ELN Rabbit Polyclonal Antibody

ELN Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

Mouse Elastin (ELN) ELISA Kit

DLR-ELN-Mu-96T 96T
EUR 661
  • Should the Mouse Elastin (ELN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Elastin (ELN) in samples from serum, plasma or other biological fluids.

Rat Elastin (ELN) ELISA Kit

DLR-ELN-Ra-48T 48T
EUR 528
  • Should the Rat Elastin (ELN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Elastin (ELN) in samples from serum, plasma or other biological fluids.

Rat Elastin (ELN) ELISA Kit

DLR-ELN-Ra-96T 96T
EUR 690
  • Should the Rat Elastin (ELN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Elastin (ELN) in samples from serum, plasma or other biological fluids.

Human Elastin (ELN) ELISA Kit

RDR-ELN-Hu-48Tests 48 Tests
EUR 522

Human Elastin (ELN) ELISA Kit

RDR-ELN-Hu-96Tests 96 Tests
EUR 724

Mouse Elastin (ELN) ELISA Kit

RDR-ELN-Mu-48Tests 48 Tests
EUR 534

Mouse Elastin (ELN) ELISA Kit

RDR-ELN-Mu-96Tests 96 Tests
EUR 742

Rat Elastin (ELN) ELISA Kit

RDR-ELN-Ra-48Tests 48 Tests
EUR 558

Rat Elastin (ELN) ELISA Kit

RDR-ELN-Ra-96Tests 96 Tests
EUR 776

Human Elastin (ELN) ELISA Kit

RD-ELN-Hu-48Tests 48 Tests
EUR 500

Human Elastin (ELN) ELISA Kit

RD-ELN-Hu-96Tests 96 Tests
EUR 692

Mouse Elastin (ELN) ELISA Kit

RD-ELN-Mu-48Tests 48 Tests
EUR 511

Mouse Elastin (ELN) ELISA Kit

RD-ELN-Mu-96Tests 96 Tests
EUR 709

Rat Elastin (ELN) ELISA Kit

RD-ELN-Ra-48Tests 48 Tests
EUR 534

Rat Elastin (ELN) ELISA Kit

RD-ELN-Ra-96Tests 96 Tests
EUR 742

ELN Polyclonal Antibody

ABP58473-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human ELN protein
  • Applications tips:
Description: A polyclonal antibody for detection of ELN from Human. This ELN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ELN protein

ELN Polyclonal Antibody

ABP58473-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ELN protein
  • Applications tips:
Description: A polyclonal antibody for detection of ELN from Human. This ELN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ELN protein

ELN Polyclonal Antibody

ABP58473-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ELN protein
  • Applications tips:
Description: A polyclonal antibody for detection of ELN from Human. This ELN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ELN protein

ELN Polyclonal Antibody

ES11837-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ELN from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

ELN Polyclonal Antibody

ES11837-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ELN from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

ELN Rabbit pAb

A12433-100ul 100 ul
EUR 308

ELN Rabbit pAb

A12433-200ul 200 ul
EUR 459

ELN Rabbit pAb

A12433-20ul 20 ul
EUR 183

ELN Rabbit pAb

A12433-50ul 50 ul
EUR 223

ELN Rabbit pAb

A2723-100ul 100 ul
EUR 308

ELN Rabbit pAb

A2723-200ul 200 ul
EUR 459

ELN Rabbit pAb

A2723-20ul 20 ul
EUR 183

ELN Rabbit pAb

A2723-50ul 50 ul
EUR 223

Elastin (ELN) Polyclonal Antibody (Human)

  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ELN (Gly392~Ala645)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN)

Elastin (ELN) Polyclonal Antibody (Human)

  • EUR 253.00
  • EUR 2615.00
  • EUR 649.00
  • EUR 319.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN)

Elastin (ELN) Polyclonal Antibody (Mouse)

  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ELN (Pro266~Gly443)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN)

Rabbit ELN ELISA Kit

ERTE0057 96Tests
EUR 521

ELN Antibody

35724-100ul 100ul
EUR 252

ELN antibody

38448-100ul 100ul
EUR 252

ELN Antibody

DF7064 200ul
EUR 304
Description: ELN Antibody detects endogenous levels of total ELN.

