TGM3 Rabbit Polyclonal Antibody

TGM3 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

TGM3 Polyclonal Antibody

ABP60669-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human TGM3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TGM3 from Human. This TGM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TGM3 protein

TGM3 Polyclonal Antibody

ABP60669-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human TGM3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TGM3 from Human. This TGM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TGM3 protein

TGM3 Polyclonal Antibody

ABP60669-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TGM3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TGM3 from Human. This TGM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TGM3 protein

TGM3 Rabbit pAb

A5856-100ul 100 ul
EUR 308

TGM3 Rabbit pAb

A5856-200ul 200 ul
EUR 459

TGM3 Rabbit pAb

A5856-20ul 20 ul
EUR 183

TGM3 Rabbit pAb

A5856-50ul 50 ul
EUR 223

Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit

DLR-TGM3-Hu-48T 48T
EUR 498
  • Should the Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transglutaminase 3, Epidermal (TGM3) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit

DLR-TGM3-Hu-96T 96T
EUR 647
  • Should the Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transglutaminase 3, Epidermal (TGM3) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Transglutaminase 3, Epidermal (TGM3) ELISA Kit

DLR-TGM3-Mu-48T 48T
EUR 508
  • Should the Mouse Transglutaminase 3, Epidermal (TGM3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Transglutaminase 3, Epidermal (TGM3) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Transglutaminase 3, Epidermal (TGM3) ELISA Kit

DLR-TGM3-Mu-96T 96T
EUR 661
  • Should the Mouse Transglutaminase 3, Epidermal (TGM3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Transglutaminase 3, Epidermal (TGM3) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit

RDR-TGM3-Hu-48Tests 48 Tests
EUR 522

Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit

RDR-TGM3-Hu-96Tests 96 Tests
EUR 724

Mouse Transglutaminase 3, Epidermal (TGM3) ELISA Kit

RDR-TGM3-Mu-48Tests 48 Tests
EUR 534

Mouse Transglutaminase 3, Epidermal (TGM3) ELISA Kit

RDR-TGM3-Mu-96Tests 96 Tests
EUR 742

Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit

RD-TGM3-Hu-48Tests 48 Tests
EUR 500

Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit

RD-TGM3-Hu-96Tests 96 Tests
EUR 692

Mouse Transglutaminase 3, Epidermal (TGM3) ELISA Kit

RD-TGM3-Mu-48Tests 48 Tests
EUR 511

Mouse Transglutaminase 3, Epidermal (TGM3) ELISA Kit

RD-TGM3-Mu-96Tests 96 Tests
EUR 709

TGM3 Antibody

33094-100ul 100ul
EUR 252

Polyclonal TGM3 Antibody (C-term)

APR10429G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TGM3 (C-term). This antibody is tested and proven to work in the following applications:

TGM3 Conjugated Antibody

C33094 100ul
EUR 397

Anti-TGM3 antibody

STJ28419 100 µl
EUR 277
Description: Transglutaminases are enzymes that catalyze the crosslinking of proteins by epsilon-gamma glutamyl lysine isopeptide bonds. While the primary structure of transglutaminases is not conserved, they all have the same amino acid sequence at their active sites and their activity is calcium-dependent. The protein encoded by this gene consists of two polypeptide chains activated from a single precursor protein by proteolysis. The encoded protein is involved the later stages of cell envelope formation in the epidermis and hair follicle.

Anti-TGM3 antibody

STJ193026 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TGM3

Tgm3/ Rat Tgm3 ELISA Kit

ELI-52085r 96 Tests
EUR 886

Transglutaminase 3, Epidermal (TGM3) Polyclonal Antibody (Human)

4-PAB756Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TGM3 (Ala468~Glu693)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transglutaminase 3, Epidermal (TGM3)

Transglutaminase 3, Epidermal (TGM3) Polyclonal Antibody (Mouse)

4-PAB756Mu01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TGM3 (Ala468~Glu693)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Transglutaminase 3, Epidermal (TGM3)

TGM3 siRNA

20-abx905550
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TGM3 siRNA

20-abx936641
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TGM3 siRNA

20-abx936642
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Transglutaminase 3 (TGM3) Antibody

abx433398-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Transglutaminase 3, Epidermal (TGM3) Polyclonal Antibody (Human), APC

4-PAB756Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TGM3 (Ala468~Glu693)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transglutaminase 3, Epidermal (TGM3). This antibody is labeled with APC.

