TIAM1 Rabbit Polyclonal Antibody

TIAM1 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

TIAM1 Polyclonal Antibody

ABP60682-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human TIAM1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TIAM1 from Human, Mouse. This TIAM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TIAM1 protein

TIAM1 Polyclonal Antibody

ABP60682-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TIAM1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TIAM1 from Human, Mouse. This TIAM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TIAM1 protein

TIAM1 Polyclonal Antibody

27344-100ul 100ul
EUR 252

TIAM1 Polyclonal Antibody

27344-50ul 50ul
EUR 187

TIAM1 Rabbit pAb

A10252-100ul 100 ul
EUR 308

TIAM1 Rabbit pAb

A10252-200ul 200 ul
EUR 459

TIAM1 Rabbit pAb

A10252-20ul 20 ul
EUR 183

TIAM1 Rabbit pAb

A10252-50ul 50 ul
EUR 223

TIAM1 Polyclonal Conjugated Antibody

C27344 100ul
EUR 397

TIAM1 Antibody

1-CSB-PA614387LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIAM1. Recognizes TIAM1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

Anti-TIAM1 Antibody

PB10103 100ug/vial
EUR 294

Anti-TIAM1 antibody

STJ73468 100 µg
EUR 359

Anti-TIAM1 antibody

STJ112290 100 µl
EUR 277

Anti-TIAM1 antibody

STJ192977 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TIAM1

TIAM1 siRNA

20-abx936755
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TIAM1 Antibody, HRP conjugated

1-CSB-PA614387LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIAM1. Recognizes TIAM1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TIAM1 Antibody, FITC conjugated

1-CSB-PA614387LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIAM1. Recognizes TIAM1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TIAM1 Antibody, Biotin conjugated

1-CSB-PA614387LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIAM1. Recognizes TIAM1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

TIAM1 cloning plasmid

CSB-CL614387HU-10ug 10ug
EUR 1858
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 4776
  • Sequence: atgggaaacgcagaaagtcaacatgtagagcacgagttttatggagaaaagcatgccagcctggggcgcaagcacacttcccgctccctgcgcctctcgcacaagacgcggaggaccaggcacgcttcctcggggaaggtgatccacaggaactccgaagtgagcacccgatcca
  • Show more
Description: A cloning plasmid for the TIAM1 gene.

Mouse Tiam1 ELISA KIT

ELI-16271m 96 Tests
EUR 865

Human TIAM1 ELISA KIT

ELI-52047h 96 Tests
EUR 824

Human TIAM1 shRNA Plasmid

20-abx954843
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Tiam1 ORF Vector (Mouse) (pORF)

ORF059565 1.0 ug DNA
EUR 1572

Tiam1 ORF Vector (Mouse) (pORF)

ORF059566 1.0 ug DNA
EUR 506

Tiam1 ORF Vector (Mouse) (pORF)

ORF059567 1.0 ug DNA
EUR 1572

Tiam1 ORF Vector (Rat) (pORF)

ORF077704 1.0 ug DNA
EUR 2080

TIAM1 ORF Vector (Human) (pORF)

ORF014713 1.0 ug DNA
EUR 354

TIAM1 sgRNA CRISPR Lentivector set (Human)

K2372801 3 x 1.0 ug
EUR 339

Tiam1 sgRNA CRISPR Lentivector set (Mouse)

K3772601 3 x 1.0 ug
EUR 339

Tiam1 sgRNA CRISPR Lentivector set (Rat)

K6559201 3 x 1.0 ug
EUR 339

Active Rac-GEF Assay Kit (Tiam1)

STA-422 20 assays
EUR 867
Description: Guanine nucleotide exchange factors (GEFs) activate the small GTPases by catalyzing the exchange of GDP for GTP. Our Active Rac-GEF Assay Kit employs the visible agarose bead technology used in our Small GTPase Activation Assays to pull down the active form of Rac-GEF from endogenous lysates or purified samples. The specific GEF known as Tiam1 is then specifically detected with a polyclonal antibody.

