MVP Rabbit Polyclonal Antibody

MVP Rabbit Polyclonal Antibody

To Order Now:

MVP Polyclonal Antibody
ABP59347-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human MVP protein
  • Applications tips:
Description: A polyclonal antibody for detection of MVP from Human, Mouse, Rat. This MVP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MVP protein
MVP Polyclonal Antibody
ABP59347-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MVP protein
  • Applications tips:
Description: A polyclonal antibody for detection of MVP from Human, Mouse, Rat. This MVP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MVP protein
MVP Polyclonal Antibody
ABP59347-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MVP protein
  • Applications tips:
Description: A polyclonal antibody for detection of MVP from Human, Mouse, Rat. This MVP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MVP protein
MVP Polyclonal Antibody
ES11827-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MVP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
MVP Polyclonal Antibody
ES11827-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MVP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
Human Major Vault Protein (MVP) ELISA Kit
DLR-MVP-Hu-48T 48T
EUR 517
  • Should the Human Major Vault Protein (MVP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Major Vault Protein (MVP) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Major Vault Protein (MVP) ELISA Kit
DLR-MVP-Hu-96T 96T
EUR 673
  • Should the Human Major Vault Protein (MVP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Major Vault Protein (MVP) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Major Vault Protein (MVP) ELISA Kit
RDR-MVP-Hu-48Tests 48 Tests
EUR 544
Human Major Vault Protein (MVP) ELISA Kit
RDR-MVP-Hu-96Tests 96 Tests
EUR 756
Human Major Vault Protein (MVP) ELISA Kit
RD-MVP-Hu-48Tests 48 Tests
EUR 521
Human Major Vault Protein (MVP) ELISA Kit
RD-MVP-Hu-96Tests 96 Tests
EUR 723
MVP Rabbit pAb
A1980-100ul 100 ul
EUR 308
MVP Rabbit pAb
A1980-200ul 200 ul
EUR 459
MVP Rabbit pAb
A1980-20ul 20 ul
EUR 183
MVP Rabbit pAb
A1980-50ul 50 ul
EUR 223
Polyclonal MVP Antibody (N-term)
APR08581G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MVP (N-term). This antibody is tested and proven to work in the following applications:
MVP Polyclonal Antibody, HRP Conjugated
A56484 100 µg
EUR 570.55
Description: kits suitable for this type of research
MVP Polyclonal Antibody, FITC Conjugated
A56485 100 µg
EUR 570.55
Description: fast delivery possible
MVP Polyclonal Antibody, Biotin Conjugated
A56486 100 µg
EUR 570.55
Description: reagents widely cited
Rabbit MVP ELISA Kit
ERTM0362 96Tests
EUR 521
MVP antibody
70R-18687 50 ul
EUR 435
Description: Rabbit polyclonal MVP antibody
MVP antibody
70R-13556 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal MVP antibody
MVP antibody
70R-2052 50 ug
EUR 467
Description: Rabbit polyclonal MVP antibody raised against the N terminal of MVP
MVP Antibody
32533-100ul 100ul
EUR 252
MVP Antibody
49659-100ul 100ul
EUR 333
MVP Antibody
49659-50ul 50ul
EUR 239
MVP Antibody
49662-100ul 100ul
EUR 333
MVP Antibody
49662-50ul 50ul
EUR 239
MVP Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MVP. Recognizes MVP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200
MVP Antibody
DF6732 200ul
EUR 304
Description: MVP Antibody detects endogenous levels of total MVP.
MVP Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MVP. Recognizes MVP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
MVP Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MVP. Recognizes MVP from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:200-1:1000
MVP Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MVP. Recognizes MVP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100
MVP Antibody
ABD6732 100 ug
EUR 438
Polyclonal MVP / VAULT1 Antibody (aa878-893)
APR02315G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MVP / VAULT1 (aa878-893). This antibody is tested and proven to work in the following applications:
Major vault protein (MVP) polyclonal antibody
ABP-PAB-10900 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:
LRP(MVP) antibody
22901-100ul 100ul
EUR 390
Anti-MVP Antibody
A00642-1 100ug/vial
EUR 334
MVP Conjugated Antibody
C49659 100ul
EUR 397
MVP Conjugated Antibody
C32533 100ul
EUR 397
MVP / LRP Antibody
abx235449-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Anti-MVP antibody
STJ24649 100 µl
EUR 277
Description: This gene encodes the major component of the vault complex. Vaults are multi-subunit ribonucleoprotein structures that may be involved in nucleo-cytoplasmic transport. The encoded protein may play a role in multiple cellular processes by regulating the MAP kinase, JAK/STAT and phosphoinositide 3-kinase/Akt signaling pathways. The encoded protein also plays a role in multidrug resistance, and expression of this gene may be a prognostic marker for several types of cancer. Alternatively spliced transcript variants have been observed for this gene.
