IMMT Rabbit Polyclonal Antibody
To Order Now: info@poweratlas.org
IMMT Polyclonal Antibody |
ES11845-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IMMT from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
IMMT Rabbit pAb |
A14107-100ul |
Abclonal |
100 ul |
EUR 308 |
IMMT Rabbit pAb |
A14107-200ul |
Abclonal |
200 ul |
EUR 459 |
IMMT Rabbit pAb |
A14107-20ul |
Abclonal |
20 ul |
EUR 183 |
IMMT Rabbit pAb |
A14107-50ul |
Abclonal |
50 ul |
EUR 223 |
IMMT Rabbit pAb |
A4471-100ul |
Abclonal |
100 ul |
EUR 308 |
IMMT Rabbit pAb |
A4471-200ul |
Abclonal |
200 ul |
EUR 459 |
IMMT Rabbit pAb |
A4471-20ul |
Abclonal |
20 ul |
Ask for price |
IMMT Rabbit pAb |
A4471-50ul |
Abclonal |
50 ul |
Ask for price |
IMMT Rabbit pAb |
A2751-100ul |
Abclonal |
100 ul |
EUR 308 |
IMMT Rabbit pAb |
A2751-200ul |
Abclonal |
200 ul |
EUR 459 |
IMMT Rabbit pAb |
A2751-20ul |
Abclonal |
20 ul |
EUR 183 |
IMMT Rabbit pAb |
A2751-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal IMMT Antibody (Center) |
APR07991G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IMMT (Center). This antibody is tested and proven to work in the following applications: |
Polyclonal IMMT Antibody (Center) |
APR07992G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IMMT (Center). This antibody is tested and proven to work in the following applications: |
IMMT Antibody |
31090-100ul |
SAB |
100ul |
EUR 252 |
IMMT Antibody |
31090-50ul |
SAB |
50ul |
EUR 187 |
IMMT antibody |
70R-17962 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal IMMT antibody |
IMMT antibody |
38458-100ul |
SAB |
100ul |
EUR 252 |
IMMT Antibody |
1-CSB-PA598310 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against IMMT. Recognizes IMMT from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:15-1:50 |
IMMT Antibody |
1-CSB-PA623101LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against IMMT. Recognizes IMMT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF, IP; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200, IP:1:200-1:2000 |
IMMT Antibody |
1-CSB-PA985538 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against IMMT. Recognizes IMMT from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200 |
IMMT Antibody |
DF7074 |
Affbiotech |
200ul |
EUR 304 |
Description: IMMT Antibody detects endogenous levels of total IMMT. |
IMMT Antibody |
1-CSB-PA011690GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against IMMT. Recognizes IMMT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
Mitofilin (IMMT) Antibody |
20-abx008293 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Mitofilin (IMMT) Antibody |
20-abx003344 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Mitofilin (IMMT) Antibody |
20-abx213137 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Mitofilin (IMMT) Antibody |
20-abx213329 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Mitofilin (IMMT) Antibody |
20-abx113139 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Mitofilin (IMMT) Antibody |
abx036116-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Mitofilin (IMMT) Antibody |
abx031803-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Mitofilin (IMMT) Antibody |
abx031803-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
IMMT Conjugated Antibody |
C31090 |
SAB |
100ul |
EUR 397 |
IMMT Conjugated Antibody |
C38458 |
SAB |
100ul |
EUR 397 |
Mitofilin (IMMT) Antibody |
abx235199-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Mitofilin (IMMT) Antibody |
20-abx302625 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Mitofilin (IMMT) Antibody |
20-abx002081 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Anti-IMMT antibody |
