ELN Rabbit Polyclonal Antibody
To Order Now: info@poweratlas.org
Mouse Elastin (ELN) ELISA Kit |
DLR-ELN-Mu-96T |
DL Develop |
96T |
EUR 661 |
- Should the Mouse Elastin (ELN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Elastin (ELN) in samples from serum, plasma or other biological fluids. |
Rat Elastin (ELN) ELISA Kit |
DLR-ELN-Ra-48T |
DL Develop |
48T |
EUR 528 |
- Should the Rat Elastin (ELN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Elastin (ELN) in samples from serum, plasma or other biological fluids. |
Rat Elastin (ELN) ELISA Kit |
DLR-ELN-Ra-96T |
DL Develop |
96T |
EUR 690 |
- Should the Rat Elastin (ELN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Elastin (ELN) in samples from serum, plasma or other biological fluids. |
Human Elastin (ELN) ELISA Kit |
RDR-ELN-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522 |
Human Elastin (ELN) ELISA Kit |
RDR-ELN-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724 |
Mouse Elastin (ELN) ELISA Kit |
RDR-ELN-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 534 |
Mouse Elastin (ELN) ELISA Kit |
RDR-ELN-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 742 |
Rat Elastin (ELN) ELISA Kit |
RDR-ELN-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 558 |
Rat Elastin (ELN) ELISA Kit |
RDR-ELN-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 776 |
Human Elastin (ELN) ELISA Kit |
RD-ELN-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Elastin (ELN) ELISA Kit |
RD-ELN-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Mouse Elastin (ELN) ELISA Kit |
RD-ELN-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Mouse Elastin (ELN) ELISA Kit |
RD-ELN-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Rat Elastin (ELN) ELISA Kit |
RD-ELN-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 534 |
Rat Elastin (ELN) ELISA Kit |
RD-ELN-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 742 |
ELN Polyclonal Antibody |
ABP58473-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human ELN protein
- Applications tips:
|
Description: A polyclonal antibody for detection of ELN from Human. This ELN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ELN protein |
ELN Polyclonal Antibody |
ABP58473-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human ELN protein
- Applications tips:
|
Description: A polyclonal antibody for detection of ELN from Human. This ELN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ELN protein |
ELN Polyclonal Antibody |
ABP58473-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human ELN protein
- Applications tips:
|
Description: A polyclonal antibody for detection of ELN from Human. This ELN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ELN protein |
ELN Polyclonal Antibody |
ES11837-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ELN from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
ELN Polyclonal Antibody |
ES11837-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ELN from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
ELN Rabbit pAb |
A12433-100ul |
Abclonal |
100 ul |
EUR 308 |
ELN Rabbit pAb |
A12433-200ul |
Abclonal |
200 ul |
EUR 459 |
ELN Rabbit pAb |
A12433-20ul |
Abclonal |
20 ul |
EUR 183 |
ELN Rabbit pAb |
A12433-50ul |
Abclonal |
50 ul |
EUR 223 |
ELN Rabbit pAb |
A2723-100ul |
Abclonal |
100 ul |
EUR 308 |
ELN Rabbit pAb |
A2723-200ul |
Abclonal |
200 ul |
EUR 459 |
ELN Rabbit pAb |
A2723-20ul |
Abclonal |
20 ul |
EUR 183 |
ELN Rabbit pAb |
A2723-50ul |
Abclonal |
50 ul |
EUR 223 |
Elastin (ELN) Polyclonal Antibody (Human) |
4-PAB337Hu01 |
Cloud-Clone |
-
EUR 239.00
-
EUR 2391.00
-
EUR 598.00
-
EUR 299.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ELN (Gly392~Ala645)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Elastin (ELN) |
Elastin (ELN) Polyclonal Antibody (Human) |
4-PAB337Hu08 |
Cloud-Clone |
-
EUR 253.00
-
EUR 2615.00
-
EUR 649.00
-
EUR 319.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Elastin (ELN) |
Elastin (ELN) Polyclonal Antibody (Mouse) |
4-PAB337Mu01 |
Cloud-Clone |
-
EUR 243.00
-
EUR 2457.00
-
EUR 613.00
-
EUR 305.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ELN (Pro266~Gly443)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN) |
Rabbit ELN ELISA Kit |
