HMGA1 Rabbit Polyclonal Antibody

HMGA1 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

HMGA1 Polyclonal Antibody

ABP58799-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human HMGA1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of HMGA1 from Human, Mouse, Rat. This HMGA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HMGA1 protein

HMGA1 Polyclonal Antibody

ES11843-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HMGA1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

HMGA1 Polyclonal Antibody

ES11843-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HMGA1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

HMGA1 Rabbit pAb

A1635-100ul 100 ul
EUR 308

HMGA1 Rabbit pAb

A1635-200ul 200 ul
EUR 459

HMGA1 Rabbit pAb

A1635-20ul 20 ul
EUR 183

HMGA1 Rabbit pAb

A1635-50ul 50 ul
EUR 223

HMGA1 Rabbit pAb

A12693-100ul 100 ul
EUR 308

HMGA1 Rabbit pAb

A12693-200ul 200 ul
EUR 459

HMGA1 Rabbit pAb

A12693-20ul 20 ul
EUR 183

HMGA1 Rabbit pAb

A12693-50ul 50 ul
EUR 223

HMGA1 Rabbit mAb

A4343-100ul 100 ul
EUR 410

HMGA1 Rabbit mAb

A4343-200ul 200 ul
EUR 571

HMGA1 Rabbit mAb

A4343-20ul 20 ul
EUR 221

HMGA1 Rabbit mAb

A4343-50ul 50 ul
EUR 287

Polyclonal HMGIY / HMGA1 Antibody

APG01093G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human HMGIY / HMGA1 . This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-HMGA1 Antibody

APG00159G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-HMGA1 . This antibody is tested and proven to work in the following applications:

Polyclonal HMGIY / HMGA1 Antibody (Internal)

APG01040G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human HMGIY / HMGA1 (Internal). This antibody is tested and proven to work in the following applications:

Polyclonal HMGA1 Antibody (C-term)

APR06143G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HMGA1 (C-term). This antibody is tested and proven to work in the following applications:

HMGA1 Antibody

47493-100ul 100ul
EUR 252

HMGA1 Antibody

47751-100ul 100ul
EUR 252

HMGA1 Antibody

1-CSB-PA983341
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HMGA1. Recognizes HMGA1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200

HMGA1 Antibody

1-CSB-PA230265
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HMGA1. Recognizes HMGA1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

HMGA1 antibody

70R-51289 100 ul
EUR 244
Description: Purified Polyclonal HMGA1 antibody

HMGA1 Antibody

AF5218 200ul
EUR 304
Description: HMGA1 Antibody detects endogenous levels of total HMGA1.

HMGA1 Antibody

ABF5218 100 ug
EUR 438

Canine High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit

DLR-HMGA1-c-48T 48T
EUR 570
  • Should the Canine High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Canine High Mobility Group AT Hook Protein 1 (HMGA1) in samples from tissue homogenates or other biological fluids.

Canine High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit

DLR-HMGA1-c-96T 96T
EUR 747
  • Should the Canine High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Canine High Mobility Group AT Hook Protein 1 (HMGA1) in samples from tissue homogenates or other biological fluids.

Human High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit

DLR-HMGA1-Hu-48T 48T
EUR 517
  • Should the Human High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human High Mobility Group AT Hook Protein 1 (HMGA1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit

DLR-HMGA1-Hu-96T 96T
EUR 673
  • Should the Human High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human High Mobility Group AT Hook Protein 1 (HMGA1) in samples from tissue homogenates, cell lysates or other biological fluids.

Canine High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit

RDR-HMGA1-c-48Tests 48 Tests
EUR 608

Canine High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit

RDR-HMGA1-c-96Tests 96 Tests
EUR 847

Human High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit

RDR-HMGA1-Hu-48Tests 48 Tests
EUR 544

Human High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit

RDR-HMGA1-Hu-96Tests 96 Tests
EUR 756

Canine High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit

RD-HMGA1-c-48Tests 48 Tests
EUR 581

Canine High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit

RD-HMGA1-c-96Tests 96 Tests
EUR 809

Human High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit

RD-HMGA1-Hu-48Tests 48 Tests
EUR 521

Human High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit

RD-HMGA1-Hu-96Tests 96 Tests
EUR 723

Polyclonal HMGIY / HMGA1 Antibody (aa1-53)

APR03322G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HMGIY / HMGA1 (aa1-53). This antibody is tested and proven to work in the following applications:

HMGA1 Conjugated Antibody

C47751 100ul
EUR 397

HMGA1 Conjugated Antibody

C47493 100ul
EUR 397

Anti-HMGA1 antibody

STJ28051 100 µl
EUR 277
Description: This gene encodes a chromatin-associated protein involved in the regulation of gene transcription, integration of retroviruses into chromosomes, and the metastatic progression of cancer cells. The encoded protein preferentially binds to the minor groove of AT-rich regions in double-stranded DNA. Multiple transcript variants encoding different isoforms have been found for this gene. Pseudogenes of this gene have been identified on multiple chromosomes.