STJ193003 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to IMMT |
IMMT siRNA |
20-abx902673 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
IMMT siRNA |
20-abx920570 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
IMMT siRNA |
20-abx920571 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
IMMT Antibody, HRP conjugated |
1-CSB-PA623101LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against IMMT. Recognizes IMMT from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
IMMT Antibody, FITC conjugated |
1-CSB-PA623101LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against IMMT. Recognizes IMMT from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
IMMT Antibody, Biotin conjugated |
1-CSB-PA623101LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against IMMT. Recognizes IMMT from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Mitofilin (IMMT) Antibody (HRP) |
20-abx317405 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Mitofilin (IMMT) Antibody (FITC) |
20-abx317406 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Mitofilin (IMMT) Antibody (Biotin) |
20-abx317407 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
IMMT Blocking Peptide |
DF7074-BP |
Affbiotech |
1mg |
EUR 195 |
IMMT cloning plasmid |
CSB-CL623101HU-10ug |
Cusabio |
10ug |
EUR 474 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2277
- Sequence: atgctgcgggcctgtcagttatcgggtgtgaccgccgccgcccagagttgtctctgtgggaagtttgtcctccgtccattgcgaccatgccgcagatactctacttcaggcagctctgggttgactactggcaaaattgctggagctggccttttgtttgttggtggaggtattg
- Show more
|
Description: A cloning plasmid for the IMMT gene. |
Rat IMMT shRNA Plasmid |
20-abx989719 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse IMMT shRNA Plasmid |
20-abx978650 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human IMMT shRNA Plasmid |
20-abx957504 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
IMMT Recombinant Protein (Human) |
RP016108 |
ABM |
100 ug |
Ask for price |
IMMT Recombinant Protein (Rat) |
RP205973 |
ABM |
100 ug |
Ask for price |
IMMT Recombinant Protein (Mouse) |
RP143741 |
ABM |
100 ug |
Ask for price |
IMMT Recombinant Protein (Mouse) |
RP143744 |
ABM |
100 ug |
Ask for price |
IMMT Recombinant Protein (Mouse) |
RP143747 |
ABM |
100 ug |
Ask for price |
IMMT Recombinant Protein (Mouse) |
RP143750 |
ABM |
100 ug |
Ask for price |
IMMT Recombinant Protein (Mouse) |
RP143753 |
ABM |
100 ug |
Ask for price |
IMMT Recombinant Protein (Mouse) |
RP143756 |
ABM |
100 ug |
Ask for price |
Human Mitofilin (IMMT) ELISA Kit |
abx259696-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Immt ORF Vector (Rat) (pORF) |
ORF068659 |
ABM |
1.0 ug DNA |
EUR 506 |
IMMT ORF Vector (Human) (pORF) |
ORF005370 |
ABM |
1.0 ug DNA |
EUR 95 |
Immt ORF Vector (Mouse) (pORF) |
ORF047915 |
ABM |
1.0 ug DNA |
EUR 506 |
Immt ORF Vector (Mouse) (pORF) |
ORF047916 |
ABM |
1.0 ug DNA |
EUR 506 |
Immt ORF Vector (Mouse) (pORF) |
ORF047917 |
ABM |
1.0 ug DNA |
EUR 506 |
Immt ORF Vector (Mouse) (pORF) |
ORF047918 |
ABM |
1.0 ug DNA |
EUR 506 |
Immt ORF Vector (Mouse) (pORF) |
ORF047919 |
ABM |
1.0 ug DNA |
EUR 506 |
Immt ORF Vector (Mouse) (pORF) |
ORF047920 |
ABM |
1.0 ug DNA |
EUR 506 |
Immt sgRNA CRISPR Lentivector set (Rat) |
K7307201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Immt sgRNA CRISPR Lentivector set (Mouse) |
K4633301 |
ABM |
3 x 1.0 ug |
EUR 339 |
IMMT sgRNA CRISPR Lentivector set (Human) |
K1084601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Immt sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7307202 |
ABM |
1.0 ug DNA |
EUR 154 |
Immt sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7307203 |
ABM |
1.0 ug DNA |
EUR 154 |
