IMMT Rabbit Polyclonal Antibody

IMMT Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

IMMT Polyclonal Antibody
ABP58932-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human IMMT protein Applications tips:
Description: A polyclonal antibody for detection of IMMT from Human, Mouse, Rat. This IMMT antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IMMT protein

IMMT Rabbit pAb
A4471-100ul	Abclonal	100 ul	EUR 308

IMMT Rabbit pAb
A4471-200ul	Abclonal	200 ul	EUR 459

IMMT Rabbit pAb
A4471-20ul	Abclonal	20 ul	Ask for price

IMMT Rabbit pAb
A4471-50ul	Abclonal	50 ul	Ask for price

IMMT Rabbit pAb
A14107-100ul	Abclonal	100 ul	EUR 308

IMMT Rabbit pAb
A14107-200ul	Abclonal	200 ul	EUR 459

IMMT Rabbit pAb
A14107-20ul	Abclonal	20 ul	EUR 183

IMMT Rabbit pAb
A14107-50ul	Abclonal	50 ul	EUR 223

IMMT Rabbit pAb
A2751-100ul	Abclonal	100 ul	EUR 308

IMMT Rabbit pAb
A2751-200ul	Abclonal	200 ul	EUR 459

IMMT Rabbit pAb
A2751-20ul	Abclonal	20 ul	EUR 183

IMMT Rabbit pAb
A2751-50ul	Abclonal	50 ul	EUR 223

Polyclonal IMMT Antibody (Center)
APR07991G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IMMT (Center). This antibody is tested and proven to work in the following applications:

Polyclonal IMMT Antibody (Center)
APR07992G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IMMT (Center). This antibody is tested and proven to work in the following applications:

IMMT Antibody
ABD7074	Lifescience Market	100 ug	EUR 438

IMMT antibody
38458-100ul	SAB	100ul	EUR 252

IMMT Antibody
31090-100ul	SAB	100ul	EUR 252

IMMT Antibody
31090-50ul	SAB	50ul	EUR 187

IMMT antibody
70R-17962	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal IMMT antibody

IMMT Antibody
DF7074	Affbiotech	200ul	EUR 304
Description: IMMT Antibody detects endogenous levels of total IMMT.

IMMT Antibody
1-CSB-PA985538	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against IMMT. Recognizes IMMT from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

IMMT Antibody
1-CSB-PA011690GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against IMMT. Recognizes IMMT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

IMMT Antibody
1-CSB-PA598310	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against IMMT. Recognizes IMMT from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:15-1:50

IMMT Antibody
1-CSB-PA623101LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IMMT. Recognizes IMMT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF, IP; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200, IP:1:200-1:2000

IMMT Conjugated Antibody
C38458	SAB	100ul	EUR 397

IMMT Conjugated Antibody
C31090	SAB	100ul	EUR 397

Mitofilin (IMMT) Antibody
20-abx113139	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Mitofilin (IMMT) Antibody
20-abx002081	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Mitofilin (IMMT) Antibody
abx036116-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Mitofilin (IMMT) Antibody
20-abx008293	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Mitofilin (IMMT) Antibody
20-abx003344	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Mitofilin (IMMT) Antibody
abx031803-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Mitofilin (IMMT) Antibody
abx031803-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Mitofilin (IMMT) Antibody
abx235199-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Mitofilin (IMMT) Antibody
20-abx302625	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Mitofilin (IMMT) Antibody
20-abx213137	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Mitofilin (IMMT) Antibody
20-abx213329	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Anti-IMMT antibody
STJ24199	St John's Laboratory	100 µl	EUR 277

Anti-IMMT antibody
STJ24200	St John's Laboratory	100 µl	EUR 277

Anti-IMMT antibody
STJ193003	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to IMMT

Anti-IMMT antibody
STJ116042	St John's Laboratory	100 µl	EUR 277

Immt/ Rat Immt ELISA Kit
ELI-43729r	Lifescience Market	96 Tests	EUR 886

IMMT siRNA
20-abx902673	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

IMMT siRNA
20-abx920570	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

IMMT siRNA
20-abx920571	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pOTB7-IMMT
PVT18623	Lifescience Market	2 ug	EUR 258

Mitofilin (IMMT) Antibody (HRP)
20-abx317405	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Mitofilin (IMMT) Antibody (FITC)
20-abx317406	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Mitofilin (IMMT) Antibody (Biotin)
20-abx317407	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

