IMMT Rabbit Polyclonal Antibody

IMMT Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

IMMT Polyclonal Antibody

ES11845-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IMMT from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

IMMT Rabbit pAb

A14107-100ul 100 ul
EUR 308

IMMT Rabbit pAb

A14107-200ul 200 ul
EUR 459

IMMT Rabbit pAb

A14107-20ul 20 ul
EUR 183

IMMT Rabbit pAb

A14107-50ul 50 ul
EUR 223

IMMT Rabbit pAb

A4471-100ul 100 ul
EUR 308

IMMT Rabbit pAb

A4471-200ul 200 ul
EUR 459

IMMT Rabbit pAb

A4471-20ul 20 ul Ask for price

IMMT Rabbit pAb

A4471-50ul 50 ul Ask for price

IMMT Rabbit pAb

A2751-100ul 100 ul
EUR 308

IMMT Rabbit pAb

A2751-200ul 200 ul
EUR 459

IMMT Rabbit pAb

A2751-20ul 20 ul
EUR 183

IMMT Rabbit pAb

A2751-50ul 50 ul
EUR 223

Polyclonal IMMT Antibody (Center)

APR07991G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IMMT (Center). This antibody is tested and proven to work in the following applications:

Polyclonal IMMT Antibody (Center)

APR07992G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IMMT (Center). This antibody is tested and proven to work in the following applications:

IMMT Antibody

31090-100ul 100ul
EUR 252

IMMT Antibody

31090-50ul 50ul
EUR 187

IMMT antibody

70R-17962 50 ul
EUR 435
Description: Rabbit polyclonal IMMT antibody

IMMT antibody

38458-100ul 100ul
EUR 252

IMMT Antibody

1-CSB-PA598310
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against IMMT. Recognizes IMMT from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:15-1:50

IMMT Antibody

1-CSB-PA623101LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IMMT. Recognizes IMMT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF, IP; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200, IP:1:200-1:2000

IMMT Antibody

1-CSB-PA985538
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against IMMT. Recognizes IMMT from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

IMMT Antibody

DF7074 200ul
EUR 304
Description: IMMT Antibody detects endogenous levels of total IMMT.

IMMT Antibody

1-CSB-PA011690GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against IMMT. Recognizes IMMT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

IMMT Antibody

ABD7074 100 ug
EUR 438

Mitofilin (IMMT) Antibody

20-abx008293
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Mitofilin (IMMT) Antibody

20-abx003344
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Mitofilin (IMMT) Antibody

20-abx213137
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mitofilin (IMMT) Antibody

20-abx213329
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mitofilin (IMMT) Antibody

20-abx113139
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mitofilin (IMMT) Antibody

abx036116-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Mitofilin (IMMT) Antibody

abx031803-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Mitofilin (IMMT) Antibody

abx031803-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

IMMT Conjugated Antibody

C31090 100ul
EUR 397

IMMT Conjugated Antibody

C38458 100ul
EUR 397

Mitofilin (IMMT) Antibody

abx235199-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Mitofilin (IMMT) Antibody

20-abx302625
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mitofilin (IMMT) Antibody

20-abx002081
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Anti-IMMT antibody

STJ24199 100 µl
EUR 277

Anti-IMMT antibody

STJ24200 100 µl
EUR 277

Anti-IMMT antibody

STJ116042 100 µl
EUR 277

Anti-IMMT antibody

STJ193003 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to IMMT

Immt/ Rat Immt ELISA Kit

ELI-43729r 96 Tests
EUR 886

IMMT siRNA

20-abx902673
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IMMT siRNA

20-abx920570
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IMMT siRNA

20-abx920571
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pOTB7-IMMT

PVT18623 2 ug
EUR 258

IMMT Antibody, HRP conjugated

1-CSB-PA623101LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IMMT. Recognizes IMMT from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

IMMT Antibody, FITC conjugated

1-CSB-PA623101LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IMMT. Recognizes IMMT from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

IMMT Antibody, Biotin conjugated

1-CSB-PA623101LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IMMT. Recognizes IMMT from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mitofilin (IMMT) Antibody (HRP)

20-abx317405
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mitofilin (IMMT) Antibody (FITC)

20-abx317406
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mitofilin (IMMT) Antibody (Biotin)

20-abx317407
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

IMMT Blocking Peptide

DF7074-BP 1mg
EUR 195

IMMT cloning plasmid

CSB-CL623101HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2277
  • Sequence: atgctgcgggcctgtcagttatcgggtgtgaccgccgccgcccagagttgtctctgtgggaagtttgtcctccgtccattgcgaccatgccgcagatactctacttcaggcagctctgggttgactactggcaaaattgctggagctggccttttgtttgttggtggaggtattg
  • Show more
Description: A cloning plasmid for the IMMT gene.