Anti-MVP antibody
STJ192985 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MVP
Mvp/ Rat Mvp ELISA Kit
ELI-03488r 96 Tests
EUR 886
Major Vault Protein (MVP) Polyclonal Antibody (Human)
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MVP (Ala2~Pro272)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Major Vault Protein (MVP)
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
MVP Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MVP. Recognizes MVP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
MVP Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MVP. Recognizes MVP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
MVP Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MVP. Recognizes MVP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
MVP recombinant monoclonal antibody
A5824 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human MVP for WB,ELISA
anti- MVP/LRP antibody
FNab05449 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:100
  • Immunogen: major vault protein
  • Uniprot ID: Q14764
  • Gene ID: 9961
  • Research Area: Cancer, Metabolism
Description: Antibody raised against MVP/LRP
Anti-MVP/LRP antibody
PAab05449 100 ug
EUR 355
Anti-LRP/MVP antibody
STJ16100893 1 mL
EUR 478
Anti-LRP/MVP antibody
STJ16100902 1 mL
EUR 478
Anti-MVP/LRP antibody
STJ16100910 100 µg
EUR 354
Anti-MVP/LRP antibody
STJ16100911 100 µg
EUR 354
Anti-MVP/LRP antibody
STJ16100912 100 µg
EUR 354
Major Vault Protein (MVP) Polyclonal Antibody (Human), APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MVP (Ala2~Pro272)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Major Vault Protein (MVP). This antibody is labeled with APC.
Major Vault Protein (MVP) Polyclonal Antibody (Human), Biotinylated
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MVP (Ala2~Pro272)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Major Vault Protein (MVP). This antibody is labeled with Biotin.
Major Vault Protein (MVP) Polyclonal Antibody (Human), Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MVP (Ala2~Pro272)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Major Vault Protein (MVP). This antibody is labeled with Cy3.
Major Vault Protein (MVP) Polyclonal Antibody (Human), FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MVP (Ala2~Pro272)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Major Vault Protein (MVP). This antibody is labeled with FITC.
Major Vault Protein (MVP) Polyclonal Antibody (Human), HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MVP (Ala2~Pro272)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Major Vault Protein (MVP). This antibody is labeled with HRP.
Major Vault Protein (MVP) Polyclonal Antibody (Human), PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MVP (Ala2~Pro272)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Major Vault Protein (MVP). This antibody is labeled with PE.
Rabbit Major Vault Protein (MVP) ELISA Kit
abx362163-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Major Vault Protein (MVP) Antibody
abx025511-100ul 100 ul
EUR 523
  • Shipped within 5-10 working days.
Major Vault Protein (MVP) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Major Vault Protein (MVP) Antibody
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Major Vault Protein (MVP) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Major Vault Protein (MVP) Antibody
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.
Major Vault Protein (MVP) Antibody
abx032736-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Major Vault Protein (MVP) Antibody
abx032736-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Major Vault Protein (MVP) Antibody
abx033927-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Major Vault Protein (MVP) Antibody
abx033927-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Major Vault Protein (MVP) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Major Vault Protein (MVP) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Major Vault Protein (MVP) Antibody
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Major Vault Protein (MVP) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Anti-MVP Antibody (monoclonal, 8B12)
M00642-1 100ug/vial
EUR 334
MVP Blocking Peptide
33R-5769 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MVP antibody, catalog no. 70R-2052
MVP Blocking Peptide
DF6732-BP 1mg
EUR 195
MVP cloning plasmid
CSB-CL015248HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2682
  • Sequence: atggcaactgaagagttcatcatccgcatccccccataccactatatccatgtgctggaccagaacagcaacgtgtcccgtgtggaggtcgggccaaagacctacatccggcaggacaatgagagggtactgtttgcccccatgcgcatggtgaccgtccccccacgtcactact
  • Show more
Description: A cloning plasmid for the MVP gene.
Major Vault Protein (MVP) Polyclonal Antibody (Human), APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MVP (Ala2~Pro272)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Major Vault Protein (MVP). This antibody is labeled with APC-Cy7.
