TAF9 Rabbit Polyclonal Antibody
To Order Now: info@poweratlas.org
 TAF9 Polyclonal Antibody |
|
ABP60614-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human TAF9 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of TAF9 from Human, Mouse, Rat. This TAF9 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TAF9 protein |
 TAF9 Rabbit pAb |
|
A2021-100ul |
Abclonal |
100 ul |
EUR 308 |
TAF9 Rabbit pAb |
|
A2021-200ul |
Abclonal |
200 ul |
EUR 459 |
TAF9 Rabbit pAb |
|
A2021-20ul |
Abclonal |
20 ul |
EUR 183 |
TAF9 Rabbit pAb |
|
A2021-50ul |
Abclonal |
50 ul |
EUR 223 |
 TAF9 antibody |
|
70R-20696 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal TAF9 antibody |
TAF9 antibody |
|
70R-8040 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Affinity purified rabbit polyclonal TAF9 antibody |
 TAF9 Antibody |
|
32554-100ul |
SAB |
100ul |
EUR 252 |
TAF9 Antibody |
|
DF6757 |
Affbiotech |
200ul |
EUR 304 |
|
Description: TAF9 Antibody detects endogenous levels of total TAF9. |
TAF9 Antibody |
|
1-CSB-PA619078ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against TAF9. Recognizes TAF9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
TAF9 Antibody |
|
1-CSB-PA023100GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against TAF9. Recognizes TAF9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
 TAF9 Conjugated Antibody |
|
C32554 |
SAB |
100ul |
EUR 397 |
 anti- TAF9 antibody |
|
FNab08489 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: TAF9 RNA polymerase II, TATA box binding protein(TBP)-associated factor, 32kDa
- Uniprot ID: Q16594
- Gene ID: 6880
- Research Area: Metabolism
|
|
Description: Antibody raised against TAF9 |
 Human TAF9 Antibody |
|
32211-05111 |
AssayPro |
150 ug |
EUR 261 |
 Anti-TAF9 antibody |
|
STJ25772 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the smaller subunits of TFIID that binds to the basal transcription factor GTF2B as well as to several transcriptional activators such as p53 and VP16. In human, TAF9 and AK6 (GeneID: 102157402) are two distinct genes that share 5' exons. A similar but distinct gene (TAF9L) has been found on the X chromosome and a pseudogene has been identified on chromosome 19. Alternative splicing results in multiple transcript variants. |
Anti-TAF9 antibody |
|
STJ193048 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to TAF9 |
 TAF9 siRNA |
|
20-abx905447 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TAF9 siRNA |
|
20-abx935993 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TAF9 siRNA |
|
20-abx935994 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 TAF9 Blocking Peptide |
|
33R-3402 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TAF9 antibody, catalog no. 70R-8040 |
TAF9 Blocking Peptide |
|
DF6757-BP |
Affbiotech |
1mg |
EUR 195 |
 TAF9 cloning plasmid |
|
CSB-CL619078HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 519
- Sequence: atgttgcttccgaacatcctgctcaccggtacaccaggggttggaaaaaccacactaggcaaagaacttgcgtcaaaatcaggactgaaatacattaatgtgggtgatttagctcgagaagagcaattgtatgatggctatgatgaagagtatgactgtcccattttagatgaaga
- Show more
|
|
Description: A cloning plasmid for the TAF9 gene. |
TAF9 cloning plasmid |
|
CSB-CL619078HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 795
- Sequence: atggagtctggcaagacggcttctcccaagagcatgccgaaagatgcacagatgatggcacaaatcctgaaggatatggggattacagaatatgagccaagagttataaatcagatgttggagtttgccttccgatatgtgaccacaattctagatgatgcaaaaatttattcaag
- Show more
|
|
Description: A cloning plasmid for the TAF9 gene. |
) Human TAF9 Antibody (Biotin Conjugate) |
|
32211-05121 |
AssayPro |
150 ug |
EUR 369 |
 Rabbit Adenylate kinase isoenzyme 6, TAF9 ELISA KIT |
|
ELI-13360Ra |
Lifescience Market |
96 Tests |
EUR 928 |
) Human TAF9 AssayLite Antibody (FITC Conjugate) |
|
32211-05141 |
AssayPro |
150 ug |
EUR 428 |
) Human TAF9 AssayLite Antibody (RPE Conjugate) |
|
32211-05151 |
AssayPro |
150 ug |
EUR 428 |
) Human TAF9 AssayLite Antibody (APC Conjugate) |
|
32211-05161 |
AssayPro |
150 ug |
EUR 428 |
) Human TAF9 AssayLite Antibody (PerCP Conjugate) |
|
32211-05171 |
AssayPro |
150 ug |
EUR 471 |
 Mouse TAF9 shRNA Plasmid |
|
20-abx979898 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human TAF9 shRNA Plasmid |
|
20-abx954709 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) TAF9 protein (His tag) |
|
80R-1656 |
Fitzgerald |
100 ug |
EUR 305 |
|
Description: Purified recombinant Human TAF9 protein |