IMMT Antibody, HRP conjugated
1-CSB-PA623101LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IMMT. Recognizes IMMT from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

IMMT Antibody, FITC conjugated
1-CSB-PA623101LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IMMT. Recognizes IMMT from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

IMMT Antibody, Biotin conjugated
1-CSB-PA623101LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IMMT. Recognizes IMMT from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

IMMT Blocking Peptide
DF7074-BP	Affbiotech	1mg	EUR 195

IMMT cloning plasmid
CSB-CL623101HU-10ug	Cusabio	10ug	EUR 474
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2277 Sequence: atgctgcgggcctgtcagttatcgggtgtgaccgccgccgcccagagttgtctctgtgggaagtttgtcctccgtccattgcgaccatgccgcagatactctacttcaggcagctctgggttgactactggcaaaattgctggagctggccttttgtttgttggtggaggtattg Show more
Description: A cloning plasmid for the IMMT gene.

Mouse IMMT shRNA Plasmid
20-abx978650	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat IMMT shRNA Plasmid
20-abx989719	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human IMMT shRNA Plasmid
20-abx957504	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

IMMT Recombinant Protein (Human)
RP016108	ABM	100 ug	Ask for price

IMMT Recombinant Protein (Rat)
RP205973	ABM	100 ug	Ask for price

IMMT Recombinant Protein (Mouse)
RP143741	ABM	100 ug	Ask for price

IMMT Recombinant Protein (Mouse)
RP143744	ABM	100 ug	Ask for price

IMMT Recombinant Protein (Mouse)
RP143747	ABM	100 ug	Ask for price

IMMT Recombinant Protein (Mouse)
RP143750	ABM	100 ug	Ask for price

IMMT Recombinant Protein (Mouse)
RP143753	ABM	100 ug	Ask for price

IMMT Recombinant Protein (Mouse)
RP143756	ABM	100 ug	Ask for price

Human Mitofilin (IMMT) ELISA Kit
abx259696-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

IMMT ORF Vector (Human) (pORF)
ORF005370	ABM	1.0 ug DNA	EUR 95

Immt ORF Vector (Rat) (pORF)
ORF068659	ABM	1.0 ug DNA	EUR 506

Immt ORF Vector (Mouse) (pORF)
ORF047915	ABM	1.0 ug DNA	EUR 506

Immt ORF Vector (Mouse) (pORF)
ORF047916	ABM	1.0 ug DNA	EUR 506

Immt ORF Vector (Mouse) (pORF)
ORF047917	ABM	1.0 ug DNA	EUR 506

Immt ORF Vector (Mouse) (pORF)
ORF047918	ABM	1.0 ug DNA	EUR 506

Immt ORF Vector (Mouse) (pORF)
ORF047919	ABM	1.0 ug DNA	EUR 506

Immt ORF Vector (Mouse) (pORF)
ORF047920	ABM	1.0 ug DNA	EUR 506

Immt sgRNA CRISPR Lentivector set (Mouse)
K4633301	ABM	3 x 1.0 ug	EUR 339

IMMT sgRNA CRISPR Lentivector set (Human)
K1084601	ABM	3 x 1.0 ug	EUR 339

Immt sgRNA CRISPR Lentivector set (Rat)
K7307201	ABM	3 x 1.0 ug	EUR 339

Immt sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4633302	ABM	1.0 ug DNA	EUR 154

Immt sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4633303	ABM	1.0 ug DNA	EUR 154

Immt sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4633304	ABM	1.0 ug DNA	EUR 154

