OR2A4 Rabbit Polyclonal Antibody

OR2A4 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

OR2A4 Polyclonal Antibody

ABP59673-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human OR2A4 protein at amino acid sequence of 170-250
  • Applications tips:
Description: A polyclonal antibody for detection of OR2A4 from Human. This OR2A4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OR2A4 protein at amino acid sequence of 170-250

OR2A4 Antibody

39719-100ul 100ul
EUR 390

Polyclonal OR2A4 Antibody (Extracellular Domain)

APR12541G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OR2A4 (Extracellular Domain). This antibody is tested and proven to work in the following applications:

Polyclonal OR2A4 Antibody (N-term)

APR14163G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OR2A4 (N-term). This antibody is tested and proven to work in the following applications:

OR2A4 / 7 Antibody

20-abx015409
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

OR2A7 / OR2A4 Antibody

20-abx324109
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

OR2A4/7 Antibody

ABD5064 100 ug
EUR 438

OR2A4/7 Antibody

DF5064 200ul
EUR 304
Description: OR2A4/7 Antibody detects endogenous levels of total OR2A4/7.

OR2A7/OR2A4 Antibody

1-CSB-PA003532
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against OR2A7/OR2A4. Recognizes OR2A7/OR2A4 from Human. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/10000

Anti-OR2A4 antibody

STJ192854 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to OR2A4

OR2A4 siRNA

20-abx927078
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Anti-OR2A4/7 Antibody

A13831 100ul
EUR 397
Description: Rabbit Polyclonal OR2A4/7 Antibody. Validated in WB and tested in Human.

OR2A4 cloning plasmid

CSB-CL016532HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 933
  • Sequence: ATGGGAGACAATATAACATCCATCAGAGAGTTCCTCCTACTGGGATTTCCCGTTGGCCCAAGGATTCAGATGCTCCTCTTTGGGCTCTTCTCCCTGTTCTACGTCTTCACCCTGCTGGGGAACGGGACCATACTGGGGCTCATCTCACTGGACTCCAGACTGCACGCCCCCATGTA
  • Show more
Description: A cloning plasmid for the OR2A4 gene.

OR2A4 Rabbit Polyclonal Antibody