ELN Rabbit Polyclonal Antibody

ELN Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

Mouse Elastin (ELN) ELISA Kit
DLR-ELN-Mu-96T	DL Develop	96T	EUR 661
Should the Mouse Elastin (ELN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Elastin (ELN) in samples from serum, plasma or other biological fluids.

Rat Elastin (ELN) ELISA Kit
DLR-ELN-Ra-48T	DL Develop	48T	EUR 528
Should the Rat Elastin (ELN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Elastin (ELN) in samples from serum, plasma or other biological fluids.

Rat Elastin (ELN) ELISA Kit
DLR-ELN-Ra-96T	DL Develop	96T	EUR 690
Should the Rat Elastin (ELN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Elastin (ELN) in samples from serum, plasma or other biological fluids.

Human Elastin (ELN) ELISA Kit
RDR-ELN-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human Elastin (ELN) ELISA Kit
RDR-ELN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

Mouse Elastin (ELN) ELISA Kit
RDR-ELN-Mu-48Tests	Reddot Biotech	48 Tests	EUR 534

Mouse Elastin (ELN) ELISA Kit
RDR-ELN-Mu-96Tests	Reddot Biotech	96 Tests	EUR 742

Rat Elastin (ELN) ELISA Kit
RDR-ELN-Ra-48Tests	Reddot Biotech	48 Tests	EUR 558

Rat Elastin (ELN) ELISA Kit
RDR-ELN-Ra-96Tests	Reddot Biotech	96 Tests	EUR 776

Human Elastin (ELN) ELISA Kit
RD-ELN-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Elastin (ELN) ELISA Kit
RD-ELN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Mouse Elastin (ELN) ELISA Kit
RD-ELN-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511

Mouse Elastin (ELN) ELISA Kit
RD-ELN-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709

Rat Elastin (ELN) ELISA Kit
RD-ELN-Ra-48Tests	Reddot Biotech	48 Tests	EUR 534

Rat Elastin (ELN) ELISA Kit
RD-ELN-Ra-96Tests	Reddot Biotech	96 Tests	EUR 742

ELN Polyclonal Antibody
ABP58473-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human ELN protein Applications tips:
Description: A polyclonal antibody for detection of ELN from Human. This ELN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ELN protein

ELN Polyclonal Antibody
ABP58473-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human ELN protein Applications tips:
Description: A polyclonal antibody for detection of ELN from Human. This ELN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ELN protein

ELN Polyclonal Antibody
ABP58473-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human ELN protein Applications tips:
Description: A polyclonal antibody for detection of ELN from Human. This ELN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ELN protein

ELN Polyclonal Antibody
ES11837-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ELN from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

ELN Polyclonal Antibody
ES11837-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ELN from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

ELN Rabbit pAb
A12433-100ul	Abclonal	100 ul	EUR 308

ELN Rabbit pAb
A12433-200ul	Abclonal	200 ul	EUR 459

ELN Rabbit pAb
A12433-20ul	Abclonal	20 ul	EUR 183

ELN Rabbit pAb
A12433-50ul	Abclonal	50 ul	EUR 223

ELN Rabbit pAb
A2723-100ul	Abclonal	100 ul	EUR 308

ELN Rabbit pAb
A2723-200ul	Abclonal	200 ul	EUR 459

ELN Rabbit pAb
A2723-20ul	Abclonal	20 ul	EUR 183

ELN Rabbit pAb
A2723-50ul	Abclonal	50 ul	EUR 223

Elastin (ELN) Polyclonal Antibody (Human)
4-PAB337Hu01	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ELN (Gly392~Ala645) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN)

Elastin (ELN) Polyclonal Antibody (Human)
4-PAB337Hu08	Cloud-Clone	EUR 253.00 EUR 2615.00 EUR 649.00 EUR 319.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN)

Elastin (ELN) Polyclonal Antibody (Mouse)
4-PAB337Mu01	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ELN (Pro266~Gly443) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN)

Rabbit ELN ELISA Kit
ERTE0057	Abclonal	96Tests	EUR 521

ELN Antibody
35724-100ul	SAB	100ul	EUR 252

ELN antibody
38448-100ul	SAB	100ul	EUR 252

ELN Antibody
DF7064	Affbiotech	200ul	EUR 304
Description: ELN Antibody detects endogenous levels of total ELN.

