OR2A4 Rabbit Polyclonal Antibody

OR2A4 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

OR2A4 Polyclonal Antibody

ES11696-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against OR2A4 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

OR2A4 Antibody

39719-100ul 100ul
EUR 390

Polyclonal OR2A4 Antibody (Extracellular Domain)

APR12541G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OR2A4 (Extracellular Domain). This antibody is tested and proven to work in the following applications:

Polyclonal OR2A4 Antibody (N-term)

APR14163G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OR2A4 (N-term). This antibody is tested and proven to work in the following applications:

OR2A7/OR2A4 Antibody

1-CSB-PA003532
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against OR2A7/OR2A4. Recognizes OR2A7/OR2A4 from Human. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/10000

OR2A4/7 Antibody

DF5064 200ul
EUR 304
Description: OR2A4/7 Antibody detects endogenous levels of total OR2A4/7.

OR2A4 / 7 Antibody

20-abx015409
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

OR2A7 / OR2A4 Antibody

20-abx324109
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

OR2A4/7 Antibody

ABD5064 100 ug
EUR 438

Anti-OR2A4 antibody

STJ192854 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to OR2A4

OR2A4 siRNA

20-abx927078
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Anti-OR2A4/7 Antibody

A13831 100ul
EUR 397
Description: Rabbit Polyclonal OR2A4/7 Antibody. Validated in WB and tested in Human.

OR2A4 cloning plasmid

CSB-CL016532HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 933
  • Sequence: ATGGGAGACAATATAACATCCATCAGAGAGTTCCTCCTACTGGGATTTCCCGTTGGCCCAAGGATTCAGATGCTCCTCTTTGGGCTCTTCTCCCTGTTCTACGTCTTCACCCTGCTGGGGAACGGGACCATACTGGGGCTCATCTCACTGGACTCCAGACTGCACGCCCCCATGTA
  • Show more
Description: A cloning plasmid for the OR2A4 gene.

OR2A4 Rabbit Polyclonal Antibody