TXLNA Rabbit Polyclonal Antibody

TXLNA Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

TXLNA Polyclonal Antibody

ES11788-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TXLNA from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

TXLNA Polyclonal Antibody

ES11788-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TXLNA from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Taxilin Alpha (TXLNa) ELISA Kit

DLR-TXLNa-Hu-48T 48T
EUR 498
  • Should the Human Taxilin Alpha (TXLNa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Taxilin Alpha (TXLNa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Taxilin Alpha (TXLNa) ELISA Kit

DLR-TXLNa-Hu-96T 96T
EUR 647
  • Should the Human Taxilin Alpha (TXLNa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Taxilin Alpha (TXLNa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Taxilin Alpha (TXLNa) ELISA Kit

RDR-TXLNa-Hu-48Tests 48 Tests
EUR 522

Human Taxilin Alpha (TXLNa) ELISA Kit

RDR-TXLNa-Hu-96Tests 96 Tests
EUR 724

Human Taxilin Alpha (TXLNa) ELISA Kit

RD-TXLNa-Hu-48Tests 48 Tests
EUR 500

Human Taxilin Alpha (TXLNa) ELISA Kit

RD-TXLNa-Hu-96Tests 96 Tests
EUR 692

TXLNA Rabbit pAb

A18291-100ul 100 ul
EUR 308

TXLNA Rabbit pAb

A18291-200ul 200 ul
EUR 459

TXLNA Rabbit pAb

A18291-20ul 20 ul
EUR 183

TXLNA Rabbit pAb

A18291-50ul 50 ul
EUR 223

Rabbit TXLNa ELISA Kit

ERTT0382 96Tests
EUR 521

TXLNA Antibody

36551-100ul 100ul
EUR 252

TXLNA Antibody

1-CSB-PA843964
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TXLNA. Recognizes TXLNA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

TXLNA Antibody

1-CSB-PA234430
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TXLNA. Recognizes TXLNA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

TXLNA antibody

70R-35826 100 ug
EUR 349
Description: Rabbit polyclonal TXLNA antibody

Polyclonal TXLNA Antibody - C-terminal region

APR01617G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TXLNA - C-terminal region. This antibody is tested and proven to work in the following applications:

Polyclonal TXLNA Antibody - N-terminal region

APR01618G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TXLNA - N-terminal region. This antibody is tested and proven to work in the following applications:

Taxilin Alpha (TXLNa) Polyclonal Antibody (Human)

4-PAB182Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TXLNa (Lys328~Glu531)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Taxilin Alpha (TXLNa)

[KO Validated] TXLNA Rabbit pAb

A19889-100ul 100 ul
EUR 410

[KO Validated] TXLNA Rabbit pAb

A19889-200ul 200 ul
EUR 571

[KO Validated] TXLNA Rabbit pAb

A19889-20ul 20 ul
EUR 221

[KO Validated] TXLNA Rabbit pAb

A19889-50ul 50 ul
EUR 287

TXLNA Conjugated Antibody

C36551 100ul
EUR 397

Anti-TXLNA antibody

STJ11100247 100 µl
EUR 277

Anti-TXLNA antibody

STJ11100765 100 µl
EUR 413

Anti-TXLNA antibody

STJ192946 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TXLNA

Taxilin Alpha (TXLNa) Polyclonal Antibody (Human), APC

4-PAB182Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TXLNa (Lys328~Glu531)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Taxilin Alpha (TXLNa). This antibody is labeled with APC.

Taxilin Alpha (TXLNa) Polyclonal Antibody (Human), Biotinylated

4-PAB182Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TXLNa (Lys328~Glu531)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Taxilin Alpha (TXLNa). This antibody is labeled with Biotin.

Taxilin Alpha (TXLNa) Polyclonal Antibody (Human), Cy3

4-PAB182Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TXLNa (Lys328~Glu531)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Taxilin Alpha (TXLNa). This antibody is labeled with Cy3.

Taxilin Alpha (TXLNa) Polyclonal Antibody (Human), FITC

4-PAB182Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TXLNa (Lys328~Glu531)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Taxilin Alpha (TXLNa). This antibody is labeled with FITC.

