ETS2 Rabbit Polyclonal Antibody

ETS2 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

ETS2 Polyclonal Antibody

ABP58508-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ETS2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ETS2 from Human, Mouse. This ETS2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ETS2 protein

ETS2 Polyclonal Antibody

ES11876-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ETS2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

ETS2 Polyclonal Antibody

ES11876-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ETS2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

ETS2 Rabbit pAb

A14486-100ul 100 ul
EUR 308

ETS2 Rabbit pAb

A14486-200ul 200 ul
EUR 459

ETS2 Rabbit pAb

A14486-20ul 20 ul
EUR 183

ETS2 Rabbit pAb

A14486-50ul 50 ul
EUR 223

ETS2 Rabbit pAb

A7329-100ul 100 ul
EUR 308

ETS2 Rabbit pAb

A7329-200ul 200 ul
EUR 459

ETS2 Rabbit pAb

A7329-20ul 20 ul
EUR 183

ETS2 Rabbit pAb

A7329-50ul 50 ul
EUR 223

ETS2 Rabbit pAb

A16844-100ul 100 ul
EUR 308

ETS2 Rabbit pAb

A16844-200ul 200 ul
EUR 459

ETS2 Rabbit pAb

A16844-20ul 20 ul
EUR 183

ETS2 Rabbit pAb

A16844-50ul 50 ul
EUR 223

ETS2 Rabbit pAb

A16845-100ul 100 ul
EUR 308

ETS2 Rabbit pAb

A16845-200ul 200 ul
EUR 459

ETS2 Rabbit pAb

A16845-20ul 20 ul
EUR 183

ETS2 Rabbit pAb

A16845-50ul 50 ul
EUR 223

Polyclonal ETS2 Antibody (Center)

APR06204G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ETS2 (Center). This antibody is tested and proven to work in the following applications:

ETS2 antibody

70R-17160 50 ul
EUR 435
Description: Rabbit polyclonal ETS2 antibody

ETS2 Antibody

36451-100ul 100ul
EUR 252

ETS2 antibody

10R-1761 100 ug
EUR 512
Description: Mouse monoclonal ETS2 antibody

ETS2 Antibody

1-CSB-PA908387
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ETS2. Recognizes ETS2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

ETS2 Antibody

1-CSB-PA695360
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ETS2. Recognizes ETS2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

ETS2 Antibody

1-CSB-PA007853GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ETS2. Recognizes ETS2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ETS2 Antibody

1-CSB-PA007853LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ETS2. Recognizes ETS2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

ETS2 Conjugated Antibody

C36451 100ul
EUR 397

anti- ETS2 antibody

FNab02879 100µg
EUR 548.75
  • Immunogen: v-ets erythroblastosis virus E26 oncogene homolog 2(avian)
  • Uniprot ID: P15036
  • Gene ID: 2114
  • Research Area: Signal Transduction, Metabolism, Cardiovascular, Cancer, Developmental biology
Description: Antibody raised against ETS2

Anti-ETS2 antibody

PAab02879 100 ug
EUR 386

Anti-ETS2 antibody

STJ116696 100 µl
EUR 277
Description: This gene encodes a transcription factor which regulates genes involved in development and apoptosis. The encoded protein is also a protooncogene and shown to be involved in regulation of telomerase. A pseudogene of this gene is located on the X chromosome. Alternative splicing results in multiple transcript variants.

Anti-ETS2 antibody

STJ119215 100 µl
EUR 277

Anti-ETS2 antibody

STJ119216 100 µl
EUR 277

Anti-ETS2 antibody

STJ29468 100 µl
EUR 277
Description: This gene encodes a transcription factor which regulates genes involved in development and apoptosis. The encoded protein is also a protooncogene and shown to be involved in regulation of telomerase. A pseudogene of this gene is located on the X chromosome. Alternative splicing results in multiple transcript variants.

Anti-ETS2 antibody

STJ193034 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ETS2

ETS2 siRNA

20-abx915738
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ETS2 siRNA

20-abx915739
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-ETS2

YF-PA11633 50 ul
EUR 363
Description: Mouse polyclonal to ETS2

anti-ETS2

YF-PA11634 50 ug
EUR 363
Description: Mouse polyclonal to ETS2

anti-ETS2

YF-PA23672 50 ul
EUR 334
Description: Mouse polyclonal to ETS2

ETS2 Antibody, HRP conjugated

1-CSB-PA007853LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ETS2. Recognizes ETS2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ETS2 Antibody, FITC conjugated

1-CSB-PA007853LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ETS2. Recognizes ETS2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ETS2 Antibody, Biotin conjugated

1-CSB-PA007853LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ETS2. Recognizes ETS2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ETS2 cloning plasmid

CSB-CL007853HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1410
  • Sequence: atgaatgatttcggaatcaagaatatggaccaggtagcccctgtggctaacagttacagagggacactcaagcgccagccagcctttgacacctttgatgggtccctgtttgctgtttttccttctctaaatgaagagcaaacactgcaagaagtgccaacaggcttggattcca
  • Show more
Description: A cloning plasmid for the ETS2 gene.