 Rat TAF9 shRNA Plasmid |
|
20-abx990703 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) TAF9 Recombinant Protein (Human) |
|
RP030871 |
ABM |
100 ug |
Ask for price |
TAF9 Recombinant Protein (Human) |
|
RP030874 |
ABM |
100 ug |
Ask for price |
) TAF9 Recombinant Protein (Rat) |
|
RP232193 |
ABM |
100 ug |
Ask for price |
TAF9 Recombinant Protein (Rat) |
|
RP232196 |
ABM |
100 ug |
Ask for price |
TAF9 Recombinant Protein (Rat) |
|
RP232199 |
ABM |
100 ug |
Ask for price |
) TAF9 Recombinant Protein (Mouse) |
|
RP177140 |
ABM |
100 ug |
Ask for price |
TAF9 Recombinant Protein (Mouse) |
|
RP177143 |
ABM |
100 ug |
Ask for price |
TAF9 Recombinant Protein (Mouse) |
|
RP177146 |
ABM |
100 ug |
Ask for price |
 TAF9 Recombinant Protein Human |
|
PROTQ16594 |
BosterBio |
Regular: 20ug |
EUR 317 |
|
Description: TAF9 produced in E.Coli is a single, non-glycosylated polypeptide chain containing 192 amino acids (1-172.a.a) and having a molecular mass of 22.2kDa. ;TAF9 is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
) TAF9 RNA Polymerase II (Recombinant) |
|
20-abx073191 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
 (pORF)) Taf9 ORF Vector (Mouse) (pORF) |
|
ORF059048 |
ABM |
1.0 ug DNA |
EUR 506 |
Taf9 ORF Vector (Mouse) (pORF) |
|
ORF059049 |
ABM |
1.0 ug DNA |
EUR 506 |
Taf9 ORF Vector (Mouse) (pORF) |
|
ORF059050 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) TAF9 ORF Vector (Human) (pORF) |
|
ORF010291 |
ABM |
1.0 ug DNA |
EUR 95 |
TAF9 ORF Vector (Human) (pORF) |
|
ORF010292 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Taf9 ORF Vector (Rat) (pORF) |
|
ORF077399 |
ABM |
1.0 ug DNA |
EUR 506 |
Taf9 ORF Vector (Rat) (pORF) |
|
ORF077400 |
ABM |
1.0 ug DNA |
EUR 506 |
Taf9 ORF Vector (Rat) (pORF) |
|
ORF077401 |
ABM |
1.0 ug DNA |
EUR 506 |
 Recombinant Human TAF9 RNA Polymerase II |
|
7-03625 |
CHI Scientific |
5µg |
Ask for price |
Recombinant Human TAF9 RNA Polymerase II |
|
7-03626 |
CHI Scientific |
20µg |
Ask for price |
Recombinant Human TAF9 RNA Polymerase II |
|
7-03627 |
CHI Scientific |
1mg |
Ask for price |
) TAF9 sgRNA CRISPR Lentivector set (Human) |
|
K2329001 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Taf9 sgRNA CRISPR Lentivector set (Mouse) |
|
K4809801 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Taf9 sgRNA CRISPR Lentivector set (Rat) |
|
K7139101 |
ABM |
3 x 1.0 ug |
EUR 339 |
 Antibody) TATA-Box Binding Protein Associated Factor 9 (TAF9) Antibody |
|
20-abx115982 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TATA-Box Binding Protein Associated Factor 9 (TAF9) Antibody |
|
20-abx001640 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
TATA-Box Binding Protein Associated Factor 9 (TAF9) Antibody |
|
abx028165-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
TATA-Box Binding Protein Associated Factor 9 (TAF9) Antibody |
|
abx028165-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
TATA-Box Binding Protein Associated Factor 9 (TAF9) Antibody |
|
abx238489-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
 (Target 1)) TAF9 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K2329002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) TAF9 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K2329003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) TAF9 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K2329004 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Taf9 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4809802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Taf9 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4809803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Taf9 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4809804 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Taf9 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K7139102 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Taf9 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K7139103 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Taf9 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K7139104 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) TAF9 Protein Vector (Human) (pPB-C-His) |
|
PV041161 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) TAF9 Protein Vector (Human) (pPB-N-His) |
|
PV041162 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) TAF9 Protein Vector (Human) (pPM-C-HA) |
|
