IMMT Rabbit Polyclonal Antibody

IMMT Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

IMMT Polyclonal Antibody

ABP58932-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human IMMT protein
  • Applications tips:
Description: A polyclonal antibody for detection of IMMT from Human, Mouse, Rat. This IMMT antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IMMT protein

IMMT Rabbit pAb

A4471-100ul 100 ul
EUR 308

IMMT Rabbit pAb

A4471-200ul 200 ul
EUR 459

IMMT Rabbit pAb

A4471-20ul 20 ul Ask for price

IMMT Rabbit pAb

A4471-50ul 50 ul Ask for price

IMMT Rabbit pAb

A14107-100ul 100 ul
EUR 308

IMMT Rabbit pAb

A14107-200ul 200 ul
EUR 459

IMMT Rabbit pAb

A14107-20ul 20 ul
EUR 183

IMMT Rabbit pAb

A14107-50ul 50 ul
EUR 223

IMMT Rabbit pAb

A2751-100ul 100 ul
EUR 308

IMMT Rabbit pAb

A2751-200ul 200 ul
EUR 459

IMMT Rabbit pAb

A2751-20ul 20 ul
EUR 183

IMMT Rabbit pAb

A2751-50ul 50 ul
EUR 223

Polyclonal IMMT Antibody (Center)

APR07991G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IMMT (Center). This antibody is tested and proven to work in the following applications:

Polyclonal IMMT Antibody (Center)

APR07992G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IMMT (Center). This antibody is tested and proven to work in the following applications:

IMMT Antibody

ABD7074 100 ug
EUR 438

IMMT antibody

38458-100ul 100ul
EUR 252

IMMT Antibody

31090-100ul 100ul
EUR 252

IMMT Antibody

31090-50ul 50ul
EUR 187

IMMT antibody

70R-17962 50 ul
EUR 435
Description: Rabbit polyclonal IMMT antibody

IMMT Antibody

DF7074 200ul
EUR 304
Description: IMMT Antibody detects endogenous levels of total IMMT.

IMMT Antibody

1-CSB-PA985538
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against IMMT. Recognizes IMMT from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

IMMT Antibody

1-CSB-PA011690GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against IMMT. Recognizes IMMT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

IMMT Antibody

1-CSB-PA598310
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against IMMT. Recognizes IMMT from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:15-1:50

IMMT Antibody

1-CSB-PA623101LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IMMT. Recognizes IMMT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF, IP; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200, IP:1:200-1:2000

IMMT Conjugated Antibody

C38458 100ul
EUR 397

IMMT Conjugated Antibody

C31090 100ul
EUR 397

Mitofilin (IMMT) Antibody

20-abx113139
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mitofilin (IMMT) Antibody

20-abx002081
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mitofilin (IMMT) Antibody

abx036116-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Mitofilin (IMMT) Antibody

20-abx008293
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Mitofilin (IMMT) Antibody

20-abx003344
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Mitofilin (IMMT) Antibody

abx031803-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Mitofilin (IMMT) Antibody

abx031803-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Mitofilin (IMMT) Antibody

abx235199-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Mitofilin (IMMT) Antibody

20-abx302625
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mitofilin (IMMT) Antibody

20-abx213137
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mitofilin (IMMT) Antibody

20-abx213329
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Anti-IMMT antibody

STJ24199 100 µl
EUR 277

Anti-IMMT antibody

STJ24200 100 µl
EUR 277

Anti-IMMT antibody

STJ193003 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to IMMT

Anti-IMMT antibody

STJ116042 100 µl
EUR 277

Immt/ Rat Immt ELISA Kit

ELI-43729r 96 Tests
EUR 886

IMMT siRNA

20-abx902673
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IMMT siRNA

20-abx920570
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IMMT siRNA

20-abx920571
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pOTB7-IMMT

PVT18623 2 ug
EUR 258

Mitofilin (IMMT) Antibody (HRP)

20-abx317405
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mitofilin (IMMT) Antibody (FITC)

20-abx317406
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mitofilin (IMMT) Antibody (Biotin)

20-abx317407
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

IMMT Antibody, HRP conjugated

1-CSB-PA623101LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IMMT. Recognizes IMMT from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

IMMT Antibody, FITC conjugated

1-CSB-PA623101LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IMMT. Recognizes IMMT from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

IMMT Antibody, Biotin conjugated

1-CSB-PA623101LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IMMT. Recognizes IMMT from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

IMMT Blocking Peptide

DF7074-BP 1mg
EUR 195

IMMT cloning plasmid

CSB-CL623101HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2277
  • Sequence: atgctgcgggcctgtcagttatcgggtgtgaccgccgccgcccagagttgtctctgtgggaagtttgtcctccgtccattgcgaccatgccgcagatactctacttcaggcagctctgggttgactactggcaaaattgctggagctggccttttgtttgttggtggaggtattg
  • Show more
Description: A cloning plasmid for the IMMT gene.