ETS2 cloning plasmid

CSB-CL007853HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1410
  • Sequence: atgaatgatttcggaatcaagaatatggaccaggtagcccctgtggctaacagttacagagggacactcaagcgccagccagcctttgacacctttgatgggtccctgtttgctgtttttccttctctaaatgaagagcaaacactgcaagaagtgccaacaggcttggattcca
  • Show more
Description: A cloning plasmid for the ETS2 gene.

pCMV-SPORT6-ETS2

PVT13519 2 ug
EUR 391

ETS2 Repressor Factor (ERF) Antibody

20-abx013510
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

ETS2 Repressor Factor (ERF) Antibody

abx031308-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

ETS2 Repressor Factor (ERF) Antibody

abx031308-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

ETS2 Repressor Factor (ERF) Antibody

abx331359-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

ETS2 Repressor Factor (ERF) Antibody

20-abx326043
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

ETS2 Repressor Factor (ERF) Antibody

20-abx325231
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

ETS2 protein (His tag)

80R-3873 100 ug
EUR 327
Description: Purified recombinant ETS2 protein (His tag)

ETS2 ELISA KIT|Human

EF009461 96 Tests
EUR 689

Mouse ETS2 shRNA Plasmid

20-abx973531
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ETS2 shRNA Plasmid

20-abx951467
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ETS2 Recombinant Protein (Human)

RP010981 100 ug Ask for price

ETS2 Recombinant Protein (Human)

RP010984 100 ug Ask for price

ETS2 Recombinant Protein (Rat)

RP200021 100 ug Ask for price

ETS2 Recombinant Protein (Mouse)

RP132377 100 ug Ask for price

Ets2 ORF Vector (Rat) (pORF)

ORF066675 1.0 ug DNA
EUR 506

h ETS2 inducible lentiviral particles

LVP160 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, ETS2, is fully sequence verified and matched to NCBI accession ID: NM_005239.4

ETS2 ORF Vector (Human) (pORF)

ORF003661 1.0 ug DNA
EUR 95

ETS2 ORF Vector (Human) (pORF)

ORF003662 1.0 ug DNA
EUR 95

Ets2 ORF Vector (Mouse) (pORF)

ORF044127 1.0 ug DNA
EUR 506

ETS2 Repressor Factor Phospho-Thr526 (ERF pT526) Antibody

20-abx326105
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

ETS2 Repressor Factor (ERF) Blocking Peptide

20-abx162421
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

ETS2 Repressor Factor (ERF) ELISA Kit

abx596479-96tests 96 tests
EUR 723
  • Shipped within 1-2 weeks.

ETS2 sgRNA CRISPR Lentivector set (Human)

K0699401 3 x 1.0 ug
EUR 339

Ets2 sgRNA CRISPR Lentivector set (Rat)

K6661201 3 x 1.0 ug
EUR 339

Ets2 sgRNA CRISPR Lentivector set (Mouse)

K3880601 3 x 1.0 ug
EUR 339

ETS2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0699402 1.0 ug DNA
EUR 154

ETS2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0699403 1.0 ug DNA
EUR 154

ETS2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0699404 1.0 ug DNA
EUR 154

Ets2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6661202 1.0 ug DNA
EUR 154

Ets2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6661203 1.0 ug DNA
EUR 154

Ets2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6661204 1.0 ug DNA
EUR 154

Ets2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3880602 1.0 ug DNA
EUR 154

Ets2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3880603 1.0 ug DNA
EUR 154

Ets2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3880604 1.0 ug DNA
EUR 154

ETS2 Protein Vector (Mouse) (pPB-C-His)

PV176506 500 ng
EUR 603

ETS2 Protein Vector (Mouse) (pPB-N-His)

PV176507 500 ng
EUR 603

ETS2 Protein Vector (Mouse) (pPM-C-HA)

PV176508 500 ng
EUR 603

ETS2 Protein Vector (Mouse) (pPM-C-His)

PV176509 500 ng
EUR 603

ETS2 Protein Vector (Rat) (pPB-C-His)

PV266698 500 ng
EUR 603

ETS2 Protein Vector (Rat) (pPB-N-His)

PV266699 500 ng
EUR 603

ETS2 Protein Vector (Rat) (pPM-C-HA)

PV266700 500 ng
EUR 603

ETS2 Protein Vector (Rat) (pPM-C-His)

PV266701 500 ng
EUR 603

ETS2 Protein Vector (Human) (pPB-C-His)

PV014641 500 ng
EUR 329

ETS2 Protein Vector (Human) (pPB-N-His)

PV014642 500 ng
EUR 329

ETS2 Protein Vector (Human) (pPM-C-HA)

PV014643 500 ng
EUR 329

ETS2 Protein Vector (Human) (pPM-C-His)

PV014644 500 ng
EUR 329

ETS2 Protein Vector (Human) (pPB-C-His)

PV014645 500 ng
EUR 329

ETS2 Protein Vector (Human) (pPB-N-His)

PV014646 500 ng
EUR 329

ETS2 Protein Vector (Human) (pPM-C-HA)

PV014647 500 ng
EUR 329

ETS2 Protein Vector (Human) (pPM-C-His)

PV014648 500 ng
EUR 329

Recombinant Human ETS2 Protein, His, E.coli-1mg

QP11815-1mg 1mg
EUR 2757

Recombinant Human ETS2 Protein, His, E.coli-20ug

QP11815-20ug 20ug
EUR 201

ETS2 Rabbit Polyclonal Antibody