Taxilin Alpha (TXLNa) Polyclonal Antibody (Human), HRP

4-PAB182Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TXLNa (Lys328~Glu531)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Taxilin Alpha (TXLNa). This antibody is labeled with HRP.

Taxilin Alpha (TXLNa) Polyclonal Antibody (Human), PE

4-PAB182Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TXLNa (Lys328~Glu531)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Taxilin Alpha (TXLNa). This antibody is labeled with PE.

Taxilin Alpha (TXLNa) Polyclonal Antibody (Mouse, Rat)

4-PAB182Mu01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TXLNa (Met1~Ala234)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Taxilin Alpha (TXLNa)

Rabbit Alpha-taxilin(TXLNA) ELISA kit

E04A2018-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Alpha-taxilin(TXLNA) ELISA kit

E04A2018-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Alpha-taxilin(TXLNA) ELISA kit

E04A2018-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Taxilin Alpha (TXLNa) ELISA Kit

abx362715-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

TXLNA siRNA

20-abx938635
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TXLNA siRNA

20-abx938636
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Taxilin Alpha (TXLNA) Antibody

20-abx213218
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Taxilin Alpha (TXLNA) Antibody

20-abx213510
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Taxilin Alpha (TXLNA) Antibody

abx037110-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Taxilin Alpha (TXLNa) Antibody

20-abx128767
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Taxilin Alpha (TXLNa) Antibody

20-abx129547
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Taxilin Alpha (TXLNa) Antibody

20-abx174724
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Taxilin Alpha (TXLNa) Polyclonal Antibody (Human), APC-Cy7

4-PAB182Hu01-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TXLNa (Lys328~Glu531)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Taxilin Alpha (TXLNa). This antibody is labeled with APC-Cy7.

Taxilin Alpha (TXLNa) Polyclonal Antibody (Mouse, Rat), APC

4-PAB182Mu01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TXLNa (Met1~Ala234)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Taxilin Alpha (TXLNa). This antibody is labeled with APC.

Taxilin Alpha (TXLNa) Polyclonal Antibody (Mouse, Rat), Biotinylated

4-PAB182Mu01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TXLNa (Met1~Ala234)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Taxilin Alpha (TXLNa). This antibody is labeled with Biotin.

Taxilin Alpha (TXLNa) Polyclonal Antibody (Mouse, Rat), Cy3

4-PAB182Mu01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TXLNa (Met1~Ala234)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Taxilin Alpha (TXLNa). This antibody is labeled with Cy3.

Taxilin Alpha (TXLNa) Polyclonal Antibody (Mouse, Rat), FITC

4-PAB182Mu01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TXLNa (Met1~Ala234)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Taxilin Alpha (TXLNa). This antibody is labeled with FITC.

Taxilin Alpha (TXLNa) Polyclonal Antibody (Mouse, Rat), HRP

4-PAB182Mu01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TXLNa (Met1~Ala234)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Taxilin Alpha (TXLNa). This antibody is labeled with HRP.

Taxilin Alpha (TXLNa) Polyclonal Antibody (Mouse, Rat), PE

4-PAB182Mu01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TXLNa (Met1~Ala234)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Taxilin Alpha (TXLNa). This antibody is labeled with PE.

TXLNA cloning plasmid

CSB-CL025363HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1641
  • Sequence: ATGAAGAACCAAGACAAAAAGAACGGGGCTGCCAAACAATCCAATCCAAAAAGCAGCCCAGGACAACCGGAAGCAGGACCCGAGGGAGCCCAGGAGCGGCCCAGCCAGGCGGCTCCTGCAGTAGAAGCAGAAGGTCCCGGCAGCAGCCAGGCTCCTCGGAAGCCGGAGGGGGCTC
  • Show more
Description: A cloning plasmid for the TXLNA gene.