T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Polyclonal Antibody (Human)

4-PAC778Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TIAM1 (Asp1261~Lys1397)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1)

TIAM1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2372802 1.0 ug DNA
EUR 154

TIAM1 sgRNA CRISPR Lentivector (Human) (Target 2)

K2372803 1.0 ug DNA
EUR 154

TIAM1 sgRNA CRISPR Lentivector (Human) (Target 3)

K2372804 1.0 ug DNA
EUR 154

Tiam1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3772602 1.0 ug DNA
EUR 154

Tiam1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3772603 1.0 ug DNA
EUR 154

Tiam1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3772604 1.0 ug DNA
EUR 154

Tiam1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6559202 1.0 ug DNA
EUR 154

Tiam1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6559203 1.0 ug DNA
EUR 154

Tiam1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6559204 1.0 ug DNA
EUR 154

TIAM1 Protein Vector (Human) (pPB-C-His)

PV058849 500 ng
EUR 481

TIAM1 Protein Vector (Human) (pPB-N-His)

PV058850 500 ng
EUR 481

TIAM1 Protein Vector (Human) (pPM-C-HA)

PV058851 500 ng
EUR 481

TIAM1 Protein Vector (Human) (pPM-C-His)

PV058852 500 ng
EUR 481

TIAM1 Protein Vector (Rat) (pPB-C-His)

PV310814 500 ng
EUR 2675

TIAM1 Protein Vector (Rat) (pPB-N-His)

PV310815 500 ng
EUR 2675

TIAM1 Protein Vector (Rat) (pPM-C-HA)

PV310816 500 ng
EUR 2675

TIAM1 Protein Vector (Rat) (pPM-C-His)

PV310817 500 ng
EUR 2675

TIAM1 Protein Vector (Mouse) (pPB-C-His)

PV238258 500 ng
EUR 2676

TIAM1 Protein Vector (Mouse) (pPB-N-His)

PV238259 500 ng
EUR 2676

TIAM1 Protein Vector (Mouse) (pPM-C-HA)

PV238260 500 ng
EUR 2676

TIAM1 Protein Vector (Mouse) (pPM-C-His)

PV238261 500 ng
EUR 2676

TIAM1 Protein Vector (Mouse) (pPB-C-His)

PV238262 500 ng
EUR 603

TIAM1 Protein Vector (Mouse) (pPB-N-His)

PV238263 500 ng
EUR 603

TIAM1 Protein Vector (Mouse) (pPM-C-HA)

PV238264 500 ng
EUR 603

TIAM1 Protein Vector (Mouse) (pPM-C-His)

PV238265 500 ng
EUR 603

TIAM1 Protein Vector (Mouse) (pPB-C-His)

PV238266 500 ng
EUR 2676

TIAM1 Protein Vector (Mouse) (pPB-N-His)

PV238267 500 ng
EUR 2676

TIAM1 Protein Vector (Mouse) (pPM-C-HA)

PV238268 500 ng
EUR 2676

TIAM1 Protein Vector (Mouse) (pPM-C-His)

PV238269 500 ng
EUR 2676

Tiam1 3'UTR GFP Stable Cell Line

TU170482 1.0 ml Ask for price

TIAM1 3'UTR GFP Stable Cell Line

TU075569 1.0 ml
EUR 2333

Tiam1 3'UTR Luciferase Stable Cell Line

TU120482 1.0 ml Ask for price

TIAM1 3'UTR Luciferase Stable Cell Line

TU025569 1.0 ml
EUR 2333

Tiam1 3'UTR Luciferase Stable Cell Line

TU221882 1.0 ml Ask for price

Tiam1 3'UTR GFP Stable Cell Line

TU271882 1.0 ml Ask for price

T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Polyclonal Antibody (Human), APC

4-PAC778Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TIAM1 (Asp1261~Lys1397)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1). This antibody is labeled with APC.

T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Polyclonal Antibody (Human), Biotinylated

4-PAC778Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TIAM1 (Asp1261~Lys1397)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1). This antibody is labeled with Biotin.

T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Polyclonal Antibody (Human), Cy3

4-PAC778Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TIAM1 (Asp1261~Lys1397)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1). This antibody is labeled with Cy3.

T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Polyclonal Antibody (Human), FITC

4-PAC778Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TIAM1 (Asp1261~Lys1397)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1). This antibody is labeled with FITC.

T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Polyclonal Antibody (Human), HRP

4-PAC778Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TIAM1 (Asp1261~Lys1397)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1). This antibody is labeled with HRP.

T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Polyclonal Antibody (Human), PE

4-PAC778Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TIAM1 (Asp1261~Lys1397)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1). This antibody is labeled with PE.

T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Polyclonal Antibody (Human), APC-Cy7

4-PAC778Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TIAM1 (Asp1261~Lys1397)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1). This antibody is labeled with APC-Cy7.

T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Antibody

20-abx126703
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Antibody

20-abx130499
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Antibody

abx031302-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Antibody

abx031302-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Antibody

20-abx313325
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Antibody

abx433488-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

TIAM1 Rabbit Polyclonal Antibody