ERTE0057 |
Abclonal |
96Tests |
EUR 521 |
ELN Antibody |
35724-100ul |
SAB |
100ul |
EUR 252 |
ELN antibody |
38448-100ul |
SAB |
100ul |
EUR 252 |
ELN Antibody |
DF7064 |
Affbiotech |
200ul |
EUR 304 |
Description: ELN Antibody detects endogenous levels of total ELN. |
ELN Antibody |
1-CSB-PA583825 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against ELN. Recognizes ELN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200 |
ELN Antibody |
1-CSB-PA591479 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against ELN. Recognizes ELN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000 |
Elastin (ELN) Polyclonal Antibody (Human), APC |
4-PAB337Hu01-APC |
Cloud-Clone |
-
EUR 333.00
-
EUR 3113.00
-
EUR 872.00
-
EUR 423.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ELN (Gly392~Ala645)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with APC. |
Elastin (ELN) Polyclonal Antibody (Human), Biotinylated |
4-PAB337Hu01-Biotin |
Cloud-Clone |
-
EUR 303.00
-
EUR 2341.00
-
EUR 697.00
-
EUR 369.00
-
EUR 216.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ELN (Gly392~Ala645)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with Biotin. |
Elastin (ELN) Polyclonal Antibody (Human), Cy3 |
4-PAB337Hu01-Cy3 |
Cloud-Clone |
-
EUR 403.00
-
EUR 4109.00
-
EUR 1121.00
-
EUR 523.00
-
EUR 245.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ELN (Gly392~Ala645)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with Cy3. |
Elastin (ELN) Polyclonal Antibody (Human), FITC |
4-PAB337Hu01-FITC |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ELN (Gly392~Ala645)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with FITC. |
Elastin (ELN) Polyclonal Antibody (Human), HRP |
4-PAB337Hu01-HRP |
Cloud-Clone |
-
EUR 305.00
-
EUR 2714.00
-
EUR 772.00
-
EUR 383.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ELN (Gly392~Ala645)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with HRP. |
Elastin (ELN) Polyclonal Antibody (Human), PE |
4-PAB337Hu01-PE |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ELN (Gly392~Ala645)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with PE. |
Elastin (ELN) Polyclonal Antibody (Human), APC |
4-PAB337Hu08-APC |
Cloud-Clone |
-
EUR 355.00
-
EUR 3419.00
-
EUR 948.00
-
EUR 454.00
-
EUR 224.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with APC. |
Elastin (ELN) Polyclonal Antibody (Human), Biotinylated |
4-PAB337Hu08-Biotin |
Cloud-Clone |
-
EUR 318.00
-
EUR 2565.00
-
EUR 753.00
-
EUR 391.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with Biotin. |
Elastin (ELN) Polyclonal Antibody (Human), Cy3 |
4-PAB337Hu08-Cy3 |
Cloud-Clone |
-
EUR 432.00
-
EUR 4517.00
-
EUR 1223.00
-
EUR 564.00
-
EUR 257.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with Cy3. |
Elastin (ELN) Polyclonal Antibody (Human), FITC |
4-PAB337Hu08-FITC |
Cloud-Clone |
-
EUR 304.00
-
EUR 2755.00
-
EUR 778.00
-
EUR 383.00
-
EUR 199.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with FITC. |
Elastin (ELN) Polyclonal Antibody (Human), HRP |
4-PAB337Hu08-HRP |
Cloud-Clone |
-
EUR 324.00
-
EUR 2979.00
-
EUR 838.00
-
EUR 410.00
-
EUR 210.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with HRP. |
Elastin (ELN) Polyclonal Antibody (Human), PE |
4-PAB337Hu08-PE |
Cloud-Clone |
-
EUR 304.00
-
EUR 2755.00
-
EUR 778.00
-
EUR 383.00
-
EUR 199.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with PE. |
Elastin (ELN) Polyclonal Antibody (Mouse), APC |
4-PAB337Mu01-APC |
Cloud-Clone |
-
EUR 340.00
-
EUR 3203.00
-
EUR 894.00
-
EUR 432.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ELN (Pro266~Gly443)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with APC. |
Elastin (ELN) Polyclonal Antibody (Mouse), Biotinylated |
4-PAB337Mu01-Biotin |
Cloud-Clone |
-
EUR 307.00
-
EUR 2407.00
-
EUR 714.00
-
EUR 375.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ELN (Pro266~Gly443)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with Biotin. |
Elastin (ELN) Polyclonal Antibody (Mouse), Cy3 |
4-PAB337Mu01-Cy3 |
Cloud-Clone |
-
EUR 411.00
-
EUR 4229.00
-
EUR 1151.00
-
EUR 535.00
-
EUR 248.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ELN (Pro266~Gly443)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with Cy3. |