ELN Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ELN. Recognizes ELN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200

ELN Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ELN. Recognizes ELN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

ELN Antibody

ABD7064 100 ug
EUR 438

Elastin (ELN) Polyclonal Antibody (Human), APC

  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ELN (Gly392~Ala645)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with APC.

Elastin (ELN) Polyclonal Antibody (Human), Biotinylated

  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ELN (Gly392~Ala645)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with Biotin.

Elastin (ELN) Polyclonal Antibody (Human), Cy3

  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ELN (Gly392~Ala645)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with Cy3.

Elastin (ELN) Polyclonal Antibody (Human), FITC

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ELN (Gly392~Ala645)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with FITC.

Elastin (ELN) Polyclonal Antibody (Human), HRP

  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ELN (Gly392~Ala645)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with HRP.

Elastin (ELN) Polyclonal Antibody (Human), PE

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ELN (Gly392~Ala645)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with PE.

Elastin (ELN) Polyclonal Antibody (Human), APC

  • EUR 355.00
  • EUR 3419.00
  • EUR 948.00
  • EUR 454.00
  • EUR 224.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with APC.

Elastin (ELN) Polyclonal Antibody (Human), Biotinylated

  • EUR 318.00
  • EUR 2565.00
  • EUR 753.00
  • EUR 391.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with Biotin.

Elastin (ELN) Polyclonal Antibody (Human), Cy3

  • EUR 432.00
  • EUR 4517.00
  • EUR 1223.00
  • EUR 564.00
  • EUR 257.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with Cy3.

Elastin (ELN) Polyclonal Antibody (Human), FITC

  • EUR 304.00
  • EUR 2755.00
  • EUR 778.00
  • EUR 383.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with FITC.

Elastin (ELN) Polyclonal Antibody (Human), HRP

  • EUR 324.00
  • EUR 2979.00
  • EUR 838.00
  • EUR 410.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with HRP.

Elastin (ELN) Polyclonal Antibody (Human), PE

  • EUR 304.00
  • EUR 2755.00
  • EUR 778.00
  • EUR 383.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with PE.

Elastin (ELN) Polyclonal Antibody (Mouse), APC

  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ELN (Pro266~Gly443)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with APC.

Elastin (ELN) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ELN (Pro266~Gly443)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with Biotin.

Elastin (ELN) Polyclonal Antibody (Mouse), Cy3

  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ELN (Pro266~Gly443)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with Cy3.

Elastin (ELN) Polyclonal Antibody (Mouse), FITC

  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ELN (Pro266~Gly443)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with FITC.

Elastin (ELN) Polyclonal Antibody (Mouse), HRP

  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ELN (Pro266~Gly443)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with HRP.

Elastin (ELN) Polyclonal Antibody (Mouse), PE

  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ELN (Pro266~Gly443)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with PE.

Rabbit Elastin (ELN) ELISA Kit

abx354258-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Elastin (ELN) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Elastin (ELN) Antibody

  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Elastin (ELN) Antibody

  • EUR 1247.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Elastin (ELN) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Elastin (ELN) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Elastin (ELN) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Elastin (ELN) Antibody

  • EUR 829.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Elastin (ELN) Antibody

  • EUR 328.00
  • EUR 815.00
  • EUR 425.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Elastin (ELN) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1261.00
  • EUR 606.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Elastin (ELN) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Elastin (ELN) Antibody

  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.