Mouse IMMT shRNA Plasmid

20-abx978650
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat IMMT shRNA Plasmid

20-abx989719
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human IMMT shRNA Plasmid

20-abx957504
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

IMMT Recombinant Protein (Human)

RP016108 100 ug Ask for price

IMMT Recombinant Protein (Rat)

RP205973 100 ug Ask for price

IMMT Recombinant Protein (Mouse)

RP143741 100 ug Ask for price

IMMT Recombinant Protein (Mouse)

RP143744 100 ug Ask for price

IMMT Recombinant Protein (Mouse)

RP143747 100 ug Ask for price

IMMT Recombinant Protein (Mouse)

RP143750 100 ug Ask for price

IMMT Recombinant Protein (Mouse)

RP143753 100 ug Ask for price

IMMT Recombinant Protein (Mouse)

RP143756 100 ug Ask for price

Human Mitofilin (IMMT) ELISA Kit

abx259696-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

IMMT ORF Vector (Human) (pORF)

ORF005370 1.0 ug DNA
EUR 95

Immt ORF Vector (Rat) (pORF)

ORF068659 1.0 ug DNA
EUR 506

Immt ORF Vector (Mouse) (pORF)

ORF047915 1.0 ug DNA
EUR 506

Immt ORF Vector (Mouse) (pORF)

ORF047916 1.0 ug DNA
EUR 506

Immt ORF Vector (Mouse) (pORF)

ORF047917 1.0 ug DNA
EUR 506

Immt ORF Vector (Mouse) (pORF)

ORF047918 1.0 ug DNA
EUR 506

Immt ORF Vector (Mouse) (pORF)

ORF047919 1.0 ug DNA
EUR 506

Immt ORF Vector (Mouse) (pORF)

ORF047920 1.0 ug DNA
EUR 506

Immt sgRNA CRISPR Lentivector set (Mouse)

K4633301 3 x 1.0 ug
EUR 339

IMMT sgRNA CRISPR Lentivector set (Human)

K1084601 3 x 1.0 ug
EUR 339

Immt sgRNA CRISPR Lentivector set (Rat)

K7307201 3 x 1.0 ug
EUR 339

Immt sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4633302 1.0 ug DNA
EUR 154

Immt sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4633303 1.0 ug DNA
EUR 154

Immt sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4633304 1.0 ug DNA
EUR 154

IMMT sgRNA CRISPR Lentivector (Human) (Target 1)

K1084602 1.0 ug DNA
EUR 154

IMMT sgRNA CRISPR Lentivector (Human) (Target 2)

K1084603 1.0 ug DNA
EUR 154

IMMT sgRNA CRISPR Lentivector (Human) (Target 3)

K1084604 1.0 ug DNA
EUR 154

Immt sgRNA CRISPR Lentivector (Rat) (Target 1)

K7307202 1.0 ug DNA
EUR 154

Immt sgRNA CRISPR Lentivector (Rat) (Target 2)

K7307203 1.0 ug DNA
EUR 154

Immt sgRNA CRISPR Lentivector (Rat) (Target 3)

K7307204 1.0 ug DNA
EUR 154

IMMT Protein Vector (Human) (pPB-C-His)

PV021477 500 ng
EUR 329

IMMT Protein Vector (Human) (pPB-N-His)

PV021478 500 ng
EUR 329

IMMT Protein Vector (Human) (pPM-C-HA)

PV021479 500 ng
EUR 329

IMMT Protein Vector (Human) (pPM-C-His)

PV021480 500 ng
EUR 329

IMMT Protein Vector (Rat) (pPB-C-His)

PV274634 500 ng
EUR 603

IMMT Protein Vector (Rat) (pPB-N-His)

PV274635 500 ng
EUR 603

IMMT Protein Vector (Rat) (pPM-C-HA)

PV274636 500 ng
EUR 603

IMMT Protein Vector (Rat) (pPM-C-His)

PV274637 500 ng
EUR 603

IMMT Protein Vector (Mouse) (pPB-C-His)

PV191658 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPB-N-His)

PV191659 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPM-C-HA)

PV191660 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPM-C-His)

PV191661 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPB-C-His)

PV191662 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPB-N-His)

PV191663 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPM-C-HA)

PV191664 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPM-C-His)

PV191665 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPB-C-His)

PV191666 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPB-N-His)

PV191667 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPM-C-HA)

PV191668 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPM-C-His)

PV191669 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPB-C-His)

PV191670 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPB-N-His)

PV191671 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPM-C-HA)

PV191672 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPM-C-His)

PV191673 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPB-C-His)

PV191674 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPB-N-His)

PV191675 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPM-C-HA)

PV191676 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPM-C-His)

PV191677 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPB-C-His)

PV191678 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPB-N-His)

PV191679 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPM-C-HA)

PV191680 500 ng
EUR 1065

IMMT Protein Vector (Mouse) (pPM-C-His)

PV191681 500 ng
EUR 1065

Immt 3'UTR Luciferase Stable Cell Line

TU206274 1.0 ml Ask for price

Immt 3'UTR GFP Stable Cell Line

TU160100 1.0 ml Ask for price

IMMT 3'UTR Luciferase Stable Cell Line

TU011123 1.0 ml
EUR 1394

Immt 3'UTR Luciferase Stable Cell Line

TU110100 1.0 ml Ask for price

IMMT 3'UTR GFP Stable Cell Line

TU061123 1.0 ml
EUR 1394

Immt 3'UTR GFP Stable Cell Line

TU256274 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IMMT Rabbit Polyclonal Antibody