VPS11 Rabbit Polyclonal Antibody
To Order Now: info@poweratlas.org
VPS11 Polyclonal Antibody |
ABP60900-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human VPS11 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of VPS11 from Human, Mouse. This VPS11 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VPS11 protein |
VPS11 Polyclonal Antibody |
ABP60900-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human VPS11 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of VPS11 from Human, Mouse. This VPS11 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VPS11 protein |
VPS11 Polyclonal Antibody |
ABP60900-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human VPS11 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of VPS11 from Human, Mouse. This VPS11 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VPS11 protein |
VPS11 antibody |
70R-21262 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal VPS11 antibody |
VPS11 antibody |
22313-100ul |
SAB |
100ul |
EUR 390 |
VPS11 antibody |
70R-13100 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal VPS11 antibody |
VPS11 Antibody |
1-CSB-PA887959ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against VPS11. Recognizes VPS11 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
VPS11 Antibody |
1-CSB-PA887959ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against VPS11. Recognizes VPS11 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
VPS11 Antibody |
DF12500 |
Affbiotech |
200ul |
EUR 304 |
Description: VPS11 antibody detects endogenous levels of VPS11. |
VPS11 Antibody |
1-CSB-PA025889GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against VPS11. Recognizes VPS11 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Polyclonal VPS11 Antibody (internal region) |
AMM08468G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human VPS11 (internal region). This antibody is tested and proven to work in the following applications: |
anti- VPS11 antibody |
FNab09426 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:5000
- IF: 1:10-1:100
- IP: 1:200-1:2000
- FC:N/A
- Immunogen: vacuolar protein sorting 11 homolog(S. cerevisiae)
- Uniprot ID: Q9H270
- Gene ID: 55823
- Research Area: Signal Transduction
|
Description: Antibody raised against VPS11 |
Anti-VPS11 antibody |
STJ193106 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to VPS11 |
VPS11 siRNA |
20-abx939490 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
VPS11 siRNA |
20-abx939491 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-VPS11 |
YF-PA19866 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to VPS11 |
anti-VPS11 |
YF-PA26370 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to VPS11 |
VPS11 Blocking Peptide |
DF12500-BP |
Affbiotech |
1mg |
EUR 195 |
VPS11 cloning plasmid |
CSB-CL887959HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 996
- Sequence: atgagtgaagtgcagccagactcaccccaggggatctacgacacactccttgagctgcgactgcagaactgggcccacgagaaggatccacaggtcaaagagaagcttcacgcagaggccatttccctgctgaagagtggtcgcttctgtgacgtctttgacaaggccctggtcct
- Show more
|
Description: A cloning plasmid for the VPS11 gene. |
Anti-VPS11 (1H1) |
YF-MA11572 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to VPS11 |
Mouse VPS11 shRNA Plasmid |
20-abx977482 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human VPS11 shRNA Plasmid |
20-abx960949 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Monoclonal VPS11 Antibody (monoclonal) (M01), Clone: 1H1 |
AMM08469G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human VPS11 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1H1. This antibody is applicable in WB |
Vps11 ORF Vector (Rat) (pORF) |
ORF078996 |
ABM |
1.0 ug DNA |
EUR 506 |
VPS11 ORF Vector (Human) (pORF) |
ORF011454 |
ABM |
1.0 ug DNA |
EUR 95 |
Vps11 ORF Vector (Mouse) (pORF) |
ORF061625 |
ABM |
1.0 ug DNA |
EUR 506 |
VPS11 Rabbit Polyclonal Antibody