ELN Antibody
1-CSB-PA583825	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ELN. Recognizes ELN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200

ELN Antibody
1-CSB-PA591479	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ELN. Recognizes ELN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

ELN Antibody
ABD7064	Lifescience Market	100 ug	EUR 438

Elastin (ELN) Polyclonal Antibody (Human), APC
4-PAB337Hu01-APC	Cloud-Clone	EUR 333.00 EUR 3113.00 EUR 872.00 EUR 423.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ELN (Gly392~Ala645) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with APC.

Elastin (ELN) Polyclonal Antibody (Human), Biotinylated
4-PAB337Hu01-Biotin	Cloud-Clone	EUR 303.00 EUR 2341.00 EUR 697.00 EUR 369.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ELN (Gly392~Ala645) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with Biotin.

Elastin (ELN) Polyclonal Antibody (Human), Cy3
4-PAB337Hu01-Cy3	Cloud-Clone	EUR 403.00 EUR 4109.00 EUR 1121.00 EUR 523.00 EUR 245.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ELN (Gly392~Ala645) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with Cy3.

Elastin (ELN) Polyclonal Antibody (Human), FITC
4-PAB337Hu01-FITC	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ELN (Gly392~Ala645) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with FITC.

Elastin (ELN) Polyclonal Antibody (Human), HRP
4-PAB337Hu01-HRP	Cloud-Clone	EUR 305.00 EUR 2714.00 EUR 772.00 EUR 383.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ELN (Gly392~Ala645) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with HRP.

Elastin (ELN) Polyclonal Antibody (Human), PE
4-PAB337Hu01-PE	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ELN (Gly392~Ala645) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with PE.

Elastin (ELN) Polyclonal Antibody (Human), APC
4-PAB337Hu08-APC	Cloud-Clone	EUR 355.00 EUR 3419.00 EUR 948.00 EUR 454.00 EUR 224.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with APC.

Elastin (ELN) Polyclonal Antibody (Human), Biotinylated
4-PAB337Hu08-Biotin	Cloud-Clone	EUR 318.00 EUR 2565.00 EUR 753.00 EUR 391.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with Biotin.

Elastin (ELN) Polyclonal Antibody (Human), Cy3
4-PAB337Hu08-Cy3	Cloud-Clone	EUR 432.00 EUR 4517.00 EUR 1223.00 EUR 564.00 EUR 257.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with Cy3.

Elastin (ELN) Polyclonal Antibody (Human), FITC
4-PAB337Hu08-FITC	Cloud-Clone	EUR 304.00 EUR 2755.00 EUR 778.00 EUR 383.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with FITC.

Elastin (ELN) Polyclonal Antibody (Human), HRP
4-PAB337Hu08-HRP	Cloud-Clone	EUR 324.00 EUR 2979.00 EUR 838.00 EUR 410.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with HRP.

Elastin (ELN) Polyclonal Antibody (Human), PE
4-PAB337Hu08-PE	Cloud-Clone	EUR 304.00 EUR 2755.00 EUR 778.00 EUR 383.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with PE.

Elastin (ELN) Polyclonal Antibody (Mouse), APC
4-PAB337Mu01-APC	Cloud-Clone	EUR 340.00 EUR 3203.00 EUR 894.00 EUR 432.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ELN (Pro266~Gly443) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with APC.

Elastin (ELN) Polyclonal Antibody (Mouse), Biotinylated
4-PAB337Mu01-Biotin	Cloud-Clone	EUR 307.00 EUR 2407.00 EUR 714.00 EUR 375.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ELN (Pro266~Gly443) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with Biotin.

Elastin (ELN) Polyclonal Antibody (Mouse), Cy3
4-PAB337Mu01-Cy3	Cloud-Clone	EUR 411.00 EUR 4229.00 EUR 1151.00 EUR 535.00 EUR 248.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ELN (Pro266~Gly443) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with Cy3.

Elastin (ELN) Polyclonal Antibody (Mouse), FITC
4-PAB337Mu01-FITC	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ELN (Pro266~Gly443) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with FITC.

Elastin (ELN) Polyclonal Antibody (Mouse), HRP
4-PAB337Mu01-HRP	Cloud-Clone	EUR 311.00 EUR 2792.00 EUR 791.00 EUR 391.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ELN (Pro266~Gly443) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with HRP.

Elastin (ELN) Polyclonal Antibody (Mouse), PE
4-PAB337Mu01-PE	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ELN (Pro266~Gly443) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with PE.

Rabbit Elastin (ELN) ELISA Kit
abx354258-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Elastin (ELN) Antibody
20-abx007872	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Elastin (ELN) Antibody
20-abx176238	Abbexa	EUR 1177.00 EUR 578.00	1 mg 200 ug
Please enquire.