Rat IMMT shRNA Plasmid

20-abx989719
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse IMMT shRNA Plasmid

20-abx978650
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human IMMT shRNA Plasmid

20-abx957504
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

IMMT Recombinant Protein (Human)

RP016108 100 ug Ask for price

IMMT Recombinant Protein (Rat)

RP205973 100 ug Ask for price

IMMT Recombinant Protein (Mouse)

RP143741 100 ug Ask for price

IMMT Recombinant Protein (Mouse)

RP143744 100 ug Ask for price

IMMT Recombinant Protein (Mouse)

RP143747 100 ug Ask for price

IMMT Recombinant Protein (Mouse)

RP143750 100 ug Ask for price

IMMT Recombinant Protein (Mouse)

RP143753 100 ug Ask for price

IMMT Recombinant Protein (Mouse)

RP143756 100 ug Ask for price

Human Mitofilin (IMMT) ELISA Kit

abx259696-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Immt ORF Vector (Rat) (pORF)

ORF068659 1.0 ug DNA
EUR 506

IMMT ORF Vector (Human) (pORF)

ORF005370 1.0 ug DNA
EUR 95

Immt ORF Vector (Mouse) (pORF)

ORF047915 1.0 ug DNA
EUR 506

Immt ORF Vector (Mouse) (pORF)

ORF047916 1.0 ug DNA
EUR 506

Immt ORF Vector (Mouse) (pORF)

ORF047917 1.0 ug DNA
EUR 506

Immt ORF Vector (Mouse) (pORF)

ORF047918 1.0 ug DNA
EUR 506

Immt ORF Vector (Mouse) (pORF)

ORF047919 1.0 ug DNA
EUR 506

Immt ORF Vector (Mouse) (pORF)

ORF047920 1.0 ug DNA
EUR 506

Immt sgRNA CRISPR Lentivector set (Rat)

K7307201 3 x 1.0 ug
EUR 339

Immt sgRNA CRISPR Lentivector set (Mouse)

K4633301 3 x 1.0 ug
EUR 339

IMMT sgRNA CRISPR Lentivector set (Human)

K1084601 3 x 1.0 ug
EUR 339

Immt sgRNA CRISPR Lentivector (Rat) (Target 1)

K7307202 1.0 ug DNA
EUR 154

Immt sgRNA CRISPR Lentivector (Rat) (Target 2)

K7307203 1.0 ug DNA
EUR 154

Immt sgRNA CRISPR Lentivector (Rat) (Target 3)

K7307204 1.0 ug DNA
EUR 154

Immt sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4633302 1.0 ug DNA
EUR 154

Immt sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4633303 1.0 ug DNA
EUR 154

Immt sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4633304 1.0 ug DNA
EUR 154

IMMT sgRNA CRISPR Lentivector (Human) (Target 1)

K1084602 1.0 ug DNA
EUR 154

IMMT sgRNA CRISPR Lentivector (Human) (Target 2)

K1084603 1.0 ug DNA
EUR 154

IMMT sgRNA CRISPR Lentivector (Human) (Target 3)

K1084604 1.0 ug DNA
EUR 154

IMMT Protein Vector (Human) (pPB-C-His)

PV021477 500 ng
EUR 329

IMMT Protein Vector (Human) (pPB-N-His)

PV021478 500 ng
EUR 329

IMMT Protein Vector (Human) (pPM-C-HA)

PV021479 500 ng
EUR 329

IMMT Protein Vector (Human) (pPM-C-His)

PV021480 500 ng
EUR 329

IMMT Protein Vector (Rat) (pPB-C-His)

PV274634 500 ng
EUR 603

IMMT Protein Vector (Rat) (pPB-N-His)

PV274635 500 ng
EUR 603

IMMT Protein Vector (Rat) (pPM-C-HA)

PV274636 500 ng
EUR 603

IMMT Protein Vector (Rat) (pPM-C-His)

PV274637 500 ng
EUR 603

IMMT Protein Vector (Mouse) (pPB-C-His)

PV191658 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPB-N-His)

PV191659 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPM-C-HA)

PV191660 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPM-C-His)

PV191661 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPB-C-His)

PV191662 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPB-N-His)

PV191663 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPM-C-HA)

PV191664 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPM-C-His)

PV191665 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPB-C-His)

PV191666 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPB-N-His)

PV191667 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPM-C-HA)

PV191668 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPM-C-His)

PV191669 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPB-C-His)

PV191670 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPB-N-His)

PV191671 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPM-C-HA)

PV191672 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPM-C-His)

PV191673 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPB-C-His)

PV191674 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPB-N-His)

PV191675 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPM-C-HA)

PV191676 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPM-C-His)

PV191677 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPB-C-His)

PV191678 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPB-N-His)

PV191679 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPM-C-HA)

PV191680 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPM-C-His)

PV191681 500 ng
EUR 1065

Immt 3'UTR Luciferase Stable Cell Line

TU110100 1.0 ml Ask for price

Immt 3'UTR GFP Stable Cell Line

TU160100 1.0 ml Ask for price

Immt 3'UTR Luciferase Stable Cell Line

TU206274 1.0 ml Ask for price

Immt 3'UTR GFP Stable Cell Line

TU256274 1.0 ml Ask for price

IMMT 3'UTR GFP Stable Cell Line

TU061123 1.0 ml
EUR 1394

IMMT 3'UTR Luciferase Stable Cell Line

TU011123 1.0 ml
EUR 1394

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

IMMT Rabbit Polyclonal Antibody