P2RY6 Rabbit Polyclonal Antibody

P2RY6 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

P2RY6 Polyclonal Antibody
ABP59790-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human P2RY6 protein at amino acid sequence of 180-260 Applications tips:
Description: A polyclonal antibody for detection of P2RY6 from Human, Mouse, Rat. This P2RY6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human P2RY6 protein at amino acid sequence of 180-260

P2RY6 Polyclonal Antibody
ES11622-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against P2RY6 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

P2RY6 Polyclonal Antibody
ES11622-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against P2RY6 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

P2RY6 Rabbit pAb
A2485-100ul	Abclonal	100 ul	EUR 308

P2RY6 Rabbit pAb
A2485-200ul	Abclonal	200 ul	EUR 459

P2RY6 Rabbit pAb
A2485-20ul	Abclonal	20 ul	EUR 183

P2RY6 Rabbit pAb
A2485-50ul	Abclonal	50 ul	EUR 223

P2RY6 antibody
70R-19080	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal P2RY6 antibody

P2RY6 Antibody
37009-100ul	SAB	100ul	EUR 252

P2RY6 antibody
38404-100ul	SAB	100ul	EUR 252

P2RY6 Antibody
1-CSB-PA977071	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against P2RY6. Recognizes P2RY6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:100-1:300

P2RY6 Antibody
DF6956	Affbiotech	200ul	EUR 304
Description: P2RY6 Antibody detects endogenous levels of total P2RY6.

P2RY6 Antibody
1-CSB-PA576070	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against P2RY6. Recognizes P2RY6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

P2RY6 Antibody
1-CSB-PA017337GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against P2RY6. Recognizes P2RY6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

P2RY6 Antibody
ABD6956	Lifescience Market	100 ug	EUR 438

Polyclonal P2RY6 Antibody (C-term)
APR17718G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human P2RY6 (C-term). This antibody is tested and proven to work in the following applications:

P2ry6/ Rat P2ry6 ELISA Kit
ELI-37027r	Lifescience Market	96 Tests	EUR 886

Polyclonal P2RY6 / P2Y6 Antibody (C-Terminus)
APR17716G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human P2RY6 / P2Y6 (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal P2RY6 / P2Y6 Antibody (Cytoplasmic Domain)
APR17717G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human P2RY6 / P2Y6 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

Polyclonal P2RY6 Antibody - N-terminal region
APR17719G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human P2RY6 - N-terminal region. This antibody is tested and proven to work in the following applications:

P2RY6 Conjugated Antibody
C37009	SAB	100ul	EUR 397

P2RY6 Conjugated Antibody
C38404	SAB	100ul	EUR 397

anti- P2RY6 antibody
FNab06074	FN Test	100µg	EUR 548.75
Immunogen: pyrimidinergic receptor P2Y, G-protein coupled, 6 Uniprot ID: Q15077 Research Area: Signal Transduction
Description: Antibody raised against P2RY6

Anti-P2RY6 antibody
PAab06074	Lifescience Market	100 ug	EUR 386

Anti-P2RY6 antibody
STJ24878	St John's Laboratory	100 µl	EUR 277
Description: The product of this gene belongs to the family of P2 receptors, which is activated by extracellular nucleotides and subdivided into P2X ligand-gated ion channels and P2Y G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor, which is a G-protein coupled receptor, is responsive to UDP, partially responsive to UTP and ADP, and not responsive to ATP. It is proposed that this receptor mediates inflammatory responses. Alternative splicing results in multiple transcript variants that encode different protein isoforms.

Anti-P2RY6 antibody
STJ192780	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to P2RY6

P2RY6 siRNA
20-abx903807	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

P2RY6 siRNA
20-abx927553	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

P2RY6 siRNA
20-abx927554	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

P2RY6 Blocking Peptide
DF6956-BP	Affbiotech	1mg	EUR 195

P2RY6 cloning plasmid
CSB-CL618975HU-10ug	Cusabio	10ug	EUR 385
Formulation: 10 μg plasmid + 200μl Glycerol Length: 987 Sequence: atggaatgggacaatggcacaggccaggctctgggcttgccacccaccacctgtgtctaccgcgagaacttcaagcaactgctgctgccacctgtgtattcggcggtgctggcggctggcctgccgctgaacatctgtgtcattacccagatctgcacgtcccgccgggccctgac Show more
Description: A cloning plasmid for the P2RY6 gene.

