OR2A4 Rabbit Polyclonal Antibody
To Order Now: info@poweratlas.org
 OR2A4 Polyclonal Antibody |
|
ABP59673-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human OR2A4 protein at amino acid sequence of 170-250
- Applications tips:
|
|
Description: A polyclonal antibody for detection of OR2A4 from Human. This OR2A4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OR2A4 protein at amino acid sequence of 170-250 |
 OR2A4 Antibody |
|
39719-100ul |
SAB |
100ul |
EUR 390 |
) Polyclonal OR2A4 Antibody (Extracellular Domain) |
|
APR12541G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OR2A4 (Extracellular Domain). This antibody is tested and proven to work in the following applications: |
) Polyclonal OR2A4 Antibody (N-term) |
|
APR14163G |
Leading Biology |
0.1ml |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OR2A4 (N-term). This antibody is tested and proven to work in the following applications: |
 OR2A4 / 7 Antibody |
|
20-abx015409 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
 OR2A7 / OR2A4 Antibody |
|
20-abx324109 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 OR2A4/7 Antibody |
|
DF5064 |
Affbiotech |
200ul |
EUR 304 |
|
Description: OR2A4/7 Antibody detects endogenous levels of total OR2A4/7. |
 OR2A7/OR2A4 Antibody |
|
1-CSB-PA003532 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
|
Description: A polyclonal antibody against OR2A7/OR2A4. Recognizes OR2A7/OR2A4 from Human. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/10000 |
 Anti-OR2A4 antibody |
|
STJ192854 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to OR2A4 |
 OR2A4 siRNA |
|
20-abx927078 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Anti-OR2A4/7 Antibody |
|
A13831 |
BosterBio |
100ul |
EUR 397 |
|
Description: Rabbit Polyclonal OR2A4/7 Antibody. Validated in WB and tested in Human. |
 OR2A4 cloning plasmid |
|
CSB-CL016532HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 933
- Sequence: ATGGGAGACAATATAACATCCATCAGAGAGTTCCTCCTACTGGGATTTCCCGTTGGCCCAAGGATTCAGATGCTCCTCTTTGGGCTCTTCTCCCTGTTCTACGTCTTCACCCTGCTGGGGAACGGGACCATACTGGGGCTCATCTCACTGGACTCCAGACTGCACGCCCCCATGTA
- Show more
|
|
Description: A cloning plasmid for the OR2A4 gene. |
OR2A4 Rabbit Polyclonal Antibody
