TAF9 Rabbit Polyclonal Antibody

TAF9 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

TAF9 Polyclonal Antibody

ABP60614-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TAF9 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TAF9 from Human, Mouse, Rat. This TAF9 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TAF9 protein

TAF9 Rabbit pAb

A2021-100ul 100 ul
EUR 308

TAF9 Rabbit pAb

A2021-200ul 200 ul
EUR 459

TAF9 Rabbit pAb

A2021-20ul 20 ul
EUR 183

TAF9 Rabbit pAb

A2021-50ul 50 ul
EUR 223

TAF9 antibody

70R-20696 50 ul
EUR 435
Description: Rabbit polyclonal TAF9 antibody

TAF9 antibody

70R-8040 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal TAF9 antibody

TAF9 Antibody

ABD6757 100 ug
EUR 438

TAF9 Antibody

32554-100ul 100ul
EUR 252

TAF9 Antibody

DF6757 200ul
EUR 304
Description: TAF9 Antibody detects endogenous levels of total TAF9.

TAF9 Antibody

1-CSB-PA619078ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TAF9. Recognizes TAF9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

TAF9 Antibody

1-CSB-PA023100GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TAF9. Recognizes TAF9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

TAF9 Conjugated Antibody

C32554 100ul
EUR 397

anti- TAF9 antibody

FNab08489 100µg
EUR 548.75
  • Immunogen: TAF9 RNA polymerase II, TATA box binding protein(TBP)-associated factor, 32kDa
  • Uniprot ID: Q16594
  • Gene ID: 6880
  • Research Area: Metabolism
Description: Antibody raised against TAF9

Human TAF9 Antibody

32211-05111 150 ug
EUR 261

Anti-TAF9 antibody

PAab08489 100 ug
EUR 386

Anti-TAF9 antibody

STJ25772 100 µl
EUR 277
Description: Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the smaller subunits of TFIID that binds to the basal transcription factor GTF2B as well as to several transcriptional activators such as p53 and VP16. In human, TAF9 and AK6 (GeneID: 102157402) are two distinct genes that share 5' exons. A similar but distinct gene (TAF9L) has been found on the X chromosome and a pseudogene has been identified on chromosome 19. Alternative splicing results in multiple transcript variants.

Anti-TAF9 antibody

STJ193048 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TAF9

Taf9/ Rat Taf9 ELISA Kit

ELI-53088r 96 Tests
EUR 886

Taf9/ Rat Taf9 ELISA Kit

ELI-42939r 96 Tests
EUR 886

TAF9 siRNA

20-abx905447
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TAF9 siRNA

20-abx935993
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TAF9 siRNA

20-abx935994
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pENTR223-TAF9

PVT12668 2 ug
EUR 391

TAF9 Blocking Peptide

33R-3402 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TAF9 antibody, catalog no. 70R-8040

TAF9 Blocking Peptide

DF6757-BP 1mg
EUR 195

TAF9 cloning plasmid

CSB-CL619078HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 519
  • Sequence: atgttgcttccgaacatcctgctcaccggtacaccaggggttggaaaaaccacactaggcaaagaacttgcgtcaaaatcaggactgaaatacattaatgtgggtgatttagctcgagaagagcaattgtatgatggctatgatgaagagtatgactgtcccattttagatgaaga
  • Show more
Description: A cloning plasmid for the TAF9 gene.

TAF9 cloning plasmid

CSB-CL619078HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 795
  • Sequence: atggagtctggcaagacggcttctcccaagagcatgccgaaagatgcacagatgatggcacaaatcctgaaggatatggggattacagaatatgagccaagagttataaatcagatgttggagtttgccttccgatatgtgaccacaattctagatgatgcaaaaatttattcaag
  • Show more
Description: A cloning plasmid for the TAF9 gene.

pCMV-SPORT6-TAF9

PVT18246 2 ug
EUR 231

Human TAF9 Antibody (Biotin Conjugate)

32211-05121 150 ug
EUR 369

Rabbit Adenylate kinase isoenzyme 6, TAF9 ELISA KIT

ELI-13360Ra 96 Tests
EUR 928

Human TAF9 AssayLite Antibody (FITC Conjugate)

32211-05141 150 ug
EUR 428

Human TAF9 AssayLite Antibody (RPE Conjugate)

32211-05151 150 ug
EUR 428

Human TAF9 AssayLite Antibody (APC Conjugate)

32211-05161 150 ug
EUR 428

Human TAF9 AssayLite Antibody (PerCP Conjugate)