Anti-HMGA1 antibody

STJ114566 100 µl
EUR 277
Description: This gene encodes a chromatin-associated protein involved in the regulation of gene transcription, integration of retroviruses into chromosomes, and the metastatic progression of cancer cells. The encoded protein preferentially binds to the minor groove of AT-rich regions in double-stranded DNA. Multiple transcript variants encoding different isoforms have been found for this gene. Pseudogenes of this gene have been identified on multiple chromosomes.

Anti-HMGA1 antibody

STJ193001 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to HMGA1

Anti-HMGA1 antibody

STJ70745 100 µg
EUR 359

Hmga1/ Rat Hmga1 ELISA Kit

ELI-04846r 96 Tests
EUR 886

Polyclonal Goat Anti-HMGA1 (aa9-21) Antibody

APG00158G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-HMGA1 (aa9-21) . This antibody is tested and proven to work in the following applications:

HMGA1 siRNA

20-abx902480
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HMGA1 siRNA

20-abx919597
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HMGA1 siRNA

20-abx919598
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Anti-HMGA1 (aa9-21) antibody

STJ71997 100 µg
EUR 359

HMGA1 Blocking Peptide

20-abx064164
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

HMGA1 Blocking Peptide

AF5218-BP 1mg
EUR 195

HMGA1 cloning plasmid

CSB-CL010545HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 291
  • Sequence: atgagtgagtcgagctcgaagtccagccagcccttggcctccaagcaggaaaaggacggcactgagaagcggggccggggcaggccgcgcaagcagcctccgaaggagcccagcgaagtgccaacacctaagagacctcggggccgaccaaagggaagcaaaaacaagggtgctgc
  • Show more
Description: A cloning plasmid for the HMGA1 gene.

HMGA1 cloning plasmid

CSB-CL010545HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 324
  • Sequence: atgagtgagtcgagctcgaagtccagccagcccttggcctccaagcaggaaaaggacggcactgagaagcggggccggggcaggccgcgcaagcagcctccggtgagtcccgggacagcgctggtagggagtcagaaggagcccagcgaagtgccaacacctaagagacctcgggg
  • Show more
Description: A cloning plasmid for the HMGA1 gene.

HMGA1 protein (His tag)

80R-1896 50 ug
EUR 397
Description: Purified recombinant HMGA1 protein

Human HMGA1 ELISA Kit

ELA-E1478h 96 Tests
EUR 824

Canine HMGA1 ELISA KIT

ELI-04845d 96 Tests
EUR 928

HMGA1 ELISA KIT|Human

EF005799 96 Tests
EUR 689

Rat HMGA1 shRNA Plasmid

20-abx987402
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human HMGA1 shRNA Plasmid

20-abx952156
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse HMGA1 shRNA Plasmid

20-abx970825
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

HMGA1 Recombinant Protein (Human)

RP014968 100 ug Ask for price

HMGA1 Recombinant Protein (Human)

RP014971 100 ug Ask for price

HMGA1 Recombinant Protein (Rat)

RP204716 100 ug Ask for price

HMGA1 Recombinant Protein (Mouse)

RP141815 100 ug Ask for price

HMGA1 Recombinant Protein (Mouse)

RP141818 100 ug Ask for price

HMGA1 Recombinant Protein (Mouse)

RP141821 100 ug Ask for price

HMGA1 Recombinant Protein (Mouse)

RP141824 100 ug Ask for price

HMGA1 Recombinant Protein (Mouse)

RP141827 100 ug Ask for price

HMGA1 Recombinant Protein (Mouse)

RP141830 100 ug Ask for price

HMGA1 Recombinant Protein (Mouse)

RP141833 100 ug Ask for price

HMGA1 Recombinant Protein (Mouse)

RP141836 100 ug Ask for price

HMGA1 Recombinant Protein (Mouse)

RP141839 100 ug Ask for price

HMGA1 Recombinant Protein (Mouse)

RP141842 100 ug Ask for price

HMGA1 Recombinant Protein (Mouse)

RP141845 100 ug Ask for price

HMGA1 Recombinant Protein (Mouse)

RP141848 100 ug Ask for price

HMGA1 Recombinant Protein (Mouse)

