TIAM1 Rabbit Polyclonal Antibody

TIAM1 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

TIAM1 Polyclonal Antibody

ABP60682-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human TIAM1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TIAM1 from Human, Mouse. This TIAM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TIAM1 protein

TIAM1 Polyclonal Antibody

ABP60682-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TIAM1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TIAM1 from Human, Mouse. This TIAM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TIAM1 protein

TIAM1 Polyclonal Antibody

ES11819-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TIAM1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

TIAM1 Polyclonal Antibody

ES11819-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TIAM1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

TIAM1 Rabbit pAb

A10252-100ul 100 ul
EUR 308

TIAM1 Rabbit pAb

A10252-200ul 200 ul
EUR 459

TIAM1 Rabbit pAb

A10252-20ul 20 ul
EUR 183

TIAM1 Rabbit pAb

A10252-50ul 50 ul
EUR 223

TIAM1 Polyclonal Conjugated Antibody

C27344 100ul
EUR 397

TIAM1 Antibody

1-CSB-PA614387LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIAM1. Recognizes TIAM1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

Anti-TIAM1 Antibody

PB10103 100ug/vial
EUR 294

Anti-TIAM1 antibody

STJ112290 100 µl
EUR 277

Anti-TIAM1 antibody

STJ73468 100 µg
EUR 359

Anti-TIAM1 antibody

STJ192977 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TIAM1

TIAM1 siRNA

20-abx936755
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TIAM1 Antibody, HRP conjugated

1-CSB-PA614387LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIAM1. Recognizes TIAM1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TIAM1 Antibody, FITC conjugated

1-CSB-PA614387LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIAM1. Recognizes TIAM1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TIAM1 Antibody, Biotin conjugated

1-CSB-PA614387LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIAM1. Recognizes TIAM1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

TIAM1 cloning plasmid

CSB-CL614387HU-10ug 10ug
EUR 1858
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 4776
  • Sequence: atgggaaacgcagaaagtcaacatgtagagcacgagttttatggagaaaagcatgccagcctggggcgcaagcacacttcccgctccctgcgcctctcgcacaagacgcggaggaccaggcacgcttcctcggggaaggtgatccacaggaactccgaagtgagcacccgatcca
  • Show more
Description: A cloning plasmid for the TIAM1 gene.

Mouse Tiam1 ELISA KIT

ELI-16271m 96 Tests
EUR 865

Human TIAM1 ELISA KIT

ELI-52047h 96 Tests
EUR 824

Human TIAM1 shRNA Plasmid

20-abx954843
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Tiam1 ORF Vector (Rat) (pORF)

ORF077704 1.0 ug DNA
EUR 2080

TIAM1 ORF Vector (Human) (pORF)

ORF014713 1.0 ug DNA
EUR 354

Tiam1 ORF Vector (Mouse) (pORF)

ORF059565 1.0 ug DNA
EUR 1572

Tiam1 ORF Vector (Mouse) (pORF)

ORF059566 1.0 ug DNA
EUR 506

Tiam1 ORF Vector (Mouse) (pORF)

ORF059567 1.0 ug DNA
EUR 1572

Tiam1 sgRNA CRISPR Lentivector set (Rat)

K6559201 3 x 1.0 ug
EUR 339

Tiam1 sgRNA CRISPR Lentivector set (Mouse)

K3772601 3 x 1.0 ug
EUR 339

TIAM1 sgRNA CRISPR Lentivector set (Human)

K2372801 3 x 1.0 ug
EUR 339

Active Rac-GEF Assay Kit (Tiam1)

STA-422 20 assays
EUR 867
Description: Guanine nucleotide exchange factors (GEFs) activate the small GTPases by catalyzing the exchange of GDP for GTP. Our Active Rac-GEF Assay Kit employs the visible agarose bead technology used in our Small GTPase Activation Assays to pull down the active form of Rac-GEF from endogenous lysates or purified samples. The specific GEF known as Tiam1 is then specifically detected with a polyclonal antibody.