Elastin (ELN) Antibody
20-abx176239	Abbexa	EUR 1247.00 EUR 592.00	1 mg 200 ug
Please enquire.

Elastin (ELN) Antibody
20-abx211321	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Elastin (ELN) Antibody
20-abx100085	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Elastin (ELN) Antibody
20-abx100086	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Elastin (ELN) Antibody
20-abx100087	Abbexa	EUR 829.00 EUR 439.00	1 mg 200 ug
Please enquire.

Elastin (ELN) Antibody
20-abx132104	Abbexa	EUR 328.00 EUR 815.00 EUR 425.00 EUR 154.00 EUR 258.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-7 working days.

Elastin (ELN) Antibody
20-abx132220	Abbexa	EUR 439.00 EUR 133.00 EUR 1261.00 EUR 606.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Elastin (ELN) Antibody
20-abx146903	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Elastin (ELN) Antibody
20-abx172209	Abbexa	EUR 871.00 EUR 453.00	1 mg 200 ug
Please enquire.

ELN Conjugated Antibody
C35724	SAB	100ul	EUR 397

ELN Conjugated Antibody
C38448	SAB	100ul	EUR 397

Elastin (ELN) Antibody
20-abx339544	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Elastin (ELN) Antibody
20-abx002068	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Anti-ELN antibody
STJ114307	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein that is one of the two components of elastic fibers. The encoded protein is rich in hydrophobic amino acids such as glycine and proline, which form mobile hydrophobic regions bounded by crosslinks between lysine residues. Deletions and mutations in this gene are associated with supravalvular aortic stenosis (SVAS) and autosomal dominant cutis laxa. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-ELN antibody
STJ192995	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to ELN

Anti-ELN antibody
STJ23529	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein that is one of the two components of elastic fibers. The encoded protein is rich in hydrophobic amino acids such as glycine and proline, which form mobile hydrophobic regions bounded by crosslinks between lysine residues. Deletions and mutations in this gene are associated with supravalvular aortic stenosis (SVAS) and autosomal dominant cutis laxa. Multiple transcript variants encoding different isoforms have been found for this gene.

ELN/ Rat ELN ELISA Kit
ELA-E1337r	Lifescience Market	96 Tests	EUR 886

Eln/ Rat Eln ELISA Kit
ELI-04404r	Lifescience Market	96 Tests	EUR 886

Elastin (ELN) Polyclonal Antibody (Human), APC-Cy7
4-PAB337Hu01-APC-Cy7	Cloud-Clone	EUR 547.00 EUR 6106.00 EUR 1624.00 EUR 727.00 EUR 310.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ELN (Gly392~Ala645) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with APC-Cy7.

Elastin (ELN) Polyclonal Antibody (Human), APC-Cy7
4-PAB337Hu08-APC-Cy7	Cloud-Clone	EUR 590.00 EUR 6718.00 EUR 1777.00 EUR 788.00 EUR 328.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with APC-Cy7.

Elastin (ELN) Polyclonal Antibody (Mouse), APC-Cy7
4-PAB337Mu01-APC-Cy7	Cloud-Clone	EUR 560.00 EUR 6286.00 EUR 1669.00 EUR 745.00 EUR 315.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ELN (Pro266~Gly443) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with APC-Cy7.

ELISA kit for Rabbit ELN (Elastin)
E-EL-RB0506	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's ELN ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rabbit ELN. Standards or samples are added to the micro ELISA plate wells and combined with the Show more
Description: A sandwich ELISA kit for quantitative measurement of Rabbit ELN (Elastin) in samples from Serum, Plasma, Cell supernatant

ELN siRNA
20-abx901701	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ELN siRNA
20-abx915285	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ELN siRNA
20-abx915286	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ELN-441958
HY-15043	MedChemExpress	10mg	EUR 739

Elastin (ELN) Antibody (FITC)
20-abx271077	Abbexa	EUR 467.00 EUR 244.00 EUR 1386.00 EUR 648.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Elastin (ELN) Antibody (Biotin)
20-abx271340	Abbexa	EUR 453.00 EUR 244.00 EUR 1288.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Elastin (ELN) Antibody (Biotin)
20-abx272127	Abbexa	EUR 439.00 EUR 244.00 EUR 1261.00 EUR 606.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Elastin (ELN) Antibody Pair
20-abx370672	Abbexa	EUR 1664.00 EUR 1066.00	10 × 96 tests 5 × 96 tests
Shipped within 5-15 working days.