Major Vault Protein (MVP) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Major Vault Protein (MVP) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Major Vault Protein (MVP) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Major Vault Protein (MVP) (VP2897R) Antibody
BNCR2897-250 250uL
EUR 394
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), RPE conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP)(1014) Antibody
BNUB0224-100 100uL
EUR 209
Description: Primary antibody against Major Vault Protein (MVP)(1014), Concentration: 0.2mg/mL
Major Vault Protein (MVP)(1014) Antibody
BNUB0224-500 500uL
EUR 458
Description: Primary antibody against Major Vault Protein (MVP)(1014), Concentration: 0.2mg/mL
Major Vault Protein (MVP)(1032) Antibody
BNUB0225-100 100uL
EUR 209
Description: Primary antibody against Major Vault Protein (MVP)(1032), Concentration: 0.2mg/mL
Major Vault Protein (MVP)(1032) Antibody
BNUB0225-500 500uL
EUR 458
Description: Primary antibody against Major Vault Protein (MVP)(1032), Concentration: 0.2mg/mL
Major Vault Protein (MVP) (VP2897R) Antibody
BNUB2897-100 100uL
EUR 264
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), Concentration: 0.2mg/mL
Major Vault Protein (MVP) (VP2897R) Antibody
BNUB2897-50 50uL
EUR 405
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), 1mg/mL
Major Vault Protein (MVP) (VP2897R) Antibody
BNUB2897-500 500uL
EUR 513
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), Concentration: 0.2mg/mL
Major Vault Protein (MVP)(1014) Antibody
BNUM0224-50 50uL
EUR 395
Description: Primary antibody against Major Vault Protein (MVP)(1014), 1mg/mL
Major Vault Protein (MVP)(1032) Antibody
BNUM0225-50 50uL
EUR 395
Description: Primary antibody against Major Vault Protein (MVP)(1032), 1mg/mL
Major Vault Protein (MVP)(1014) Antibody
BNC040224-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF405S conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP)(1014) Antibody
BNC040224-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF405S conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP)(1032) Antibody
BNC040225-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF405S conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP)(1032) Antibody
BNC040225-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF405S conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP) (VP2897R) Antibody
BNC552897-100 100uL
EUR 233
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF555 conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP) (VP2897R) Antibody
BNC552897-500 500uL
EUR 545
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF555 conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP)(1014) Antibody
BNC610224-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF660R conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP)(1014) Antibody
BNC610224-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF660R conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP)(1032) Antibody
BNC610225-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF660R conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP)(1032) Antibody
BNC610225-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF660R conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP) (VP2897R) Antibody
BNC432897-100 100uL
EUR 233
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF543 conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP) (VP2897R) Antibody
BNC432897-500 500uL
EUR 545
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF543 conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP)(1014) Antibody
BNC470224-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF647 conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP)(1014) Antibody
BNC470224-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF647 conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP)(1032) Antibody
BNC470225-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF647 conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP)(1032) Antibody
BNC470225-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF647 conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP) (VP2897R) Antibody
BNC472897-100 100uL
EUR 233
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF647 conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP) (VP2897R) Antibody
BNC472897-500 500uL
EUR 545
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF647 conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP)(1014) Antibody
BNC550224-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF555 conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP)(1014) Antibody
BNC550224-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF555 conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP)(1032) Antibody
BNC550225-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF555 conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP)(1032) Antibody
BNC550225-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF555 conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP) (VP2897R) Antibody
BNC042897-100 100uL
EUR 233
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF405S conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP) (VP2897R) Antibody
BNC042897-500 500uL
EUR 545
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF405S conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP)(1014) Antibody
BNC050224-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF405M conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP)(1014) Antibody
BNC050224-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF405M conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP)(1032) Antibody
BNC050225-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF405M conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP)(1032) Antibody
BNC050225-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF405M conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP) (VP2897R) Antibody
BNC052897-100 100uL
EUR 233
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF405M conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP) (VP2897R) Antibody
BNC052897-500 500uL
EUR 545
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF405M conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP)(1014) Antibody
BNC400224-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF640R conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP)(1014) Antibody
BNC400224-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF640R conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP)(1032) Antibody
BNC400225-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF640R conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP)(1032) Antibody
BNC400225-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF640R conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP) (VP2897R) Antibody
BNC402897-100 100uL
EUR 233
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF640R conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP) (VP2897R) Antibody
BNC402897-500 500uL
EUR 545
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF640R conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP)(1014) Antibody
BNC430224-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF543 conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP)(1014) Antibody
BNC430224-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF543 conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP)(1032) Antibody
BNC430225-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF543 conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP)(1032) Antibody
BNC430225-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF543 conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP) (VP2897R) Antibody
BNC702897-100 100uL
EUR 233
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF770 conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP) (VP2897R) Antibody
BNC702897-500 500uL
EUR 545
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF770 conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP)(1014) Antibody
BNC800224-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF680 conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP)(1014) Antibody
BNC800224-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF680 conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP)(1032) Antibody
BNC800225-100 100uL
EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF680 conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP)(1032) Antibody
BNC800225-500 500uL
EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF680 conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP) (VP2897R) Antibody
BNC802897-100 100uL
EUR 233
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF680 conjugate, Concentration: 0.1mg/mL
Major Vault Protein (MVP) (VP2897R) Antibody
BNC802897-500 500uL
EUR 545
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), CF680 conjugate, Concentration: 0.1mg/mL

MVP Rabbit Polyclonal Antibody