P2RY6 ELISA KIT|Human
EF001499	Lifescience Market	96 Tests	EUR 689

Rat P2RY6 shRNA Plasmid
20-abx987437	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human P2RY6 shRNA Plasmid
20-abx953344	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse P2RY6 shRNA Plasmid
20-abx982061	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

P2RY6 Recombinant Protein (Human)
RP022372	ABM	100 ug	Ask for price

P2RY6 Recombinant Protein (Mouse)
RP159806	ABM	100 ug	Ask for price

P2RY6 Recombinant Protein (Rat)
RP219089	ABM	100 ug	Ask for price

P2ry6 ORF Vector (Rat) (pORF)
ORF073031	ABM	1.0 ug DNA	EUR 506

P2RY6 ORF Vector (Human) (pORF)
ORF007458	ABM	1.0 ug DNA	EUR 95

P2ry6 ORF Vector (Mouse) (pORF)
ORF053270	ABM	1.0 ug DNA	EUR 506

P2ry6 sgRNA CRISPR Lentivector set (Rat)
K7076901	ABM	3 x 1.0 ug	EUR 339

P2ry6 sgRNA CRISPR Lentivector set (Mouse)
K3768301	ABM	3 x 1.0 ug	EUR 339

P2RY6 sgRNA CRISPR Lentivector set (Human)
K1582401	ABM	3 x 1.0 ug	EUR 339

Purinergic Receptor P2Y, G Protein Coupled 6 (P2RY6) Antibody
20-abx214648	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Purinergic Receptor P2Y, G Protein Coupled 6 (P2RY6) Antibody
20-abx214804	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Purinergic Receptor P2Y, G Protein Coupled 6 (P2RY6) Antibody
abx028562-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Purinergic Receptor P2Y, G Protein Coupled 6 (P2RY6) Antibody
abx028562-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Purinergic Receptor P2Y, G Protein Coupled 6 (P2RY6) Antibody
abx236074-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Purinergic Receptor P2Y, G Protein Coupled 6 (P2RY6) Antibody
20-abx001929	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Human P2Y purinoceptor 6, P2RY6 ELISA KIT
ELI-43275h	Lifescience Market	96 Tests	EUR 824

Mouse P2Y purinoceptor 6, P2ry6 ELISA KIT
ELI-35729m	Lifescience Market	96 Tests	EUR 865

P2ry6 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7076902	ABM	1.0 ug DNA	EUR 154

P2ry6 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7076903	ABM	1.0 ug DNA	EUR 154

P2ry6 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7076904	ABM	1.0 ug DNA	EUR 154

P2ry6 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3768302	ABM	1.0 ug DNA	EUR 154

P2ry6 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3768303	ABM	1.0 ug DNA	EUR 154

P2ry6 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3768304	ABM	1.0 ug DNA	EUR 154

P2RY6 sgRNA CRISPR Lentivector (Human) (Target 1)
K1582402	ABM	1.0 ug DNA	EUR 154

P2RY6 sgRNA CRISPR Lentivector (Human) (Target 2)
K1582403	ABM	1.0 ug DNA	EUR 154

P2RY6 sgRNA CRISPR Lentivector (Human) (Target 3)
K1582404	ABM	1.0 ug DNA	EUR 154

P2RY6 Protein Vector (Rat) (pPB-C-His)
PV292122	ABM	500 ng	EUR 603

P2RY6 Protein Vector (Rat) (pPB-N-His)
PV292123	ABM	500 ng	EUR 603

P2RY6 Protein Vector (Rat) (pPM-C-HA)
PV292124	ABM	500 ng	EUR 603

P2RY6 Protein Vector (Rat) (pPM-C-His)
PV292125	ABM	500 ng	EUR 603

P2RY6 Protein Vector (Mouse) (pPB-C-His)
PV213078	ABM	500 ng	EUR 603

P2RY6 Protein Vector (Mouse) (pPB-N-His)
PV213079	ABM	500 ng	EUR 603

P2RY6 Protein Vector (Mouse) (pPM-C-HA)
PV213080	ABM	500 ng	EUR 603

P2RY6 Protein Vector (Mouse) (pPM-C-His)
PV213081	ABM	500 ng	EUR 603

P2RY6 Protein Vector (Human) (pPB-C-His)
PV029829	ABM	500 ng	EUR 329

P2RY6 Protein Vector (Human) (pPB-N-His)
PV029830	ABM	500 ng	EUR 329

P2RY6 Protein Vector (Human) (pPM-C-HA)
PV029831	ABM	500 ng	EUR 329

P2RY6 Protein Vector (Human) (pPM-C-His)
PV029832	ABM	500 ng	EUR 329

P2ry6 3'UTR Luciferase Stable Cell Line
TU115820	ABM	1.0 ml	Ask for price

P2ry6 3'UTR GFP Stable Cell Line
TU165820	ABM	1.0 ml	Ask for price

P2ry6 3'UTR GFP Stable Cell Line
TU265735	ABM	1.0 ml	Ask for price

P2ry6 3'UTR Luciferase Stable Cell Line
TU215735	ABM	1.0 ml	Ask for price

P2RY6 3'UTR GFP Stable Cell Line
TU067257	ABM	1.0 ml	EUR 1394

P2RY6 3'UTR Luciferase Stable Cell Line
TU017257	ABM	1.0 ml	EUR 1394

P2RY6 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV663247	ABM	1.0 ug DNA	EUR 514

P2RY6 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV663251	ABM	1.0 ug DNA	EUR 514

P2RY6 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV663252	ABM	1.0 ug DNA	EUR 514

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

P2RY6 Rabbit Polyclonal Antibody