.0 ug DNA
EUR 154

GNB1L Protein Vector (Mouse) (pPB-C-His)

PV185290 500 ng
EUR 603

GNB1L Protein Vector (Mouse) (pPB-N-His)

PV185291 500 ng
EUR 603

GNB1L Protein Vector (Mouse) (pPM-C-HA)

PV185292 500 ng
EUR 603

GNB1L Protein Vector (Mouse) (pPM-C-His)

PV185293 500 ng
EUR 603

GNB1L Protein Vector (Mouse) (pPB-C-His)

PV185294 500 ng
EUR 603

GNB1L Protein Vector (Mouse) (pPB-N-His)

PV185295 500 ng
EUR 603

GNB1L Protein Vector (Mouse) (pPM-C-HA)

PV185296 500 ng
EUR 603

GNB1L Protein Vector (Mouse) (pPM-C-His)

PV185297 500 ng
EUR 603

GNB1L Protein Vector (Human) (pPB-C-His)

PV018009 500 ng
EUR 329

GNB1L Protein Vector (Human) (pPB-N-His)

PV018010 500 ng
EUR 329

GNB1L Protein Vector (Human) (pPM-C-HA)

PV018011 500 ng
EUR 329

GNB1L Protein Vector (Human) (pPM-C-His)

PV018012 500 ng
EUR 329

Recombinant Human GNB1L Protein, GST, E.coli-100ug

QP8085-ec-100ug 100ug
EUR 571

Recombinant Human GNB1L Protein, GST, E.coli-10ug

QP8085-ec-10ug 10ug
EUR 272

Recombinant Human GNB1L Protein, GST, E.coli-1mg

QP8085-ec-1mg 1mg
EUR 2303

Recombinant Human GNB1L Protein, GST, E.coli-200ug

QP8085-ec-200ug 200ug
EUR 898

Recombinant Human GNB1L Protein, GST, E.coli-500ug

QP8085-ec-500ug 500ug
EUR 1514

Recombinant Human GNB1L Protein, GST, E.coli-50ug

QP8085-ec-50ug 50ug
EUR 362

Gnb1l 3'UTR Luciferase Stable Cell Line

TU108858 1.0 ml Ask for price

Gnb1l 3'UTR Luciferase Stable Cell Line

TU205217 1.0 ml Ask for price

Gnb1l 3'UTR GFP Stable Cell Line

TU158858 1.0 ml Ask for price

Gnb1l 3'UTR GFP Stable Cell Line

TU255217 1.0 ml Ask for price

GNB1L 3'UTR GFP Stable Cell Line

TU058984 1.0 ml
EUR 4617

GNB1L 3'UTR Luciferase Stable Cell Line

TU008984 1.0 ml
EUR 4617

Guanine Nucleotide-Binding Protein Subunit Beta-Like Protein 1 (GNB1L) Antibody

20-abx006541
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Guanine Nucleotide-Binding Protein Subunit Beta-Like Protein 1 (GNB1L) Antibody

20-abx321945
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Guanine Nucleotide-Binding Protein Subunit Beta-Like Protein 1 (GNB1L) Antibody

20-abx322540
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

GNB1L Rabbit Polyclonal Antibody