PV041163 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) TAF9 Protein Vector (Human) (pPM-C-His) |
|
PV041164 |
ABM |
500 ng |
EUR 329 |
TAF9 Protein Vector (Human) (pPB-C-His) |
|
PV041165 |
ABM |
500 ng |
EUR 329 |
TAF9 Protein Vector (Human) (pPB-N-His) |
|
PV041166 |
ABM |
500 ng |
EUR 329 |
TAF9 Protein Vector (Human) (pPM-C-HA) |
|
PV041167 |
ABM |
500 ng |
EUR 329 |
TAF9 Protein Vector (Human) (pPM-C-His) |
|
PV041168 |
ABM |
500 ng |
EUR 329 |
 Recombinant Human TAF9 Protein, His, E.coli-1mg |
|
QP13686-1mg |
EnQuireBio |
1mg |
EUR 2757 |
 Recombinant Human TAF9 Protein, His, E.coli-20ug |
|
QP13686-20ug |
EnQuireBio |
20ug |
EUR 201 |
 Recombinant Human TAF9 Protein, His, E.coli-5ug |
|
QP13686-5ug |
EnQuireBio |
5ug |
EUR 155 |
 (pPB-C-His)) TAF9 Protein Vector (Rat) (pPB-C-His) |
|
PV309594 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) TAF9 Protein Vector (Rat) (pPB-N-His) |
|
PV309595 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) TAF9 Protein Vector (Rat) (pPM-C-HA) |
|
PV309596 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) TAF9 Protein Vector (Rat) (pPM-C-His) |
|
PV309597 |
ABM |
500 ng |
EUR 603 |
TAF9 Protein Vector (Rat) (pPB-C-His) |
|
PV309598 |
ABM |
500 ng |
EUR 603 |
TAF9 Protein Vector (Rat) (pPB-N-His) |
|
PV309599 |
ABM |
500 ng |
EUR 603 |
TAF9 Protein Vector (Rat) (pPM-C-HA) |
|
PV309600 |
ABM |
500 ng |
EUR 603 |
TAF9 Protein Vector (Rat) (pPM-C-His) |
|
PV309601 |
ABM |
500 ng |
EUR 603 |
TAF9 Protein Vector (Rat) (pPB-C-His) |
|
PV309602 |
ABM |
500 ng |
EUR 603 |
TAF9 Protein Vector (Rat) (pPB-N-His) |
|
PV309603 |
ABM |
500 ng |
EUR 603 |
TAF9 Protein Vector (Rat) (pPM-C-HA) |
|
PV309604 |
ABM |
500 ng |
EUR 603 |
TAF9 Protein Vector (Rat) (pPM-C-His) |
|
PV309605 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) TAF9 Protein Vector (Mouse) (pPB-C-His) |
|
PV236190 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) TAF9 Protein Vector (Mouse) (pPB-N-His) |
|
PV236191 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) TAF9 Protein Vector (Mouse) (pPM-C-HA) |
|
PV236192 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) TAF9 Protein Vector (Mouse) (pPM-C-His) |
|
PV236193 |
ABM |
500 ng |
EUR 603 |
TAF9 Protein Vector (Mouse) (pPB-C-His) |
|
PV236194 |
ABM |
500 ng |
EUR 603 |
TAF9 Protein Vector (Mouse) (pPB-N-His) |
|
PV236195 |
ABM |
500 ng |
EUR 603 |
TAF9 Protein Vector (Mouse) (pPM-C-HA) |
|
PV236196 |
ABM |
500 ng |
EUR 603 |
TAF9 Protein Vector (Mouse) (pPM-C-His) |
|
PV236197 |
ABM |
500 ng |
EUR 603 |
TAF9 Protein Vector (Mouse) (pPB-C-His) |
|
PV236198 |
ABM |
500 ng |
EUR 603 |
TAF9 Protein Vector (Mouse) (pPB-N-His) |
|
PV236199 |
ABM |
500 ng |
EUR 603 |
TAF9 Protein Vector (Mouse) (pPM-C-HA) |
|
PV236200 |
ABM |
500 ng |
EUR 603 |
TAF9 Protein Vector (Mouse) (pPM-C-His) |
|
PV236201 |
ABM |
500 ng |
EUR 603 |
 Taf9 3'UTR GFP Stable Cell Line |
|
TU170114 |
ABM |
1.0 ml |
Ask for price |
 Taf9 3'UTR Luciferase Stable Cell Line |
|
TU120114 |
ABM |
1.0 ml |
Ask for price |
 TAF9 3'UTR GFP Stable Cell Line |
|
TU075092 |
ABM |
1.0 ml |
EUR 1394 |
 TAF9 3'UTR Luciferase Stable Cell Line |
|
TU025092 |
ABM |
1.0 ml |
EUR 1394 |
Taf9 3'UTR Luciferase Stable Cell Line |
|
TU221556 |
ABM |
1.0 ml |
Ask for price |
Taf9 3'UTR GFP Stable Cell Line |
|
TU271556 |
ABM |
1.0 ml |
Ask for price |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
|
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG5 Rabbit Polyclonal Antibody |
|
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
|
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG7 Rabbit Polyclonal Antibody |
|
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
|
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG13 Rabbit Polyclonal Antibody |
|
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG14L Rabbit Polyclonal Antibody |
|
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
|
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NBR1 Rabbit Polyclonal Antibody |
|
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Gab1 Rabbit Polyclonal Antibody |
|
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
|
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ERK1 Rabbit Polyclonal Antibody |
|
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
|
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
 HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
TAF9 Rabbit Polyclonal Antibody
