OR2A4 Rabbit Polyclonal Antibody
To Order Now: info@poweratlas.org
 OR2A4 Polyclonal Antibody |
|
ES11696-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against OR2A4 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 OR2A4 Antibody |
|
39719-100ul |
SAB |
100ul |
EUR 390 |
) Polyclonal OR2A4 Antibody (Extracellular Domain) |
|
APR12541G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OR2A4 (Extracellular Domain). This antibody is tested and proven to work in the following applications: |
) Polyclonal OR2A4 Antibody (N-term) |
|
APR14163G |
Leading Biology |
0.1ml |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OR2A4 (N-term). This antibody is tested and proven to work in the following applications: |
 OR2A7/OR2A4 Antibody |
|
1-CSB-PA003532 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
|
Description: A polyclonal antibody against OR2A7/OR2A4. Recognizes OR2A7/OR2A4 from Human. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/10000 |
 OR2A4/7 Antibody |
|
DF5064 |
Affbiotech |
200ul |
EUR 304 |
|
Description: OR2A4/7 Antibody detects endogenous levels of total OR2A4/7. |
 OR2A4 / 7 Antibody |
|
20-abx015409 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
 OR2A7 / OR2A4 Antibody |
|
20-abx324109 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Anti-OR2A4 antibody |
|
STJ192854 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to OR2A4 |
 OR2A4 siRNA |
|
20-abx927078 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Anti-OR2A4/7 Antibody |
|
A13831 |
BosterBio |
100ul |
EUR 397 |
|
Description: Rabbit Polyclonal OR2A4/7 Antibody. Validated in WB and tested in Human. |
 OR2A4 cloning plasmid |
|
CSB-CL016532HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 933
- Sequence: ATGGGAGACAATATAACATCCATCAGAGAGTTCCTCCTACTGGGATTTCCCGTTGGCCCAAGGATTCAGATGCTCCTCTTTGGGCTCTTCTCCCTGTTCTACGTCTTCACCCTGCTGGGGAACGGGACCATACTGGGGCTCATCTCACTGGACTCCAGACTGCACGCCCCCATGTA
- Show more
|
|
Description: A cloning plasmid for the OR2A4 gene. |
OR2A4 Rabbit Polyclonal Antibody