T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Polyclonal Antibody (Human)

4-PAC778Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TIAM1 (Asp1261~Lys1397)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1)

Tiam1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6559202 1.0 ug DNA
EUR 154

Tiam1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6559203 1.0 ug DNA
EUR 154

Tiam1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6559204 1.0 ug DNA
EUR 154

Tiam1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3772602 1.0 ug DNA
EUR 154

Tiam1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3772603 1.0 ug DNA
EUR 154

Tiam1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3772604 1.0 ug DNA
EUR 154

TIAM1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2372802 1.0 ug DNA
EUR 154

TIAM1 sgRNA CRISPR Lentivector (Human) (Target 2)

K2372803 1.0 ug DNA
EUR 154

TIAM1 sgRNA CRISPR Lentivector (Human) (Target 3)

K2372804 1.0 ug DNA
EUR 154

TIAM1 Protein Vector (Rat) (pPB-C-His)

PV310814 500 ng
EUR 2675

TIAM1 Protein Vector (Rat) (pPB-N-His)

PV310815 500 ng
EUR 2675

TIAM1 Protein Vector (Rat) (pPM-C-HA)

PV310816 500 ng
EUR 2675

TIAM1 Protein Vector (Rat) (pPM-C-His)

PV310817 500 ng
EUR 2675

TIAM1 Protein Vector (Human) (pPB-C-His)

PV058849 500 ng
EUR 481

TIAM1 Protein Vector (Human) (pPB-N-His)

PV058850 500 ng
EUR 481

TIAM1 Protein Vector (Human) (pPM-C-HA)

PV058851 500 ng
EUR 481

TIAM1 Protein Vector (Human) (pPM-C-His)

PV058852 500 ng
EUR 481

TIAM1 Protein Vector (Mouse) (pPB-C-His)

PV238258 500 ng
EUR 2676

TIAM1 Protein Vector (Mouse) (pPB-N-His)

PV238259 500 ng
EUR 2676

TIAM1 Protein Vector (Mouse) (pPM-C-HA)

PV238260 500 ng
EUR 2676

TIAM1 Protein Vector (Mouse) (pPM-C-His)

PV238261 500 ng
EUR 2676

TIAM1 Protein Vector (Mouse) (pPB-C-His)

PV238262 500 ng
EUR 603

TIAM1 Protein Vector (Mouse) (pPB-N-His)

PV238263 500 ng
EUR 603

TIAM1 Protein Vector (Mouse) (pPM-C-HA)

PV238264 500 ng
EUR 603

TIAM1 Protein Vector (Mouse) (pPM-C-His)

PV238265 500 ng
EUR 603

TIAM1 Protein Vector (Mouse) (pPB-C-His)

PV238266 500 ng
EUR 2676

TIAM1 Protein Vector (Mouse) (pPB-N-His)

PV238267 500 ng
EUR 2676

TIAM1 Protein Vector (Mouse) (pPM-C-HA)

PV238268 500 ng
EUR 2676

TIAM1 Protein Vector (Mouse) (pPM-C-His)

PV238269 500 ng
EUR 2676

Tiam1 3'UTR Luciferase Stable Cell Line

TU120482 1.0 ml Ask for price

Tiam1 3'UTR GFP Stable Cell Line

TU170482 1.0 ml Ask for price

Tiam1 3'UTR Luciferase Stable Cell Line

TU221882 1.0 ml Ask for price

TIAM1 3'UTR GFP Stable Cell Line

TU075569 1.0 ml
EUR 2333

Tiam1 3'UTR GFP Stable Cell Line

TU271882 1.0 ml Ask for price

TIAM1 3'UTR Luciferase Stable Cell Line

TU025569 1.0 ml
EUR 2333

T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Polyclonal Antibody (Human), APC

4-PAC778Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TIAM1 (Asp1261~Lys1397)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1). This antibody is labeled with APC.

T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Polyclonal Antibody (Human), Biotinylated

4-PAC778Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TIAM1 (Asp1261~Lys1397)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1). This antibody is labeled with Biotin.

T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Polyclonal Antibody (Human), Cy3

4-PAC778Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TIAM1 (Asp1261~Lys1397)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1). This antibody is labeled with Cy3.

T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Polyclonal Antibody (Human), FITC

4-PAC778Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TIAM1 (Asp1261~Lys1397)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1). This antibody is labeled with FITC.

T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Polyclonal Antibody (Human), HRP

4-PAC778Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TIAM1 (Asp1261~Lys1397)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1). This antibody is labeled with HRP.

T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Polyclonal Antibody (Human), PE

4-PAC778Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TIAM1 (Asp1261~Lys1397)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1). This antibody is labeled with PE.

T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Polyclonal Antibody (Human), APC-Cy7

4-PAC778Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TIAM1 (Asp1261~Lys1397)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1). This antibody is labeled with APC-Cy7.

T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Antibody

20-abx126703
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Antibody

20-abx130499
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Antibody

abx031302-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Antibody

abx031302-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Antibody

abx433488-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Antibody

20-abx313325
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody

ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody

ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

TIAM1 Rabbit Polyclonal Antibody