Elastin (ELN) Polyclonal Antibody (Mouse), FITC |
4-PAB337Mu01-FITC |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ELN (Pro266~Gly443)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with FITC. |
Elastin (ELN) Polyclonal Antibody (Mouse), HRP |
4-PAB337Mu01-HRP |
Cloud-Clone |
-
EUR 311.00
-
EUR 2792.00
-
EUR 791.00
-
EUR 391.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ELN (Pro266~Gly443)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with HRP. |
Elastin (ELN) Polyclonal Antibody (Mouse), PE |
4-PAB337Mu01-PE |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ELN (Pro266~Gly443)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with PE. |
Rabbit Elastin (ELN) ELISA Kit |
abx354258-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Elastin (ELN) Antibody |
20-abx007872 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Elastin (ELN) Antibody |
20-abx176238 |
Abbexa |
|
|
|
Elastin (ELN) Antibody |
20-abx176239 |
Abbexa |
|
|
|
Elastin (ELN) Antibody |
20-abx211321 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Elastin (ELN) Antibody |
20-abx100085 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1149.00
-
EUR 565.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Elastin (ELN) Antibody |
20-abx100086 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1177.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Elastin (ELN) Antibody |
20-abx100087 |
Abbexa |
|
|
|
Elastin (ELN) Antibody |
20-abx132104 |
Abbexa |
-
EUR 328.00
-
EUR 815.00
-
EUR 425.00
-
EUR 154.00
-
EUR 258.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Elastin (ELN) Antibody |
20-abx132220 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1261.00
-
EUR 606.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Elastin (ELN) Antibody |
20-abx146903 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Elastin (ELN) Antibody |
20-abx172209 |
Abbexa |
|
|
|
ELN Conjugated Antibody |
C35724 |
SAB |
100ul |
EUR 397 |
ELN Conjugated Antibody |
C38448 |
SAB |
100ul |
EUR 397 |
Elastin (ELN) Antibody |
20-abx339544 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Elastin (ELN) Antibody |
20-abx002068 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Anti-ELN antibody |
STJ114307 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein that is one of the two components of elastic fibers. The encoded protein is rich in hydrophobic amino acids such as glycine and proline, which form mobile hydrophobic regions bounded by crosslinks between lysine residues. Deletions and mutations in this gene are associated with supravalvular aortic stenosis (SVAS) and autosomal dominant cutis laxa. Multiple transcript variants encoding different isoforms have been found for this gene. |
Anti-ELN antibody |
STJ192995 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to ELN |
Anti-ELN antibody |
STJ23529 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein that is one of the two components of elastic fibers. The encoded protein is rich in hydrophobic amino acids such as glycine and proline, which form mobile hydrophobic regions bounded by crosslinks between lysine residues. Deletions and mutations in this gene are associated with supravalvular aortic stenosis (SVAS) and autosomal dominant cutis laxa. Multiple transcript variants encoding different isoforms have been found for this gene. |
Elastin (ELN) Polyclonal Antibody (Human), APC-Cy7 |
4-PAB337Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 547.00
-
EUR 6106.00
-
EUR 1624.00
-
EUR 727.00
-
EUR 310.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ELN (Gly392~Ala645)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with APC-Cy7. |
Elastin (ELN) Polyclonal Antibody (Human), APC-Cy7 |
4-PAB337Hu08-APC-Cy7 |
Cloud-Clone |
-
EUR 590.00
-
EUR 6718.00
-
EUR 1777.00
-
EUR 788.00
-
EUR 328.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with APC-Cy7. |
Elastin (ELN) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAB337Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 560.00
-
EUR 6286.00
-
EUR 1669.00
-
EUR 745.00
-
EUR 315.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ELN (Pro266~Gly443)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with APC-Cy7. |
ELISA kit for Rabbit ELN (Elastin) |