Immt sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7307204 |
ABM |
1.0 ug DNA |
EUR 154 |
Immt sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4633302 |
ABM |
1.0 ug DNA |
EUR 154 |
Immt sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4633303 |
ABM |
1.0 ug DNA |
EUR 154 |
Immt sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4633304 |
ABM |
1.0 ug DNA |
EUR 154 |
IMMT sgRNA CRISPR Lentivector (Human) (Target 1) |
K1084602 |
ABM |
1.0 ug DNA |
EUR 154 |
IMMT sgRNA CRISPR Lentivector (Human) (Target 2) |
K1084603 |
ABM |
1.0 ug DNA |
EUR 154 |
IMMT sgRNA CRISPR Lentivector (Human) (Target 3) |
K1084604 |
ABM |
1.0 ug DNA |
EUR 154 |
IMMT Protein Vector (Human) (pPB-C-His) |
PV021477 |
ABM |
500 ng |
EUR 329 |
IMMT Protein Vector (Human) (pPB-N-His) |
PV021478 |
ABM |
500 ng |
EUR 329 |
IMMT Protein Vector (Human) (pPM-C-HA) |
PV021479 |
ABM |
500 ng |
EUR 329 |
IMMT Protein Vector (Human) (pPM-C-His) |
PV021480 |
ABM |
500 ng |
EUR 329 |
IMMT Protein Vector (Rat) (pPB-C-His) |
PV274634 |
ABM |
500 ng |
EUR 603 |
IMMT Protein Vector (Rat) (pPB-N-His) |
PV274635 |
ABM |
500 ng |
EUR 603 |
IMMT Protein Vector (Rat) (pPM-C-HA) |
PV274636 |
ABM |
500 ng |
EUR 603 |
IMMT Protein Vector (Rat) (pPM-C-His) |
PV274637 |
ABM |
500 ng |
EUR 603 |
IMMT Protein Vector (Mouse) (pPB-C-His) |
PV191658 |
ABM |
500 ng |
EUR 1065 |
IMMT Protein Vector (Mouse) (pPB-N-His) |
PV191659 |
ABM |
500 ng |
EUR 1065 |
IMMT Protein Vector (Mouse) (pPM-C-HA) |
PV191660 |
ABM |
500 ng |
EUR 1065 |
IMMT Protein Vector (Mouse) (pPM-C-His) |
PV191661 |
ABM |
500 ng |
EUR 1065 |
IMMT Protein Vector (Mouse) (pPB-C-His) |
PV191662 |
ABM |
500 ng |
EUR 1065 |
IMMT Protein Vector (Mouse) (pPB-N-His) |
PV191663 |
ABM |
500 ng |
EUR 1065 |
IMMT Protein Vector (Mouse) (pPM-C-HA) |
PV191664 |
ABM |
500 ng |
EUR 1065 |
IMMT Protein Vector (Mouse) (pPM-C-His) |
PV191665 |
ABM |
500 ng |
EUR 1065 |
IMMT Protein Vector (Mouse) (pPB-C-His) |
PV191666 |
ABM |
500 ng |
EUR 1065 |
IMMT Protein Vector (Mouse) (pPB-N-His) |
PV191667 |
ABM |
500 ng |
EUR 1065 |
IMMT Protein Vector (Mouse) (pPM-C-HA) |
PV191668 |
ABM |
500 ng |
EUR 1065 |
IMMT Protein Vector (Mouse) (pPM-C-His) |
PV191669 |
ABM |
500 ng |
EUR 1065 |
IMMT Protein Vector (Mouse) (pPB-C-His) |
PV191670 |
ABM |
500 ng |
EUR 1065 |
IMMT Protein Vector (Mouse) (pPB-N-His) |
PV191671 |
ABM |
500 ng |
EUR 1065 |
IMMT Protein Vector (Mouse) (pPM-C-HA) |
PV191672 |
ABM |
500 ng |
EUR 1065 |
IMMT Protein Vector (Mouse) (pPM-C-His) |
PV191673 |
ABM |
500 ng |
EUR 1065 |
IMMT Protein Vector (Mouse) (pPB-C-His) |
PV191674 |
ABM |
500 ng |
EUR 1065 |
IMMT Protein Vector (Mouse) (pPB-N-His) |
PV191675 |
ABM |
500 ng |
EUR 1065 |
IMMT Protein Vector (Mouse) (pPM-C-HA) |
PV191676 |
ABM |
500 ng |
EUR 1065 |
IMMT Protein Vector (Mouse) (pPM-C-His) |
PV191677 |
ABM |
500 ng |
EUR 1065 |
IMMT Protein Vector (Mouse) (pPB-C-His) |
PV191678 |
ABM |
500 ng |
EUR 1065 |
IMMT Protein Vector (Mouse) (pPB-N-His) |
PV191679 |
ABM |
500 ng |
EUR 1065 |
IMMT Protein Vector (Mouse) (pPM-C-HA) |
PV191680 |
ABM |
500 ng |
EUR 1065 |
IMMT Protein Vector (Mouse) (pPM-C-His) |
PV191681 |
ABM |
500 ng |
EUR 1065 |
Immt 3'UTR Luciferase Stable Cell Line |
TU110100 |
ABM |
1.0 ml |
Ask for price |
Immt 3'UTR GFP Stable Cell Line |
TU160100 |
ABM |
1.0 ml |
Ask for price |
Immt 3'UTR Luciferase Stable Cell Line |
TU206274 |
ABM |
1.0 ml |
Ask for price |
Immt 3'UTR GFP Stable Cell Line |
TU256274 |
ABM |
1.0 ml |
Ask for price |
IMMT 3'UTR GFP Stable Cell Line |
TU061123 |
ABM |
1.0 ml |
EUR 1394 |
IMMT 3'UTR Luciferase Stable Cell Line |
TU011123 |
ABM |
1.0 ml |
EUR 1394 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
IMMT Rabbit Polyclonal Antibody