RP141851 100 ug Ask for price

HMGA1 Recombinant Protein (Mouse)

RP141854 100 ug Ask for price

High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Human)

4-PAC050Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Glu3~Gln107)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human High Mobility Group AT Hook Protein 1 (HMGA1)

High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Mouse)

4-PAC050Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Met1~Gln107)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse High Mobility Group AT Hook Protein 1 (HMGA1)

High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Rat)

4-PAC050Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Met1~Gln107)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat High Mobility Group AT Hook Protein 1 (HMGA1)

Hmga1 ORF Vector (Rat) (pORF)

ORF068240 1.0 ug DNA
EUR 506

HMGA1 ORF Vector (Human) (pORF)

ORF004990 1.0 ug DNA
EUR 95

HMGA1 ORF Vector (Human) (pORF)

ORF004991 1.0 ug DNA
EUR 95

Hmga1 ORF Vector (Mouse) (pORF)

ORF047273 1.0 ug DNA
EUR 506

Hmga1 ORF Vector (Mouse) (pORF)

ORF047274 1.0 ug DNA
EUR 506

Hmga1 ORF Vector (Mouse) (pORF)

ORF047275 1.0 ug DNA
EUR 506

Hmga1 ORF Vector (Mouse) (pORF)

ORF047276 1.0 ug DNA
EUR 506

Hmga1 ORF Vector (Mouse) (pORF)

ORF047277 1.0 ug DNA
EUR 506

Hmga1 ORF Vector (Mouse) (pORF)

ORF047278 1.0 ug DNA
EUR 506

Hmga1 ORF Vector (Mouse) (pORF)

ORF047279 1.0 ug DNA
EUR 506

Hmga1 ORF Vector (Mouse) (pORF)

ORF047280 1.0 ug DNA
EUR 506

Hmga1 ORF Vector (Mouse) (pORF)

ORF047281 1.0 ug DNA
EUR 506

Hmga1 ORF Vector (Mouse) (pORF)

ORF047282 1.0 ug DNA
EUR 506

Hmga1 ORF Vector (Mouse) (pORF)

ORF047283 1.0 ug DNA
EUR 506

Hmga1 ORF Vector (Mouse) (pORF)

ORF047284 1.0 ug DNA
EUR 506

Hmga1 ORF Vector (Mouse) (pORF)

ORF047285 1.0 ug DNA
EUR 506

Hmga1 ORF Vector (Mouse) (pORF)

ORF047286 1.0 ug DNA
EUR 506

Hmga1-rs1 Recombinant Protein (Mouse)

RP141857 100 ug Ask for price

Hmga1-rs1 Recombinant Protein (Mouse)

RP141860 100 ug Ask for price

HMGA1 ELISA Kit (Human) (OKAN06579)

OKAN06579 96 Wells
EUR 792
Description: Description of target: This gene encodes a chromatin-associated protein involved in the regulation of gene transcription, integration of retroviruses into chromosomes, and the metastatic progression of cancer cells. The encoded protein preferentially binds to the minor groove of AT-rich regions in double-stranded DNA. Multiple transcript variants encoding different isoforms have been found for this gene. Pseudogenes of this gene have been identified on multiple chromosomes.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.112 ng/mL

HMGA1 ELISA Kit (Dog) (OKCD02589)

OKCD02589 96 Wells
EUR 936
Description: Description of target: HMG-I/Y bind preferentially to the minor groove of A+T rich regions in double-stranded DNA. It is suggested that these proteins could function in nucleosome phasing and in the 3'-end processing of mRNA transcripts. They are also involved in the transcription regulation of genes containing, or in close proximity to A+T-rich regions. ;Species reactivity: Dog;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.115 ng/mL

HMGA1 ELISA Kit (Human) (OKCD07955)

OKCD07955 96 Wells
EUR 975
Description: Description of target: This gene encodes a chromatin-associated protein involved in the regulation of gene transcription, integration of retroviruses into chromosomes, and the metastatic progression of cancer cells. The encoded protein preferentially binds to the minor groove of AT-rich regions in double-stranded DNA. Multiple transcript variants encoding different isoforms have been found for this gene. Pseudogenes of this gene have been identified on multiple chromosomes.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.112ng/mL

HMGA1 ELISA Kit (Human) (OKEH04469)

OKEH04469 96 Wells
EUR 662
Description: Description of target: This gene encodes a chromatin-associated protein involved in the regulation of gene transcription, integration of retroviruses into chromosomes, and the metastatic progression of cancer cells. The encoded protein preferentially binds to the minor groove of AT-rich regions in double-stranded DNA. Multiple transcript variants encoding different isoforms have been found for this gene. Pseudogenes of this gene have been identified on multiple chromosomes.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.039 ng/mL

HMGA1 ELISA Kit (Rat) (OKEH06159)

OKEH06159 96 Wells
EUR 662
Description: Description of target: HMG-I/Y bind preferentially to the minor groove of A+T rich regions in double-stranded DNA. It is suggested that these proteins could function in nucleosome phasing and in the 3'-end processing of mRNA transcripts. They are also involved in the transcription regulation of genes containing, or in close proximity to A+T-rich regions.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.089 ng/mL

High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Human), APC

4-PAC050Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Glu3~Gln107)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with APC.

