WDFY1 Rabbit Polyclonal Antibody

WDFY1 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

WDFY1 Polyclonal Antibody

ABP60912-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human WDFY1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of WDFY1 from Human. This WDFY1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human WDFY1 protein

WDFY1 Polyclonal Antibody

ES11743-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WDFY1 from . This antibody is tested and validated for WB, ELISA, WB, ELISA

WDFY1 Polyclonal Antibody

ES11743-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WDFY1 from . This antibody is tested and validated for WB, ELISA, WB, ELISA

WDFY1 Antibody

46708-100ul 100ul
EUR 252

WDFY1 Antibody

1-CSB-PA816890LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against WDFY1. Recognizes WDFY1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

WDFY1 antibody

70R-4012 50 ug
EUR 467
Description: Rabbit polyclonal WDFY1 antibody raised against the N terminal of WDFY1

Polyclonal WDFY1 antibody - N-terminal region

AMM08508G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WDFY1 - N-terminal region. This antibody is tested and proven to work in the following applications:

Polyclonal FENS1 / WDFY1 Antibody (C-Term)

APR15946G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human FENS1 / WDFY1 (C-Term). This antibody is tested and proven to work in the following applications:

WDFY1 Conjugated Antibody

C46708 100ul
EUR 397

WDFY1 Antibody (HRP)

20-abx315463
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

WDFY1 Antibody (FITC)

20-abx315464
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

WDFY1 Antibody (Biotin)

20-abx315465
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-WDFY1 antibody

STJ192901 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to WDFY1

WDFY1 siRNA

20-abx939669
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

WDFY1 Antibody, HRP conjugated

1-CSB-PA816890LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against WDFY1. Recognizes WDFY1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

WDFY1 Antibody, FITC conjugated

1-CSB-PA816890LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against WDFY1. Recognizes WDFY1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

WDFY1 Antibody, Biotin conjugated

1-CSB-PA816890LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against WDFY1. Recognizes WDFY1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-FENS1 / WDFY1 antibody

STJ70535 100 µg
EUR 260

WDFY1 Blocking Peptide

33R-5591 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of WDFY1 antibody, catalog no. 70R-4012

WDFY1 cloning plasmid

CSB-CL816890HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1233
  • Sequence: atggcggccgaaatccactccaggccgcagagcagccgcccggtgctgctgagcaagatcgaggggcaccaggacgccgtcacggccgcgctgctcatccccaaggaggacggcgtgatcacggccagcgaggacagaaccatccgggtatggctgaaaagagacagtggtcaat
  • Show more
Description: A cloning plasmid for the WDFY1 gene.

Bovine WDFY1 ELISA KIT

ELI-16956b 96 Tests
EUR 928

Human WDFY1 ELISA KIT

ELI-28737h 96 Tests
EUR 824

Human WDFY1 shRNA Plasmid

20-abx961562
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

WDFY1 Recombinant Protein (Rat)

RP237194 100 ug Ask for price

WDFY1 Recombinant Protein (Human)

RP034543 100 ug Ask for price

WDFY1 Recombinant Protein (Mouse)

RP185174 100 ug Ask for price

WDFY1 Recombinant Protein (Mouse)

RP185177 100 ug Ask for price

Wdfy1 ORF Vector (Mouse) (pORF)

ORF061726 1.0 ug DNA
EUR 506

Wdfy1 ORF Vector (Mouse) (pORF)

ORF061727 1.0 ug DNA
EUR 506

Wdfy1 ORF Vector (Rat) (pORF)

ORF079066 1.0 ug DNA
EUR 506

WDFY1 ORF Vector (Human) (pORF)

ORF011515 1.0 ug DNA
EUR 95

Wdfy1 sgRNA CRISPR Lentivector set (Rat)

K7187501 3 x 1.0 ug
EUR 339

WDFY1 sgRNA CRISPR Lentivector set (Human)

K2627801 3 x 1.0 ug
EUR 339

Wdfy1 sgRNA CRISPR Lentivector set (Mouse)

K4557001 3 x 1.0 ug
EUR 339

Wdfy1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7187502 1.0 ug DNA
EUR 154

Wdfy1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7187503 1.0 ug DNA
EUR 154

Wdfy1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7187504 1.0 ug DNA
EUR 154

WDFY1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2627802 1.0 ug DNA
EUR 154

WDFY1 sgRNA CRISPR Lentivector (Human) (Target 2)

K2627803 1.0 ug DNA
EUR 154

WDFY1 sgRNA CRISPR Lentivector (Human) (Target 3)

K2627804 1.0 ug DNA
EUR 154

Wdfy1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4557002 1.0 ug DNA
EUR 154

Wdfy1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4557003 1.0 ug DNA
EUR 154

Wdfy1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4557004 1.0 ug DNA
EUR 154

WDFY1 Protein Vector (Mouse) (pPB-C-His)

PV246902 500 ng
EUR 603

WDFY1 Protein Vector (Mouse) (pPB-N-His)

PV246903 500 ng
EUR 603

WDFY1 Protein Vector (Mouse) (pPM-C-HA)

PV246904 500 ng
EUR 603

WDFY1 Protein Vector (Mouse) (pPM-C-His)

PV246905 500 ng
EUR 603

WDFY1 Protein Vector (Mouse) (pPB-C-His)

PV246906 500 ng
EUR 603

WDFY1 Protein Vector (Mouse) (pPB-N-His)

PV246907 500 ng
EUR 603

WDFY1 Protein Vector (Mouse) (pPM-C-HA)

PV246908 500 ng
EUR 603

WDFY1 Protein Vector (Mouse) (pPM-C-His)

PV246909 500 ng
EUR 603

WDFY1 Protein Vector (Rat) (pPB-C-His)

PV316262 500 ng
EUR 603

WDFY1 Protein Vector (Rat) (pPB-N-His)

PV316263 500 ng
EUR 603

WDFY1 Protein Vector (Rat) (pPM-C-HA)

PV316264 500 ng
EUR 603

WDFY1 Protein Vector (Rat) (pPM-C-His)

PV316265 500 ng
EUR 603

WDFY1 Protein Vector (Human) (pPB-C-His)

PV046057 500 ng
EUR 329

WDFY1 Protein Vector (Human) (pPB-N-His)

PV046058 500 ng
EUR 329

WDFY1 Protein Vector (Human) (pPM-C-HA)

PV046059 500 ng
EUR 329

WDFY1 Protein Vector (Human) (pPM-C-His)

PV046060 500 ng
EUR 329

Wdfy1 3'UTR Luciferase Stable Cell Line

TU122201 1.0 ml Ask for price

WDFY1 Rabbit Polyclonal Antibody