GPR84 Rabbit Polyclonal Antibody
To Order Now: info@poweratlas.org
GPR84 Polyclonal Antibody |
ABP58698-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human GPR84 protein at amino acid sequence of 230-310
- Applications tips:
|
Description: A polyclonal antibody for detection of GPR84 from Human. This GPR84 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPR84 protein at amino acid sequence of 230-310 |
GPR84 Polyclonal Antibody |
ES11483-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against GPR84 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
GPR84 Polyclonal Antibody |
ES11483-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against GPR84 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Polyclonal GPR84 Antibody (Center) |
APR16623G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR84 (Center). This antibody is tested and proven to work in the following applications: |
GPR84 Antibody |
44971-100ul |
SAB |
100ul |
EUR 252 |
GPR84 Antibody |
44971-50ul |
SAB |
50ul |
EUR 187 |
GPR84 Antibody |
1-CSB-PA865107LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GPR84. Recognizes GPR84 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200 |
GPR84 Antibody |
DF2769 |
Affbiotech |
200ul |
EUR 304 |
Description: GPR84 antibody detects endogenous levels of total GPR84. |
GPR84 Antibody |
DF2811 |
Affbiotech |
200ul |
EUR 304 |
Description: GPR84 antibody detects endogenous levels of total GPR84. |
Polyclonal GPR84 Antibody (Cytoplasmic Domain) |
APR16624G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR84 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications: |
Polyclonal GPR84 Antibody (Extracellular Domain) |
APR16625G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR84 (Extracellular Domain). This antibody is tested and proven to work in the following applications: |
GPR84 Polyclonal Antibody, HRP Conjugated |
A67299 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
GPR84 Polyclonal Antibody, FITC Conjugated |
A67300 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
GPR84 Polyclonal Antibody, Biotin Conjugated |
A67301 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
GPR84 Conjugated Antibody |
C44971 |
SAB |
100ul |
EUR 397 |
GPR84 Antibody (HRP) |
20-abx310835 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
GPR84 Antibody (FITC) |
20-abx310836 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
GPR84 Antibody (Biotin) |
20-abx310837 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-GPR84 antibody |
STJ192641 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to GPR84 |
GPR84 siRNA |
20-abx918560 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GPR84 siRNA |
20-abx918561 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GPR84 Antibody, HRP conjugated |
1-CSB-PA865107LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GPR84. Recognizes GPR84 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
GPR84 Antibody, FITC conjugated |
1-CSB-PA865107LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GPR84. Recognizes GPR84 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
GPR84 Antibody, Biotin conjugated |
1-CSB-PA865107LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GPR84. Recognizes GPR84 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
GPR84 Blocking Peptide |
DF2769-BP |
Affbiotech |
1mg |
EUR 195 |
GPR84 Blocking Peptide |
DF2811-BP |
Affbiotech |
1mg |
EUR 195 |
GPR84 cloning plasmid |
CSB-CL865107HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1191
- Sequence: atgtggaacagctctgacgccaacttctcctgctaccatgagtctgtgctgggctatcgttatgttgcagttagctggggggtggtggtggctgtgacaggcaccgtgggcaatgtgctcaccctactggccttggccatccagcccaagctccgtacccgattcaacctgctca
- Show more
|
Description: A cloning plasmid for the GPR84 gene. |
Mouse GPR84 shRNA Plasmid |
20-abx979070 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human GPR84 shRNA Plasmid |
20-abx959986 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
GPR84 Rabbit Polyclonal Antibody