High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Human), Biotinylated

4-PAC050Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Glu3~Gln107)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with Biotin.

High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Human), Cy3

4-PAC050Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Glu3~Gln107)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with Cy3.

High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Human), FITC

4-PAC050Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Glu3~Gln107)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with FITC.

High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Human), HRP

4-PAC050Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Glu3~Gln107)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with HRP.

High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Human), PE

4-PAC050Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Glu3~Gln107)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with PE.

High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Mouse), APC

4-PAC050Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Met1~Gln107)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with APC.

High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Mouse), Biotinylated

4-PAC050Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Met1~Gln107)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with Biotin.

High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Mouse), Cy3

4-PAC050Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Met1~Gln107)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with Cy3.

High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Mouse), FITC

4-PAC050Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Met1~Gln107)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with FITC.

High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Mouse), HRP

4-PAC050Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Met1~Gln107)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with HRP.

High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Mouse), PE

4-PAC050Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Met1~Gln107)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with PE.

High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Rat), APC

4-PAC050Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Met1~Gln107)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with APC.

High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Rat), Biotinylated

4-PAC050Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Met1~Gln107)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with Biotin.

High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Rat), Cy3

4-PAC050Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Met1~Gln107)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with Cy3.

High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Rat), FITC

4-PAC050Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Met1~Gln107)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with FITC.

High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Rat), HRP

4-PAC050Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Met1~Gln107)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with HRP.

High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Rat), PE

4-PAC050Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Met1~Gln107)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with PE.

High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Human), APC-Cy7

4-PAC050Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Glu3~Gln107)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with APC-Cy7.

High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Mouse), APC-Cy7

4-PAC050Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Met1~Gln107)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with APC-Cy7.

High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Rat), APC-Cy7

4-PAC050Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HMGA1 (Met1~Gln107)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with APC-Cy7.

Hmga1 sgRNA CRISPR Lentivector set (Rat)

K7016301 3 x 1.0 ug
EUR 339

Hmga1 sgRNA CRISPR Lentivector set (Mouse)

K4428901 3 x 1.0 ug
EUR 339

HMGA1 sgRNA CRISPR Lentivector set (Human)

K0969001 3 x 1.0 ug
EUR 339

Hmga1-rs1 ORF Vector (Mouse) (pORF)

ORF047287 1.0 ug DNA
EUR 506

Hmga1-rs1 ORF Vector (Mouse) (pORF)

ORF047288 1.0 ug DNA
EUR 506

HMGA1-RS1 ELISA Kit (Mouse) (OKEH05471)

OKEH05471 96 Wells
EUR 662
Description: Description of target: HMG-I/Y bind preferentially to the minor groove of A+T rich regions in double-stranded DNA. It is suggested that these proteins could function in nucleosome phasing and in the 3'-end processing of mRNA transcripts. They are also involved in the transcription regulation of genes containing, or in close proximity to A+T-rich regions. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.088 ng/mL

High Mobility Group AT Hook Protein 1 (HMGA1) Antibody

20-abx214938
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

High Mobility Group AT Hook Protein 1 (HMGA1) Antibody

20-abx176838
  • EUR 1358.00
  • EUR 648.00
  • 1 mg
  • 200 ug
  • Please enquire.

High Mobility Group AT Hook Protein 1 (HMGA1) Antibody

20-abx104010
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

High Mobility Group AT Hook Protein 1 (HMGA1) Antibody

20-abx104011
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

High Mobility Group AT Hook Protein 1 (HMGA1) Antibody

20-abx104012
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

High Mobility Group AT Hook Protein 1 (HMGA1) Antibody

20-abx172807
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

High Mobility Group AT Hook Protein 1 (HMGA1) Antibody

20-abx172808
  • EUR 940.00
  • EUR 481.00
  • 1 mg
  • 200 ug
  • Please enquire.

High Mobility Group AT Hook Protein 1 (HMGA1) Antibody

20-abx242352
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

HMGA1 Rabbit Polyclonal Antibody