IMMT sgRNA CRISPR Lentivector (Human) (Target 1)
K1084602	ABM	1.0 ug DNA	EUR 154

IMMT sgRNA CRISPR Lentivector (Human) (Target 2)
K1084603	ABM	1.0 ug DNA	EUR 154

IMMT sgRNA CRISPR Lentivector (Human) (Target 3)
K1084604	ABM	1.0 ug DNA	EUR 154

Immt sgRNA CRISPR Lentivector (Rat) (Target 1)
K7307202	ABM	1.0 ug DNA	EUR 154

Immt sgRNA CRISPR Lentivector (Rat) (Target 2)
K7307203	ABM	1.0 ug DNA	EUR 154

Immt sgRNA CRISPR Lentivector (Rat) (Target 3)
K7307204	ABM	1.0 ug DNA	EUR 154

IMMT Protein Vector (Human) (pPB-C-His)
PV021477	ABM	500 ng	EUR 329

IMMT Protein Vector (Human) (pPB-N-His)
PV021478	ABM	500 ng	EUR 329

IMMT Protein Vector (Human) (pPM-C-HA)
PV021479	ABM	500 ng	EUR 329

IMMT Protein Vector (Human) (pPM-C-His)
PV021480	ABM	500 ng	EUR 329

IMMT Protein Vector (Rat) (pPB-C-His)
PV274634	ABM	500 ng	EUR 603

IMMT Protein Vector (Rat) (pPB-N-His)
PV274635	ABM	500 ng	EUR 603

IMMT Protein Vector (Rat) (pPM-C-HA)
PV274636	ABM	500 ng	EUR 603

IMMT Protein Vector (Rat) (pPM-C-His)
PV274637	ABM	500 ng	EUR 603

IMMT Protein Vector (Mouse) (pPB-C-His)
PV191658	ABM	500 ng	EUR 1065

IMMT Protein Vector (Mouse) (pPB-N-His)
PV191659	ABM	500 ng	EUR 1065

IMMT Protein Vector (Mouse) (pPM-C-HA)
PV191660	ABM	500 ng	EUR 1065

IMMT Protein Vector (Mouse) (pPM-C-His)
PV191661	ABM	500 ng	EUR 1065

IMMT Protein Vector (Mouse) (pPB-C-His)
PV191662	ABM	500 ng	EUR 1065

IMMT Protein Vector (Mouse) (pPB-N-His)
PV191663	ABM	500 ng	EUR 1065

IMMT Protein Vector (Mouse) (pPM-C-HA)
PV191664	ABM	500 ng	EUR 1065

IMMT Protein Vector (Mouse) (pPM-C-His)
PV191665	ABM	500 ng	EUR 1065

IMMT Protein Vector (Mouse) (pPB-C-His)
PV191666	ABM	500 ng	EUR 1065

IMMT Protein Vector (Mouse) (pPB-N-His)
PV191667	ABM	500 ng	EUR 1065

IMMT Protein Vector (Mouse) (pPM-C-HA)
PV191668	ABM	500 ng	EUR 1065

IMMT Protein Vector (Mouse) (pPM-C-His)
PV191669	ABM	500 ng	EUR 1065

IMMT Protein Vector (Mouse) (pPB-C-His)
PV191670	ABM	500 ng	EUR 1065

IMMT Protein Vector (Mouse) (pPB-N-His)
PV191671	ABM	500 ng	EUR 1065

IMMT Protein Vector (Mouse) (pPM-C-HA)
PV191672	ABM	500 ng	EUR 1065

IMMT Protein Vector (Mouse) (pPM-C-His)
PV191673	ABM	500 ng	EUR 1065

IMMT Protein Vector (Mouse) (pPB-C-His)
PV191674	ABM	500 ng	EUR 1065

IMMT Protein Vector (Mouse) (pPB-N-His)
PV191675	ABM	500 ng	EUR 1065

IMMT Protein Vector (Mouse) (pPM-C-HA)
PV191676	ABM	500 ng	EUR 1065

IMMT Protein Vector (Mouse) (pPM-C-His)
PV191677	ABM	500 ng	EUR 1065

IMMT Protein Vector (Mouse) (pPB-C-His)
PV191678	ABM	500 ng	EUR 1065

IMMT Protein Vector (Mouse) (pPB-N-His)
PV191679	ABM	500 ng	EUR 1065

IMMT Protein Vector (Mouse) (pPM-C-HA)
PV191680	ABM	500 ng	EUR 1065

IMMT Protein Vector (Mouse) (pPM-C-His)
PV191681	ABM	500 ng	EUR 1065

Immt 3'UTR Luciferase Stable Cell Line
TU206274	ABM	1.0 ml	Ask for price

Immt 3'UTR GFP Stable Cell Line
TU160100	ABM	1.0 ml	Ask for price

IMMT 3'UTR Luciferase Stable Cell Line
TU011123	ABM	1.0 ml	EUR 1394

Immt 3'UTR Luciferase Stable Cell Line
TU110100	ABM	1.0 ml	Ask for price

IMMT 3'UTR GFP Stable Cell Line
TU061123	ABM	1.0 ml	EUR 1394

Immt 3'UTR GFP Stable Cell Line
TU256274	ABM	1.0 ml	Ask for price

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IMMT Rabbit Polyclonal Antibody