E-EL-RB0506 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's ELN ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rabbit ELN. Standards or samples are added to the micro ELISA plate wells and combined with the
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Rabbit ELN (Elastin) in samples from Serum, Plasma, Cell supernatant |
ELN siRNA |
20-abx901701 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ELN siRNA |
20-abx915285 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ELN siRNA |
20-abx915286 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Elastin (ELN) Antibody (FITC) |
20-abx271077 |
Abbexa |
-
EUR 467.00
-
EUR 244.00
-
EUR 1386.00
-
EUR 648.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Elastin (ELN) Antibody (Biotin) |
20-abx271340 |
Abbexa |
-
EUR 453.00
-
EUR 244.00
-
EUR 1288.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Elastin (ELN) Antibody (Biotin) |
20-abx272127 |
Abbexa |
-
EUR 439.00
-
EUR 244.00
-
EUR 1261.00
-
EUR 606.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Elastin (ELN) Antibody Pair |
20-abx370672 |
Abbexa |
|
-
10 × 96 tests
-
5 × 96 tests
|
- Shipped within 5-15 working days.
|
Elastin (ELN) Antibody (FITC) |
20-abx273707 |
Abbexa |
-
EUR 467.00
-
EUR 244.00
-
EUR 1358.00
-
EUR 648.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Elastin (ELN) Monoclonal Antibody (Human) |
4-MAB337Hu21 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2523.00
-
EUR 628.00
-
EUR 311.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Gly392~Ala645
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Elastin (ELN) |
ELN Blocking Peptide |
DF7064-BP |
Affbiotech |
1mg |
EUR 195 |
ELN cloning plasmid |
CSB-CL007617HU-10ug |
Cusabio |
10ug |
EUR 663 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1977
- Sequence: atggcgggtctgacggcggcggccccgcggcccggagtcctcctgctcctgctgtccatcctccacccctctcggcctggaggggtccctggggccattcctggtggagttcctggaggagtcttttatccaggggctggtctcggagcccttggaggaggagcgctggggcctg
- Show more
|
Description: A cloning plasmid for the ELN gene. |
Recombinant Elastin (ELN) |
4-RPB337Hu01 |
Cloud-Clone |
-
EUR 476.32
-
EUR 230.00
-
EUR 1511.20
-
EUR 570.40
-
EUR 1040.80
-
EUR 382.00
-
EUR 3628.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P15502
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 22.9kDa
- Isoelectric Point: 10.3
|
Description: Recombinant Human Elastin expressed in: E.coli |
Recombinant Elastin (ELN) |
4-RPB337Mu01 |
Cloud-Clone |
-
EUR 499.62
-
EUR 236.00
-
EUR 1598.56
-
EUR 599.52
-
EUR 1099.04
-
EUR 397.00
-
EUR 3846.40
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P54320
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 47.3kDa
- Isoelectric Point: 9
|
Description: Recombinant Mouse Elastin expressed in: E.coli |
Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody |
BNUB1981-100 |
Biotium |
100uL |
EUR 264 |
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), Concentration: 0.2mg/mL |
Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody |
BNUB1981-50 |
Biotium |
50uL |
EUR 405 |
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), 1mg/mL |
Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody |
BNUB1981-500 |
Biotium |
500uL |
EUR 513 |
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), Concentration: 0.2mg/mL |
Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody |
BNC551981-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF555 conjugate, Concentration: 0.1mg/mL |
Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody |
BNC551981-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF555 conjugate, Concentration: 0.1mg/mL |
Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody |
BNC611981-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF660R conjugate, Concentration: 0.1mg/mL |
Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody |
BNC611981-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF660R conjugate, Concentration: 0.1mg/mL |
Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody |
BNC471981-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF647 conjugate, Concentration: 0.1mg/mL |
Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody |
BNC471981-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF647 conjugate, Concentration: 0.1mg/mL |
Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody |
BNC041981-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF405S conjugate, Concentration: 0.1mg/mL |
Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody |
BNC041981-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF405S conjugate, Concentration: 0.1mg/mL |
Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody |
BNC051981-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF405M conjugate, Concentration: 0.1mg/mL |
Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody |
BNC051981-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF405M conjugate, Concentration: 0.1mg/mL |
Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody |
BNC401981-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF640R conjugate, Concentration: 0.1mg/mL |
Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody |
BNC401981-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF640R conjugate, Concentration: 0.1mg/mL |
Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody |
BNC431981-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF543 conjugate, Concentration: 0.1mg/mL |
Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody |
BNC431981-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF543 conjugate, Concentration: 0.1mg/mL |
Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody |
BNC701981-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF770 conjugate, Concentration: 0.1mg/mL |
Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody |
BNC701981-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF770 conjugate, Concentration: 0.1mg/mL |
Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody |
BNC801981-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF680 conjugate, Concentration: 0.1mg/mL |
Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody |
BNC801981-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF680 conjugate, Concentration: 0.1mg/mL |
Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody |
BNCH1981-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL |
Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody |
BNCH1981-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL |
Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody |
BNCP1981-250 |
Biotium |
250uL |
EUR 394 |
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), PerCP conjugate, Concentration: 0.1mg/mL |
Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody |
BNCR1981-250 |
Biotium |
250uL |
EUR 394 |
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), RPE conjugate, Concentration: 0.1mg/mL |
Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody |
BNC941981-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF594 conjugate, Concentration: 0.1mg/mL |
Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody |
BNC941981-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF594 conjugate, Concentration: 0.1mg/mL |
Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody |
BNCA1981-250 |
Biotium |
250uL |
EUR 394 |
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), APC conjugate, Concentration: 0.1mg/mL |
Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody |
BNCB1981-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), Biotin conjugate, Concentration: 0.1mg/mL |
Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody |
BNCB1981-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), Biotin conjugate, Concentration: 0.1mg/mL |
Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody |
BNC881981-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF488A conjugate, Concentration: 0.1mg/mL |
Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody |
BNC881981-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF488A conjugate, Concentration: 0.1mg/mL |
Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody |
BNC681981-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF568 conjugate, Concentration: 0.1mg/mL |
Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody |
BNC681981-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF568 conjugate, Concentration: 0.1mg/mL |
Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody |
BNCAP1981-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL |
Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody |
BNCAP1981-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL |
Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody |
BNC811981-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF680R conjugate, Concentration: 0.1mg/mL |
Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody |
BNC811981-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF680R conjugate, Concentration: 0.1mg/mL |
Elastin (ELN) MonoSpecific Antibody, Unconjugated-20ug |
2006-MSM1-P0 |
EnQuireBio |
20ug |
EUR 233 |
Elastin (ELN) MonoSpecific Antibody, Unconjugated-100ug |
2006-MSM1-P1 |
EnQuireBio |
100ug |
EUR 428 |
Elastin (ELN) Monoclonal Antibody (Human), APC |
4-MAB337Hu21-APC |
Cloud-Clone |
-
EUR 346.00
-
EUR 3293.00
-
EUR 917.00
-
EUR 441.00
-
EUR 220.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Gly392~Ala645
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Elastin (ELN). This antibody is labeled with APC. |
Elastin (ELN) Monoclonal Antibody (Human), Biotinylated |
4-MAB337Hu21-Biotin |
Cloud-Clone |
-
EUR 312.00
-
EUR 2473.00
-
EUR 730.00
-
EUR 382.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Gly392~Ala645
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Elastin (ELN). This antibody is labeled with Biotin. |
Elastin (ELN) Monoclonal Antibody (Human), Cy3 |
4-MAB337Hu21-Cy3 |
Cloud-Clone |
-
EUR 420.00
-
EUR 4349.00
-
EUR 1181.00
-
EUR 547.00
-
EUR 252.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Gly392~Ala645
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Elastin (ELN). This antibody is labeled with Cy3. |
Elastin (ELN) Monoclonal Antibody (Human), FITC |
4-MAB337Hu21-FITC |
Cloud-Clone |
-
EUR 297.00
-
EUR 2654.00
-
EUR 753.00
-
EUR 373.00
-
EUR 196.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Gly392~Ala645
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Elastin (ELN). This antibody is labeled with FITC. |
Elastin (ELN) Monoclonal Antibody (Human), HRP |
4-MAB337Hu21-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2870.00
-
EUR 811.00
-
EUR 399.00
-
EUR 207.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Gly392~Ala645
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Elastin (ELN). This antibody is labeled with HRP. |
Elastin (ELN) Monoclonal Antibody (Human), PE |
4-MAB337Hu21-PE |
Cloud-Clone |
-
EUR 297.00
-
EUR 2654.00
-
EUR 753.00
-
EUR 373.00
-
EUR 196.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Gly392~Ala645
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Elastin (ELN). This antibody is labeled with PE. |
Human Elastin (ELN) Protein |
20-abx066394 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2040.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Mouse Elastin (ELN) Protein |
20-abx066395 |
Abbexa |
-
EUR 704.00
-
EUR 286.00
-
EUR 2151.00
-
EUR 829.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human ELN ELISA Kit |
EHE0057 |
Abclonal |
96Tests |
EUR 521 |
Goat ELN ELISA Kit |
EGTE0057 |
Abclonal |
96Tests |
EUR 521 |
Bovine ELN ELISA Kit |
EBE0057 |
Abclonal |
96Tests |
EUR 521 |
Canine ELN ELISA Kit |
ECE0057 |
Abclonal |
96Tests |
EUR 521 |
Chicken ELN ELISA Kit |
ECKE0057 |
Abclonal |
96Tests |
EUR 521 |
Anserini ELN ELISA Kit |
EAE0057 |
Abclonal |
96Tests |
EUR 521 |
OVA Conjugated Elastin (ELN) |
4-CPB337Hu21 |
Cloud-Clone |
-
EUR 226.34
-
EUR 163.00
-
EUR 573.76
-
EUR 257.92
-
EUR 415.84
-
EUR 214.00
-
EUR 1284.40
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P15502
- Buffer composition: PBS, pH 7.4.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): Inquire
- Isoelectric Point: Inquire
|
Description: Recombinant Human Elastin expressed in: chemical synthesis |
KLH conjugated Elastin (ELN) |
4-CPB337Hu31 |
Cloud-Clone |
-
EUR 413.60
-
EUR 214.00
-
EUR 1276.00
-
EUR 492.00
-
EUR 884.00
-
EUR 340.00
-
EUR 3040.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P15502
- Buffer composition: PBS, pH 7.4.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): Inquire
- Isoelectric Point: Inquire
|
Description: Recombinant Human Elastin expressed in: chemical synthesis |
ELN Rabbit Polyclonal Antibody