VPS11 Rabbit Polyclonal Antibody

VPS11 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

VPS11 Polyclonal Antibody

ABP60900-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human VPS11 protein
  • Applications tips:
Description: A polyclonal antibody for detection of VPS11 from Human, Mouse. This VPS11 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VPS11 protein

VPS11 Polyclonal Antibody

ES11948-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VPS11 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

VPS11 Polyclonal Antibody

ES11948-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VPS11 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

VPS11 antibody

22313-100ul 100ul
EUR 390

VPS11 antibody

70R-13100 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal VPS11 antibody

VPS11 antibody

70R-21262 50 ul
EUR 435
Description: Rabbit polyclonal VPS11 antibody

VPS11 Antibody

1-CSB-PA887959ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against VPS11. Recognizes VPS11 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

VPS11 Antibody

1-CSB-PA887959ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against VPS11. Recognizes VPS11 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

VPS11 Antibody

DF12500 200ul
EUR 304
Description: VPS11 antibody detects endogenous levels of VPS11.

VPS11 Antibody

1-CSB-PA025889GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against VPS11. Recognizes VPS11 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal VPS11 Antibody (internal region)

AMM08468G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human VPS11 (internal region). This antibody is tested and proven to work in the following applications:

anti- VPS11 antibody

FNab09426 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • IF: 1:10-1:100
  • IP: 1:200-1:2000
  • FC:N/A
  • Immunogen: vacuolar protein sorting 11 homolog(S. cerevisiae)
  • Uniprot ID: Q9H270
  • Gene ID: 55823
  • Research Area: Signal Transduction
Description: Antibody raised against VPS11

Anti-VPS11 antibody

PAab09426 100 ug
EUR 386

Anti-VPS11 antibody

STJ193106 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to VPS11

Anti-VPS11 antibody

STJ70733 100 µg
EUR 359

VPS11 siRNA

20-abx939490
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

VPS11 siRNA

20-abx939491
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-VPS11

YF-PA19866 50 ul
EUR 363
Description: Mouse polyclonal to VPS11

anti-VPS11

YF-PA26370 50 ul
EUR 334
Description: Mouse polyclonal to VPS11

VPS11 Blocking Peptide

DF12500-BP 1mg
EUR 195

VPS11 cloning plasmid

CSB-CL887959HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 996
  • Sequence: atgagtgaagtgcagccagactcaccccaggggatctacgacacactccttgagctgcgactgcagaactgggcccacgagaaggatccacaggtcaaagagaagcttcacgcagaggccatttccctgctgaagagtggtcgcttctgtgacgtctttgacaaggccctggtcct
  • Show more
Description: A cloning plasmid for the VPS11 gene.

Anti-VPS11 (1H1)

YF-MA11572 100 ug
EUR 363
Description: Mouse monoclonal to VPS11

VPS11 ELISA KIT|Human

EF004207 96 Tests
EUR 689

Mouse Vps11 ELISA KIT

ELI-51416m 96 Tests
EUR 865

Mouse VPS11 shRNA Plasmid

20-abx977482
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human VPS11 shRNA Plasmid

20-abx960949
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human VPS11 ELISA KIT

ELI-40616h 96 Tests
EUR 824

Monoclonal VPS11 Antibody (monoclonal) (M01), Clone: 1H1

AMM08469G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human VPS11 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1H1. This antibody is applicable in WB

Vps11 ORF Vector (Mouse) (pORF)

ORF061625 1.0 ug DNA
EUR 506

Vps11 ORF Vector (Rat) (pORF)

ORF078996 1.0 ug DNA
EUR 506

VPS11 ORF Vector (Human) (pORF)

ORF011454 1.0 ug DNA
EUR 95

VPS11 Rabbit Polyclonal Antibody