32211-05171 150 ug
EUR 471

Mouse TAF9 shRNA Plasmid

20-abx979898
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Taf9 ELISA KIT

ELI-17301m 96 Tests
EUR 865

TAF9 ELISA KIT|Human

EF003444 96 Tests
EUR 689

Human TAF9 ELISA KIT

ELI-51992h 96 Tests
EUR 824

Bovine TAF9 ELISA KIT

ELI-53087b 96 Tests
EUR 928

Human TAF9 shRNA Plasmid

20-abx954709
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TAF9 protein (His tag)

80R-1656 100 ug
EUR 305
Description: Purified recombinant Human TAF9 protein

Rat TAF9 shRNA Plasmid

20-abx990703
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TAF9 Recombinant Protein (Human)

RP030871 100 ug Ask for price

TAF9 Recombinant Protein (Human)

RP030874 100 ug Ask for price

TAF9 Recombinant Protein (Rat)

RP232193 100 ug Ask for price

TAF9 Recombinant Protein (Rat)

RP232196 100 ug Ask for price

TAF9 Recombinant Protein (Rat)

RP232199 100 ug Ask for price

TAF9 Recombinant Protein (Mouse)

RP177140 100 ug Ask for price

TAF9 Recombinant Protein (Mouse)

RP177143 100 ug Ask for price

TAF9 Recombinant Protein (Mouse)

RP177146 100 ug Ask for price

TAF9 Recombinant Protein Human

PROTQ16594 Regular: 20ug
EUR 317
Description: TAF9 produced in E.Coli is a single, non-glycosylated polypeptide chain containing 192 amino acids (1-172.a.a) and having a molecular mass of 22.2kDa. ;TAF9 is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

TAF9 RNA Polymerase II (Recombinant)

20-abx073191
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Taf9 ORF Vector (Mouse) (pORF)

ORF059048 1.0 ug DNA
EUR 506

Taf9 ORF Vector (Mouse) (pORF)

ORF059049 1.0 ug DNA
EUR 506

Taf9 ORF Vector (Mouse) (pORF)

ORF059050 1.0 ug DNA
EUR 506

TAF9 ORF Vector (Human) (pORF)

ORF010291 1.0 ug DNA
EUR 95

TAF9 ORF Vector (Human) (pORF)

ORF010292 1.0 ug DNA
EUR 95

Taf9 ORF Vector (Rat) (pORF)

ORF077399 1.0 ug DNA
EUR 506

Taf9 ORF Vector (Rat) (pORF)

ORF077400 1.0 ug DNA
EUR 506

Taf9 ORF Vector (Rat) (pORF)

ORF077401 1.0 ug DNA
EUR 506

Recombinant Human TAF9 RNA Polymerase II

7-03625 5µg Ask for price

Recombinant Human TAF9 RNA Polymerase II

7-03626 20µg Ask for price

Recombinant Human TAF9 RNA Polymerase II

7-03627 1mg Ask for price

TAF9 sgRNA CRISPR Lentivector set (Human)

K2329001 3 x 1.0 ug
EUR 339

Taf9 sgRNA CRISPR Lentivector set (Mouse)

K4809801 3 x 1.0 ug
EUR 339

Taf9 sgRNA CRISPR Lentivector set (Rat)

K7139101 3 x 1.0 ug
EUR 339

TATA-Box Binding Protein Associated Factor 9 (TAF9) Antibody

20-abx115982
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

TATA-Box Binding Protein Associated Factor 9 (TAF9) Antibody

20-abx001640
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

TATA-Box Binding Protein Associated Factor 9 (TAF9) Antibody

abx028165-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

TATA-Box Binding Protein Associated Factor 9 (TAF9) Antibody

abx028165-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

TATA-Box Binding Protein Associated Factor 9 (TAF9) Antibody

abx238489-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

TAF9 sgRNA CRISPR Lentivector (Human) (Target 1)

K2329002 1.0 ug DNA
EUR 154

TAF9 sgRNA CRISPR Lentivector (Human) (Target 2)

K2329003 1.0 ug DNA
EUR 154

TAF9 sgRNA CRISPR Lentivector (Human) (Target 3)

K2329004 1.0 ug DNA
EUR 154

Taf9 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4809802 1.0 ug DNA
EUR 154

Taf9 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4809803 1.0 ug DNA
EUR 154

Taf9 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4809804 1.0 ug DNA
EUR 154

Taf9 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7139102 1.0 ug DNA
EUR 154

Taf9 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7139103 1.0 ug DNA
EUR 154