ELN Conjugated Antibody

C35724 100ul
EUR 397

ELN Conjugated Antibody

C38448 100ul
EUR 397

Elastin (ELN) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Elastin (ELN) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Anti-ELN antibody

STJ114307 100 µl
EUR 277
Description: This gene encodes a protein that is one of the two components of elastic fibers. The encoded protein is rich in hydrophobic amino acids such as glycine and proline, which form mobile hydrophobic regions bounded by crosslinks between lysine residues. Deletions and mutations in this gene are associated with supravalvular aortic stenosis (SVAS) and autosomal dominant cutis laxa. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-ELN antibody

STJ192995 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ELN

Anti-ELN antibody

STJ23529 100 µl
EUR 277
Description: This gene encodes a protein that is one of the two components of elastic fibers. The encoded protein is rich in hydrophobic amino acids such as glycine and proline, which form mobile hydrophobic regions bounded by crosslinks between lysine residues. Deletions and mutations in this gene are associated with supravalvular aortic stenosis (SVAS) and autosomal dominant cutis laxa. Multiple transcript variants encoding different isoforms have been found for this gene.


ELA-E1337r 96 Tests
EUR 886

Eln/ Rat Eln ELISA Kit

ELI-04404r 96 Tests
EUR 886

Elastin (ELN) Polyclonal Antibody (Human), APC-Cy7

  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ELN (Gly392~Ala645)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with APC-Cy7.

Elastin (ELN) Polyclonal Antibody (Human), APC-Cy7

  • EUR 590.00
  • EUR 6718.00
  • EUR 1777.00
  • EUR 788.00
  • EUR 328.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with APC-Cy7.

Elastin (ELN) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ELN (Pro266~Gly443)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with APC-Cy7.

ELISA kit for Rabbit ELN (Elastin)

E-EL-RB0506 1 plate of 96 wells
EUR 584
  • Gentaur's ELN ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rabbit ELN. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rabbit ELN (Elastin) in samples from Serum, Plasma, Cell supernatant


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


HY-15043 10mg
EUR 739

Elastin (ELN) Antibody (FITC)

  • EUR 467.00
  • EUR 244.00
  • EUR 1386.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Elastin (ELN) Antibody (Biotin)

  • EUR 453.00
  • EUR 244.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Elastin (ELN) Antibody (Biotin)

  • EUR 439.00
  • EUR 244.00
  • EUR 1261.00
  • EUR 606.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Elastin (ELN) Antibody Pair

  • EUR 1664.00
  • EUR 1066.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Elastin (ELN) Antibody (FITC)

  • EUR 467.00
  • EUR 244.00
  • EUR 1358.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Elastin (ELN) Monoclonal Antibody (Human)

  • EUR 247.00
  • EUR 2523.00
  • EUR 628.00
  • EUR 311.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gly392~Ala645
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Elastin (ELN)

ELN Blocking Peptide

DF7064-BP 1mg
EUR 195

ELN cloning plasmid

CSB-CL007617HU-10ug 10ug
EUR 663
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1977
  • Sequence: atggcgggtctgacggcggcggccccgcggcccggagtcctcctgctcctgctgtccatcctccacccctctcggcctggaggggtccctggggccattcctggtggagttcctggaggagtcttttatccaggggctggtctcggagcccttggaggaggagcgctggggcctg
  • Show more
Description: A cloning plasmid for the ELN gene.

ELN 318463 racemate

HY-50882A 5mg
EUR 601

Recombinant Elastin (ELN)

  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P15502
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.9kDa
  • Isoelectric Point: 10.3
Description: Recombinant Human Elastin expressed in: E.coli

Recombinant Elastin (ELN)

  • EUR 499.62
  • EUR 236.00
  • EUR 1598.56
  • EUR 599.52
  • EUR 1099.04
  • EUR 397.00
  • EUR 3846.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P54320
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 47.3kDa
  • Isoelectric Point: 9
Description: Recombinant Mouse Elastin expressed in: E.coli

Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

BNUB1981-100 100uL
EUR 264
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), Concentration: 0.2mg/mL

ELN Rabbit Polyclonal Antibody