GPR84 Rabbit Polyclonal Antibody

GPR84 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

GPR84 Polyclonal Antibody

ABP58698-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human GPR84 protein at amino acid sequence of 230-310
  • Applications tips:
Description: A polyclonal antibody for detection of GPR84 from Human. This GPR84 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPR84 protein at amino acid sequence of 230-310

GPR84 Polyclonal Antibody

ABP58698-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human GPR84 protein at amino acid sequence of 230-310
  • Applications tips:
Description: A polyclonal antibody for detection of GPR84 from Human. This GPR84 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPR84 protein at amino acid sequence of 230-310

GPR84 Polyclonal Antibody

A67298 100 µg
EUR 570.55
Description: The best epigenetics products

Polyclonal GPR84 Antibody (Center)

APR16623G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR84 (Center). This antibody is tested and proven to work in the following applications:

GPR84 Antibody

ABD2769 100 ug
EUR 438

GPR84 Antibody

ABD2811 100 ug
EUR 438

GPR84 Antibody

44971-100ul 100ul
EUR 252

GPR84 Antibody

44971-50ul 50ul
EUR 187

GPR84 Antibody

DF2769 200ul
EUR 304
Description: GPR84 antibody detects endogenous levels of total GPR84.

GPR84 Antibody

DF2811 200ul
EUR 304
Description: GPR84 antibody detects endogenous levels of total GPR84.

GPR84 Antibody

1-CSB-PA865107LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPR84. Recognizes GPR84 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

Polyclonal GPR84 Antibody (Cytoplasmic Domain)

APR16624G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR84 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

Polyclonal GPR84 Antibody (Extracellular Domain)

APR16625G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR84 (Extracellular Domain). This antibody is tested and proven to work in the following applications:

GPR84 Polyclonal Antibody, HRP Conjugated

A67299 100 µg
EUR 570.55
Description: kits suitable for this type of research

GPR84 Polyclonal Antibody, FITC Conjugated

A67300 100 µg
EUR 570.55
Description: fast delivery possible

GPR84 Polyclonal Antibody, Biotin Conjugated

A67301 100 µg
EUR 570.55
Description: reagents widely cited

GPR84 Conjugated Antibody

C44971 100ul
EUR 397

GPR84 Antibody (HRP)

20-abx310835
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GPR84 Antibody (FITC)

20-abx310836
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GPR84 Antibody (Biotin)

20-abx310837
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-GPR84 antibody

STJ192641 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GPR84

GPR84 siRNA

20-abx918560
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPR84 siRNA

20-abx918561
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPR84 Antibody, HRP conjugated

1-CSB-PA865107LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPR84. Recognizes GPR84 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GPR84 Antibody, FITC conjugated

1-CSB-PA865107LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPR84. Recognizes GPR84 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GPR84 Antibody, Biotin conjugated

1-CSB-PA865107LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPR84. Recognizes GPR84 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GPR84 antagonist 8

HY-112562 10mM/1mL
EUR 744

GPR84 cloning plasmid

CSB-CL865107HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1191
  • Sequence: atgtggaacagctctgacgccaacttctcctgctaccatgagtctgtgctgggctatcgttatgttgcagttagctggggggtggtggtggctgtgacaggcaccgtgggcaatgtgctcaccctactggccttggccatccagcccaagctccgtacccgattcaacctgctca
  • Show more
Description: A cloning plasmid for the GPR84 gene.

GPR84 Blocking Peptide

DF2769-BP 1mg
EUR 195

GPR84 Blocking Peptide

DF2811-BP 1mg
EUR 195

pET24a-GPR84 Plasmid

PVTB50010-1a 2 ug
EUR 356

Mouse GPR84 shRNA Plasmid

20-abx979070
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GPR84 shRNA Plasmid

20-abx959986
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GPR84 Recombinant Protein (Human)

RP013903 100 ug Ask for price

GPR84 Rabbit Polyclonal Antibody