Transglutaminase 3, Epidermal (TGM3) Polyclonal Antibody (Human), Biotinylated

4-PAB756Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TGM3 (Ala468~Glu693)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transglutaminase 3, Epidermal (TGM3). This antibody is labeled with Biotin.

Transglutaminase 3, Epidermal (TGM3) Polyclonal Antibody (Human), Cy3

4-PAB756Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TGM3 (Ala468~Glu693)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transglutaminase 3, Epidermal (TGM3). This antibody is labeled with Cy3.

Transglutaminase 3, Epidermal (TGM3) Polyclonal Antibody (Human), FITC

4-PAB756Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TGM3 (Ala468~Glu693)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transglutaminase 3, Epidermal (TGM3). This antibody is labeled with FITC.

Transglutaminase 3, Epidermal (TGM3) Polyclonal Antibody (Human), HRP

4-PAB756Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TGM3 (Ala468~Glu693)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transglutaminase 3, Epidermal (TGM3). This antibody is labeled with HRP.

Transglutaminase 3, Epidermal (TGM3) Polyclonal Antibody (Human), PE

4-PAB756Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TGM3 (Ala468~Glu693)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transglutaminase 3, Epidermal (TGM3). This antibody is labeled with PE.

Transglutaminase 3, Epidermal (TGM3) Polyclonal Antibody (Mouse), APC

4-PAB756Mu01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TGM3 (Ala468~Glu693)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Transglutaminase 3, Epidermal (TGM3). This antibody is labeled with APC.

Transglutaminase 3, Epidermal (TGM3) Polyclonal Antibody (Mouse), Biotinylated

4-PAB756Mu01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TGM3 (Ala468~Glu693)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Transglutaminase 3, Epidermal (TGM3). This antibody is labeled with Biotin.

Transglutaminase 3, Epidermal (TGM3) Polyclonal Antibody (Mouse), Cy3

4-PAB756Mu01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TGM3 (Ala468~Glu693)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Transglutaminase 3, Epidermal (TGM3). This antibody is labeled with Cy3.

Transglutaminase 3, Epidermal (TGM3) Polyclonal Antibody (Mouse), FITC

4-PAB756Mu01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TGM3 (Ala468~Glu693)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Transglutaminase 3, Epidermal (TGM3). This antibody is labeled with FITC.

Transglutaminase 3, Epidermal (TGM3) Polyclonal Antibody (Mouse), HRP

4-PAB756Mu01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TGM3 (Ala468~Glu693)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Transglutaminase 3, Epidermal (TGM3). This antibody is labeled with HRP.

Transglutaminase 3, Epidermal (TGM3) Polyclonal Antibody (Mouse), PE

4-PAB756Mu01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TGM3 (Ala468~Glu693)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Transglutaminase 3, Epidermal (TGM3). This antibody is labeled with PE.

Rabbit Transglutaminase 3, Epidermal (TGM3) ELISA Kit

abx362855-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

TGM3 cloning plasmid

CSB-CL600462HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2082
  • Sequence: ATGGCTGCTCTAGGAGTCCAGAGTATCAACTGGCAGACGGCCTTCAACCGACAAGCGCATCACACAGACAAGTTCTCCAGCCAGGAGCTCATCTTGCGGAGAGGCCAAAACTTCCAGGTCTTAATGATCATGAACAAAGGCCTTGGCTCTAACGAAAGACTGGAGTTCATTGTCT
  • Show more
Description: A cloning plasmid for the TGM3 gene.