Taf9 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7139104 1.0 ug DNA
EUR 154

TAF9 Protein Vector (Human) (pPB-C-His)

PV041161 500 ng
EUR 329

TAF9 Protein Vector (Human) (pPB-N-His)

PV041162 500 ng
EUR 329

TAF9 Protein Vector (Human) (pPM-C-HA)

PV041163 500 ng
EUR 329

TAF9 Protein Vector (Human) (pPM-C-His)

PV041164 500 ng
EUR 329

TAF9 Protein Vector (Human) (pPB-C-His)

PV041165 500 ng
EUR 329

TAF9 Protein Vector (Human) (pPB-N-His)

PV041166 500 ng
EUR 329

TAF9 Protein Vector (Human) (pPM-C-HA)

PV041167 500 ng
EUR 329

TAF9 Protein Vector (Human) (pPM-C-His)

PV041168 500 ng
EUR 329

Recombinant Human TAF9 Protein, His, E.coli-1mg

QP13686-1mg 1mg
EUR 2757

Recombinant Human TAF9 Protein, His, E.coli-20ug

QP13686-20ug 20ug
EUR 201

Recombinant Human TAF9 Protein, His, E.coli-5ug

QP13686-5ug 5ug
EUR 155

TAF9 Protein Vector (Rat) (pPB-C-His)

PV309594 500 ng
EUR 603

TAF9 Protein Vector (Rat) (pPB-N-His)

PV309595 500 ng
EUR 603

TAF9 Protein Vector (Rat) (pPM-C-HA)

PV309596 500 ng
EUR 603

TAF9 Protein Vector (Rat) (pPM-C-His)

PV309597 500 ng
EUR 603

TAF9 Protein Vector (Rat) (pPB-C-His)

PV309598 500 ng
EUR 603

TAF9 Protein Vector (Rat) (pPB-N-His)

PV309599 500 ng
EUR 603

TAF9 Protein Vector (Rat) (pPM-C-HA)

PV309600 500 ng
EUR 603

TAF9 Protein Vector (Rat) (pPM-C-His)

PV309601 500 ng
EUR 603

TAF9 Protein Vector (Rat) (pPB-C-His)

PV309602 500 ng
EUR 603

TAF9 Protein Vector (Rat) (pPB-N-His)

PV309603 500 ng
EUR 603

TAF9 Protein Vector (Rat) (pPM-C-HA)

PV309604 500 ng
EUR 603

TAF9 Protein Vector (Rat) (pPM-C-His)

PV309605 500 ng
EUR 603

TAF9 Protein Vector (Mouse) (pPB-C-His)

PV236190 500 ng
EUR 603

TAF9 Protein Vector (Mouse) (pPB-N-His)

PV236191 500 ng
EUR 603

TAF9 Protein Vector (Mouse) (pPM-C-HA)

PV236192 500 ng
EUR 603

TAF9 Protein Vector (Mouse) (pPM-C-His)

PV236193 500 ng
EUR 603

TAF9 Protein Vector (Mouse) (pPB-C-His)

PV236194 500 ng
EUR 603

TAF9 Protein Vector (Mouse) (pPB-N-His)

PV236195 500 ng
EUR 603

TAF9 Protein Vector (Mouse) (pPM-C-HA)

PV236196 500 ng
EUR 603

TAF9 Protein Vector (Mouse) (pPM-C-His)

PV236197 500 ng
EUR 603

TAF9 Protein Vector (Mouse) (pPB-C-His)

PV236198 500 ng
EUR 603

TAF9 Protein Vector (Mouse) (pPB-N-His)

PV236199 500 ng
EUR 603

TAF9 Protein Vector (Mouse) (pPM-C-HA)

PV236200 500 ng
EUR 603

TAF9 Protein Vector (Mouse) (pPM-C-His)

PV236201 500 ng
EUR 603

Taf9 3'UTR GFP Stable Cell Line

TU170114 1.0 ml Ask for price

Taf9 3'UTR Luciferase Stable Cell Line

TU120114 1.0 ml Ask for price

TAF9 3'UTR GFP Stable Cell Line

TU075092 1.0 ml
EUR 1394

TAF9 3'UTR Luciferase Stable Cell Line

TU025092 1.0 ml
EUR 1394

Taf9 3'UTR Luciferase Stable Cell Line

TU221556 1.0 ml Ask for price

Taf9 3'UTR GFP Stable Cell Line

TU271556 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody

ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

TAF9 Rabbit Polyclonal Antibody