Elastin (ELN) Antibody (FITC)
20-abx273707	Abbexa	EUR 467.00 EUR 244.00 EUR 1358.00 EUR 648.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Elastin (ELN) Monoclonal Antibody (Human)
4-MAB337Hu21	Cloud-Clone	EUR 247.00 EUR 2523.00 EUR 628.00 EUR 311.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gly392~Ala645 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Elastin (ELN)

ELN Blocking Peptide
DF7064-BP	Affbiotech	1mg	EUR 195

ELN cloning plasmid
CSB-CL007617HU-10ug	Cusabio	10ug	EUR 663
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1977 Sequence: atggcgggtctgacggcggcggccccgcggcccggagtcctcctgctcctgctgtccatcctccacccctctcggcctggaggggtccctggggccattcctggtggagttcctggaggagtcttttatccaggggctggtctcggagcccttggaggaggagcgctggggcctg Show more
Description: A cloning plasmid for the ELN gene.

ELN 318463 racemate
HY-50882A	MedChemExpress	5mg	EUR 601

Recombinant Elastin (ELN)
4-RPB337Hu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P15502 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 22.9kDa Isoelectric Point: 10.3
Description: Recombinant Human Elastin expressed in: E.coli

Recombinant Elastin (ELN)
4-RPB337Mu01	Cloud-Clone	EUR 499.62 EUR 236.00 EUR 1598.56 EUR 599.52 EUR 1099.04 EUR 397.00 EUR 3846.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P54320 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 47.3kDa Isoelectric Point: 9
Description: Recombinant Mouse Elastin expressed in: E.coli

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody
BNUB1981-100	Biotium	100uL	EUR 264
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), Concentration: 0.2mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody
BNUB1981-50	Biotium	50uL	EUR 405
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), 1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody
BNUB1981-500	Biotium	500uL	EUR 513
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), Concentration: 0.2mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody
BNC551981-100	Biotium	100uL	EUR 233
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF555 conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody
BNC551981-500	Biotium	500uL	EUR 545
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF555 conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody
BNC611981-100	Biotium	100uL	EUR 233
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF660R conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody
BNC611981-500	Biotium	500uL	EUR 545
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF660R conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody
BNC471981-100	Biotium	100uL	EUR 233
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF647 conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody
BNC471981-500	Biotium	500uL	EUR 545
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF647 conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody
BNC041981-100	Biotium	100uL	EUR 233
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF405S conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody
BNC041981-500	Biotium	500uL	EUR 545
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF405S conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody
BNC051981-100	Biotium	100uL	EUR 233
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF405M conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody
BNC051981-500	Biotium	500uL	EUR 545
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF405M conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody
BNC401981-100	Biotium	100uL	EUR 233
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF640R conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody
BNC401981-500	Biotium	500uL	EUR 545
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF640R conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody
BNC431981-100	Biotium	100uL	EUR 233
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF543 conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody
BNC431981-500	Biotium	500uL	EUR 545
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF543 conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody
BNC701981-100	Biotium	100uL	EUR 233
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF770 conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody
BNC701981-500	Biotium	500uL	EUR 545
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF770 conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody
BNC801981-100	Biotium	100uL	EUR 233
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF680 conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody
BNC801981-500	Biotium	500uL	EUR 545
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF680 conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody
BNCH1981-100	Biotium	100uL	EUR 233
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody
BNCH1981-500	Biotium	500uL	EUR 545
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody
BNCP1981-250	Biotium	250uL	EUR 394
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), PerCP conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody
BNCR1981-250	Biotium	250uL	EUR 394
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), RPE conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody
BNC941981-100	Biotium	100uL	EUR 233
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF594 conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody
BNC941981-500	Biotium	500uL	EUR 545
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF594 conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody
BNCA1981-250	Biotium	250uL	EUR 394
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), APC conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody
BNCB1981-100	Biotium	100uL	EUR 233
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), Biotin conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody
BNCB1981-500	Biotium	500uL	EUR 545
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), Biotin conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody
BNC881981-100	Biotium	100uL	EUR 233
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF488A conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody
BNC881981-500	Biotium	500uL	EUR 545
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF488A conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody
BNC681981-100	Biotium	100uL	EUR 233
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF568 conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody
BNC681981-500	Biotium	500uL	EUR 545
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF568 conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody
BNCAP1981-100	Biotium	100uL	EUR 233
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody
BNCAP1981-500	Biotium	500uL	EUR 545
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody
BNC811981-100	Biotium	100uL	EUR 233
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF680R conjugate, Concentration: 0.1mg/mL