Transglutaminase 3, Epidermal (TGM3) Antibody

20-abx103072
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Transglutaminase 3, Epidermal (TGM3) Antibody

20-abx103073
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Transglutaminase 3, Epidermal (TGM3) Antibody

20-abx004493
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Transglutaminase 3, Epidermal (TGM3) Antibody

abx029604-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Transglutaminase 3, Epidermal (TGM3) Antibody

abx029604-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Transglutaminase 3, Epidermal (TGM3) Antibody

20-abx174895
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Transglutaminase 3, Epidermal (TGM3) Antibody

20-abx178689
  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Transglutaminase 3, Epidermal (TGM3) Polyclonal Antibody (Human), APC-Cy7

4-PAB756Hu01-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TGM3 (Ala468~Glu693)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Transglutaminase 3, Epidermal (TGM3). This antibody is labeled with APC-Cy7.

Transglutaminase 3, Epidermal (TGM3) Polyclonal Antibody (Mouse), APC-Cy7

4-PAB756Mu01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TGM3 (Ala468~Glu693)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Transglutaminase 3, Epidermal (TGM3). This antibody is labeled with APC-Cy7.

Transglutaminase 3, Epidermal (TGM3) Antibody (FITC)

20-abx273922
  • EUR 467.00
  • EUR 244.00
  • EUR 1386.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Transglutaminase 3, Epidermal (TGM3) Antibody (Biotin)

20-abx272183
  • EUR 439.00
  • EUR 244.00
  • EUR 1261.00
  • EUR 606.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Transglutaminase 3, Epidermal (TGM3) Antibody (Biotin)

20-abx272888
  • EUR 453.00
  • EUR 244.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Bovine TGM3 ELISA KIT

ELI-19015b 96 Tests
EUR 928

Human TGM3 ELISA KIT

ELI-17237h 96 Tests
EUR 824

TGM3 ELISA KIT|Human

EF007210 96 Tests
EUR 689

Mouse Tgm3 ELISA KIT

ELI-29290m 96 Tests
EUR 865

Human TGM3 shRNA Plasmid

20-abx954826
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse TGM3 shRNA Plasmid

20-abx973096
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat TGM3 shRNA Plasmid

20-abx990651
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TGM3 Recombinant Protein (Human)

RP044110 100 ug Ask for price

TGM3 Recombinant Protein (Rat)

RP232967 100 ug Ask for price

TGM3 Recombinant Protein (Mouse)

RP178490 100 ug Ask for price

Tgm3 ORF Vector (Mouse) (pORF)

ORF059498 1.0 ug DNA
EUR 506

Tgm3 ORF Vector (Rat) (pORF)

ORF077657 1.0 ug DNA
EUR 506

TGM3 ORF Vector (Human) (pORF)

ORF014704 1.0 ug DNA
EUR 354

Recombinant Transglutaminase 3, Epidermal (TGM3)

4-RPB756Hu01
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q08188
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Transglutaminase 3, Epidermal expressed in: E.coli

Recombinant Transglutaminase 3, Epidermal (TGM3)

4-RPB756Mu01
  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q08189
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Transglutaminase 3, Epidermal expressed in: E.coli

TGM3 ELISA Kit (Mouse) (OKCD00845)

OKCD00845 96 Wells
EUR 818
Description: Description of target: Catalyzes the calcium-dependent formation of isopeptide cross-links between glutamine and lysine residues in various proteins, as well as the conjugation of polyamines to proteins. Involved in the formation of the cornified envelope (CE), a specialized component consisting of covalent cross-links of proteins beneath the plasma membrane of terminally differentiated keratinocytes. Catalyzes small proline-rich proteins (SPRR1 and SPRR2) and LOR cross-linking to form small interchain oligomers, which are further cross-linked by TGM1 onto the growing CE scaffold (By similarity). In hair follicles, involved in cross-linking structural proteins to hardening the inner root sheath.By similarity ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.138 ng/mL

TGM3 ELISA Kit (Human) (OKCD01600)

