WDFY1 Rabbit Polyclonal Antibody
To Order Now: info@poweratlas.org
WDFY1 Polyclonal Antibody |
ABP60912-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human WDFY1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of WDFY1 from Human. This WDFY1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human WDFY1 protein |
WDFY1 Polyclonal Antibody |
ABP60912-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human WDFY1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of WDFY1 from Human. This WDFY1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human WDFY1 protein |
WDFY1 Polyclonal Antibody |
ABP60912-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human WDFY1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of WDFY1 from Human. This WDFY1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human WDFY1 protein |
WDFY1 antibody |
70R-4012 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal WDFY1 antibody raised against the N terminal of WDFY1 |
WDFY1 Antibody |
46708-100ul |
SAB |
100ul |
EUR 252 |
WDFY1 Antibody |
1-CSB-PA816890LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against WDFY1. Recognizes WDFY1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000 |
Polyclonal WDFY1 antibody - N-terminal region |
AMM08508G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WDFY1 - N-terminal region. This antibody is tested and proven to work in the following applications: |
Polyclonal FENS1 / WDFY1 Antibody (C-Term) |
APR15946G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human FENS1 / WDFY1 (C-Term). This antibody is tested and proven to work in the following applications: |
WDFY1 Conjugated Antibody |
C46708 |
SAB |
100ul |
EUR 397 |
WDFY1 Antibody (HRP) |
20-abx315463 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
WDFY1 Antibody (FITC) |
20-abx315464 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
WDFY1 Antibody (Biotin) |
20-abx315465 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-WDFY1 antibody |
STJ192901 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to WDFY1 |
WDFY1 siRNA |
20-abx939669 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
WDFY1 Antibody, HRP conjugated |
1-CSB-PA816890LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against WDFY1. Recognizes WDFY1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
WDFY1 Antibody, FITC conjugated |
1-CSB-PA816890LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against WDFY1. Recognizes WDFY1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
WDFY1 Antibody, Biotin conjugated |
1-CSB-PA816890LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against WDFY1. Recognizes WDFY1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
WDFY1 Blocking Peptide |
33R-5591 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of WDFY1 antibody, catalog no. 70R-4012 |
WDFY1 cloning plasmid |
CSB-CL816890HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1233
- Sequence: atggcggccgaaatccactccaggccgcagagcagccgcccggtgctgctgagcaagatcgaggggcaccaggacgccgtcacggccgcgctgctcatccccaaggaggacggcgtgatcacggccagcgaggacagaaccatccgggtatggctgaaaagagacagtggtcaat
- Show more
|
Description: A cloning plasmid for the WDFY1 gene. |
Human WDFY1 shRNA Plasmid |
20-abx961562 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
WDFY1 Recombinant Protein (Human) |
RP034543 |
ABM |
100 ug |
Ask for price |
WDFY1 Recombinant Protein (Rat) |
RP237194 |
ABM |
100 ug |
Ask for price |
WDFY1 Recombinant Protein (Mouse) |
RP185174 |
ABM |
100 ug |
Ask for price |
WDFY1 Recombinant Protein (Mouse) |
RP185177 |
ABM |
100 ug |
Ask for price |
Wdfy1 ORF Vector (Rat) (pORF) |
ORF079066 |
ABM |
1.0 ug DNA |
EUR 506 |
WDFY1 ORF Vector (Human) (pORF) |
ORF011515 |
ABM |
1.0 ug DNA |
EUR 95 |
Wdfy1 ORF Vector (Mouse) (pORF) |
ORF061726 |
ABM |
1.0 ug DNA |
EUR 506 |
Wdfy1 ORF Vector (Mouse) (pORF) |
ORF061727 |
ABM |
1.0 ug DNA |
EUR 506 |
WDFY1 sgRNA CRISPR Lentivector set (Human) |
K2627801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Wdfy1 sgRNA CRISPR Lentivector set (Mouse) |
K4557001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Wdfy1 sgRNA CRISPR Lentivector set (Rat) |
K7187501 |
ABM |
3 x 1.0 ug |
EUR 339 |
WDFY1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2627802 |
ABM |
1.0 ug DNA |
EUR 154 |
WDFY1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2627803 |
ABM |
1.0 ug DNA |
EUR 154 |
WDFY1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2627804 |
ABM |
1.0 ug DNA |
EUR 154 |
Wdfy1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4557002 |
ABM |
1.0 ug DNA |
EUR 154 |
Wdfy1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4557003 |
ABM |
1.0 ug DNA |
EUR 154 |
Wdfy1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4557004 |
ABM |
1.0 ug DNA |
EUR 154 |
Wdfy1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7187502 |
ABM |
1.0 ug DNA |
EUR 154 |
Wdfy1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7187503 |
ABM |
1.0 ug DNA |
EUR 154 |
Wdfy1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7187504 |
ABM |
1.0 ug DNA |
EUR 154 |
WDFY1 Protein Vector (Human) (pPB-C-His) |
PV046057 |
ABM |
500 ng |
EUR 329 |
WDFY1 Protein Vector (Human) (pPB-N-His) |
PV046058 |
ABM |
500 ng |
EUR 329 |
WDFY1 Protein Vector (Human) (pPM-C-HA) |
PV046059 |
ABM |
500 ng |
EUR 329 |
WDFY1 Protein Vector (Human) (pPM-C-His) |
PV046060 |
ABM |
500 ng |
EUR 329 |
WDFY1 Protein Vector (Rat) (pPB-C-His) |
PV316262 |
ABM |
500 ng |
EUR 603 |
WDFY1 Protein Vector (Rat) (pPB-N-His) |
PV316263 |
ABM |
500 ng |
EUR 603 |
WDFY1 Protein Vector (Rat) (pPM-C-HA) |
PV316264 |
ABM |
500 ng |
EUR 603 |
WDFY1 Protein Vector (Rat) (pPM-C-His) |
PV316265 |
ABM |
500 ng |
EUR 603 |
WDFY1 Protein Vector (Mouse) (pPB-C-His) |
PV246902 |
ABM |
500 ng |
EUR 603 |
WDFY1 Protein Vector (Mouse) (pPB-N-His) |
PV246903 |
ABM |
500 ng |
EUR 603 |
WDFY1 Protein Vector (Mouse) (pPM-C-HA) |
PV246904 |
ABM |
500 ng |
EUR 603 |
WDFY1 Protein Vector (Mouse) (pPM-C-His) |
PV246905 |
ABM |
500 ng |
EUR 603 |
WDFY1 Protein Vector (Mouse) (pPB-C-His) |
PV246906 |
ABM |
500 ng |
EUR 603 |
WDFY1 Protein Vector (Mouse) (pPB-N-His) |
PV246907 |
ABM |
500 ng |
EUR 603 |
WDFY1 Protein Vector (Mouse) (pPM-C-HA) |
PV246908 |
ABM |
500 ng |
EUR 603 |
WDFY1 Protein Vector (Mouse) (pPM-C-His) |
PV246909 |
ABM |
500 ng |
EUR 603 |
Wdfy1 3'UTR GFP Stable Cell Line |
TU172201 |
ABM |
1.0 ml |
Ask for price |
WDFY1 Rabbit Polyclonal Antibody