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody
BNC811981-500	Biotium	500uL	EUR 545
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF680R conjugate, Concentration: 0.1mg/mL

Elastin (ELN) MonoSpecific Antibody, Unconjugated-20ug
2006-MSM1-P0	EnQuireBio	20ug	EUR 233

Elastin (ELN) MonoSpecific Antibody, Unconjugated-100ug
2006-MSM1-P1	EnQuireBio	100ug	EUR 428

Elastin (ELN) Monoclonal Antibody (Human), APC
4-MAB337Hu21-APC	Cloud-Clone	EUR 346.00 EUR 3293.00 EUR 917.00 EUR 441.00 EUR 220.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gly392~Ala645 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Elastin (ELN). This antibody is labeled with APC.

Elastin (ELN) Monoclonal Antibody (Human), Biotinylated
4-MAB337Hu21-Biotin	Cloud-Clone	EUR 312.00 EUR 2473.00 EUR 730.00 EUR 382.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gly392~Ala645 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Elastin (ELN). This antibody is labeled with Biotin.

Elastin (ELN) Monoclonal Antibody (Human), Cy3
4-MAB337Hu21-Cy3	Cloud-Clone	EUR 420.00 EUR 4349.00 EUR 1181.00 EUR 547.00 EUR 252.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gly392~Ala645 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Elastin (ELN). This antibody is labeled with Cy3.

Elastin (ELN) Monoclonal Antibody (Human), FITC
4-MAB337Hu21-FITC	Cloud-Clone	EUR 297.00 EUR 2654.00 EUR 753.00 EUR 373.00 EUR 196.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gly392~Ala645 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Elastin (ELN). This antibody is labeled with FITC.

Elastin (ELN) Monoclonal Antibody (Human), HRP
4-MAB337Hu21-HRP	Cloud-Clone	EUR 316.00 EUR 2870.00 EUR 811.00 EUR 399.00 EUR 207.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gly392~Ala645 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Elastin (ELN). This antibody is labeled with HRP.

Elastin (ELN) Monoclonal Antibody (Human), PE
4-MAB337Hu21-PE	Cloud-Clone	EUR 297.00 EUR 2654.00 EUR 753.00 EUR 373.00 EUR 196.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Gly392~Ala645 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Elastin (ELN). This antibody is labeled with PE.

Human Elastin (ELN) Protein
20-abx066394	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Elastin (ELN) Protein
20-abx066395	Abbexa	EUR 704.00 EUR 286.00 EUR 2151.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human ELN ELISA Kit
EHE0057	Abclonal	96Tests	EUR 521

Human ELN ELISA Kit
ELA-E1337h	Lifescience Market	96 Tests	EUR 824

Goat ELN ELISA Kit
EGTE0057	Abclonal	96Tests	EUR 521

Bovine ELN ELISA Kit
EBE0057	Abclonal	96Tests	EUR 521

Canine ELN ELISA Kit
ECE0057	Abclonal	96Tests	EUR 521

Chicken ELN ELISA Kit
ECKE0057	Abclonal	96Tests	EUR 521

Anserini ELN ELISA Kit
EAE0057	Abclonal	96Tests	EUR 521

ELN ELISA KIT|Human
EF005387	Lifescience Market	96 Tests	EUR 689

OVA Conjugated Elastin (ELN)
4-CPB337Hu21	Cloud-Clone	EUR 226.34 EUR 163.00 EUR 573.76 EUR 257.92 EUR 415.84 EUR 214.00 EUR 1284.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P15502 Buffer composition: PBS, pH 7.4. Form: Freeze-dried powder Predicted Molecular Mass (KD): Inquire Isoelectric Point: Inquire
Description: Recombinant Human Elastin expressed in: chemical synthesis

KLH conjugated Elastin (ELN)
4-CPB337Hu31	Cloud-Clone	EUR 413.60 EUR 214.00 EUR 1276.00 EUR 492.00 EUR 884.00 EUR 340.00 EUR 3040.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P15502 Buffer composition: PBS, pH 7.4. Form: Freeze-dried powder Predicted Molecular Mass (KD): Inquire Isoelectric Point: Inquire
Description: Recombinant Human Elastin expressed in: chemical synthesis

ELN Rabbit Polyclonal Antibody