OKCD01600 96 Wells
EUR 792
Description: Description of target: Catalyzes the calcium-dependent formation of isopeptide cross-links between glutamine and lysine residues in various proteins, as well as the conjugation of polyamines to proteins. Involved in the formation of the cornified envelope (CE), a specialized component consisting of covalent cross-links of proteins beneath the plasma membrane of terminally differentiated keratinocytes. Catalyzes small proline-rich proteins (SPRR1 and SPRR2) and LOR cross-linking to form small interchain oligomers, which are further cross-linked by TGM1 onto the growing CE scaffold. In hair follicles, involved in cross-linking structural proteins to hardening the inner root sheath.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.113 ng/mL

Human Transglutaminase 3, Epidermal (TGM3) Protein

20-abx069444
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Mouse Transglutaminase 3, Epidermal (TGM3) Protein

20-abx069445
  • EUR 523.00
  • EUR 244.00
  • EUR 1497.00
  • EUR 606.00
  • EUR 384.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

TGM3 sgRNA CRISPR Lentivector set (Human)

K2366301 3 x 1.0 ug
EUR 339

Tgm3 sgRNA CRISPR Lentivector set (Mouse)

K3930001 3 x 1.0 ug
EUR 339

Tgm3 sgRNA CRISPR Lentivector set (Rat)

K6682401 3 x 1.0 ug
EUR 339

Pig Transglutaminase 3, Epidermal (TGM3) ELISA Kit

abx361096-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human TGM3(Transglutaminase 3, Epidermal) ELISA Kit

EH3869 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: Q08188
  • Alias: TGM3/TG3/TgaseE/EC 2.3.2.13/MGC126250/protein-glutamine gamma-glutamyltransferase E/TG(E)/TGase E/TGase-3/TGEMGC126249/transglutaminase 3(E polypeptide, protein-glutamine-gamma-glutamyltransfe
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Mouse Transglutaminase 3, Epidermal (TGM3) ELISA Kit

20-abx154750
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit

20-abx153275
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Chicken Transglutaminase 3, Epidermal (TGM3) ELISA Kit

abx355995-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Transglutaminase 3, Epidermal (TGM3) ELISA Kit

abx359247-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Transglutaminase 3, Epidermal (TGM3) CLIA Kit

20-abx493047
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Transglutaminase 3, Epidermal (TGM3) CLIA Kit

20-abx493048
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit

abx253266-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Transglutaminase 3, Epidermal (TGM3) CLIA Kit

abx197835-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

TGM3 sgRNA CRISPR Lentivector (Human) (Target 1)

K2366302 1.0 ug DNA
EUR 154

TGM3 sgRNA CRISPR Lentivector (Human) (Target 2)

K2366303 1.0 ug DNA
EUR 154

TGM3 sgRNA CRISPR Lentivector (Human) (Target 3)

K2366304 1.0 ug DNA
EUR 154

Tgm3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3930002 1.0 ug DNA
EUR 154

Tgm3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3930003 1.0 ug DNA
EUR 154

Tgm3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3930004 1.0 ug DNA
EUR 154

Tgm3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6682402 1.0 ug DNA
EUR 154

Tgm3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6682403 1.0 ug DNA
EUR 154

Tgm3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6682404 1.0 ug DNA
EUR 154

TGM3 Protein Vector (Human) (pPB-C-His)

PV058813 500 ng
EUR 481

TGM3 Protein Vector (Human) (pPB-N-His)

PV058814 500 ng
EUR 481

TGM3 Protein Vector (Human) (pPM-C-HA)

PV058815 500 ng
EUR 481

TGM3 Protein Vector (Human) (pPM-C-His)

PV058816 500 ng
EUR 481

Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit

SEB756Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 3, Epidermal (TGM3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 3, Epidermal (TGM3) in Tissue homogenates, cell lysates and other biological fluids.

Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit

SEB756Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 3, Epidermal (TGM3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 3, Epidermal (TGM3) in Tissue homogenates, cell lysates and other biological fluids.

Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit

SEB756Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 3, Epidermal (TGM3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 3, Epidermal (TGM3) in Tissue homogenates, cell lysates and other biological fluids.

Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit

SEB756Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transglutaminase 3, Epidermal (TGM3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transglutaminase 3, Epidermal (TGM3) in Tissue homogenates, cell lysates and other biological fluids.

Human Transglutaminase 3, Epidermal (TGM3) ELISA Kit

4-SEB756Hu
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Transglutaminase 3, Epidermal elisa. Alternative names of the recognized antigen: TGE
  • Egt
  • Protein-Glutamine Gamma-Glutamyltransferase E
  • Transglutaminase E
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Transglutaminase 3, Epidermal (TGM3) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Transglutaminase 3, Epidermal (TGM3) ELISA Kit

SEB756Mu-10x96wellstestplate 10x96-wells test plate
EUR 4626.78
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Transglutaminase 3, Epidermal (TGM3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Transglutaminase 3, Epidermal (TGM3) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Transglutaminase 3, Epidermal (TGM3) ELISA Kit

SEB756Mu-1x48wellstestplate 1x48-wells test plate
EUR 468.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Transglutaminase 3, Epidermal (TGM3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Transglutaminase 3, Epidermal (TGM3) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Transglutaminase 3, Epidermal (TGM3) ELISA Kit

SEB756Mu-1x96wellstestplate 1x96-wells test plate
EUR 626.68
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Transglutaminase 3, Epidermal (TGM3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Transglutaminase 3, Epidermal (TGM3) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Transglutaminase 3, Epidermal (TGM3) ELISA Kit

SEB756Mu-5x96wellstestplate 5x96-wells test plate
EUR 2520.06
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Transglutaminase 3, Epidermal (TGM3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Transglutaminase 3, Epidermal (TGM3) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Transglutaminase 3, Epidermal (TGM3) ELISA Kit

4-SEB756Mu
  • EUR 4677.00
  • EUR 2471.00
  • EUR 627.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Transglutaminase 3, Epidermal elisa. Alternative names of the recognized antigen: TGE
  • Egt
  • Protein-Glutamine Gamma-Glutamyltransferase E
  • Transglutaminase E
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Transglutaminase 3, Epidermal (TGM3) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Transglutaminase 3, Epidermal ELISA Kit (TGM3)

RK02382 96 Tests
EUR 521

Human Transglutaminase 3, Epidermal(TGM3)ELISA Kit

QY-E04117 96T
EUR 361

TGM3 Protein Vector (Rat) (pPB-C-His)

PV310626 500 ng
EUR 1166

TGM3 Protein Vector (Rat) (pPB-N-His)

PV310627 500 ng
EUR 1166

TGM3 Protein Vector (Rat) (pPM-C-HA)

PV310628 500 ng
EUR 1166

TGM3 Protein Vector (Rat) (pPM-C-His)

PV310629 500 ng
EUR 1166

TGM3 Protein Vector (Mouse) (pPB-C-His)

PV237990 500 ng
EUR 1065

TGM3 Protein Vector (Mouse) (pPB-N-His)

PV237991 500 ng
EUR 1065

TGM3 Protein Vector (Mouse) (pPM-C-HA)

PV237992 500 ng
EUR 1065

TGM3 Protein Vector (Mouse) (pPM-C-His)

PV237993 500 ng
EUR 1065

Tgm3 3'UTR GFP Stable Cell Line

TU170425 1.0 ml Ask for price

TGM3 3'UTR GFP Stable Cell Line

TU075502 1.0 ml
EUR 1521

Tgm3 3'UTR Luciferase Stable Cell Line

TU120425 1.0 ml Ask for price

TGM3 3'UTR Luciferase Stable Cell Line

TU025502 1.0 ml
EUR 1521

Tgm3 3'UTR Luciferase Stable Cell Line

TU221835 1.0 ml Ask for price

Tgm3 3'UTR GFP Stable Cell Line

TU271835 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

TGM3 Rabbit Polyclonal Antibody