TXLNA cloning plasmid

CSB-CL025363HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1641
  • Sequence: ATGAAGAACCAAGACAAAAAGAACGGGGCTGCCAAACAATCCAATCCAAAAAGCAGCCCAGGACAACCGGAAGCAGGACCCGAGGGAGCCCAGGAGCGGCCCAGCCAGGCGGCTCCTGCAGTAGAAGCAGAAGGTCCCGGCAGCAGCCAGGCTCCTCGGAAGCCGGAGGGGGCTC
  • Show more
Description: A cloning plasmid for the TXLNA gene.

Taxilin Alpha (TXLNa) Polyclonal Antibody (Mouse, Rat), APC-Cy7

4-PAB182Mu01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TXLNa (Met1~Ala234)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse, Rat Taxilin Alpha (TXLNa). This antibody is labeled with APC-Cy7.

Active Taxilin Alpha (TXLNa)

4-APB182Hu01
  • EUR 777.38
  • EUR 311.00
  • EUR 2640.16
  • EUR 946.72
  • EUR 1793.44
  • EUR 583.00
  • EUR 6450.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P40222
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.4kDa
  • Isoelectric Point: 7.8
Description: Recombinant Human Taxilin Alpha expressed in: Available from E.coli, Yeast, Baculovirus and Mammalian cells

Human TXLNA ELISA Kit

EHT0382 96Tests
EUR 521

Bovine TXLNA ELISA Kit

EBT0382 96Tests
EUR 521

Anserini TXLNa ELISA Kit

EAT0382 96Tests
EUR 521

Chicken TXLNA ELISA Kit

ECKT0382 96Tests
EUR 521

Canine TXLNA ELISA Kit

ECT0382 96Tests
EUR 521

Goat TXLNA ELISA Kit

EGTT0382 96Tests
EUR 521

Human TXLNA ELISA Kit

ELA-E9023h 96 Tests
EUR 824

TXLNA ELISA KIT|Human

EF006468 96 Tests
EUR 689

Human TXLNA shRNA Plasmid

20-abx966233
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse TXLNA shRNA Plasmid

20-abx980010
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Sheep TXLNA ELISA Kit

EST0382 96Tests
EUR 521

Porcine TXLNA ELISA Kit

EPT0382 96Tests
EUR 521

Rat TXLNA ELISA Kit

ERT0382 96Tests
EUR 521

Monkey TXLNA ELISA Kit

EMKT0382 96Tests
EUR 521

Mouse TXLNA ELISA Kit

EMT0382 96Tests
EUR 521

Recombinant Taxilin Alpha (TXLNa)

4-RPB182Hu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P40222
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.4kDa
  • Isoelectric Point: 7.8
Description: Recombinant Human Taxilin Alpha expressed in: E.coli

Recombinant Taxilin Alpha (TXLNa)

4-RPB182Mu01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q6PAM1
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 57.7kDa
  • Isoelectric Point: 6.3
Description: Recombinant Mouse Taxilin Alpha expressed in: E.coli

TXLNA Recombinant Protein (Rat)

RP235364 100 ug Ask for price

TXLNA Recombinant Protein (Human)

RP044575 100 ug Ask for price

TXLNA Recombinant Protein (Human)

RP044578 100 ug Ask for price

TXLNA Recombinant Protein (Mouse)

RP182360 100 ug Ask for price

TXLNA Recombinant Protein (Mouse)

RP182363 100 ug Ask for price

Human Taxilin Alpha (TXLNa) Protein

20-abx166674
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Taxilin Alpha (TXLNa) Protein

20-abx168348
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Guinea Pig TXLNA ELISA Kit

EGT0382 96Tests
EUR 521

Txlna ORF Vector (Rat) (pORF)

ORF078456 1.0 ug DNA
EUR 506

TXLNA ORF Vector (Human) (pORF)

ORF014859 1.0 ug DNA
EUR 354

TXLNA ORF Vector (Human) (pORF)

ORF014860 1.0 ug DNA
EUR 354

Txlna ORF Vector (Mouse) (pORF)

ORF060788 1.0 ug DNA
EUR 506

Txlna ORF Vector (Mouse) (pORF)

ORF060789 1.0 ug DNA
EUR 506

TXLNA ELISA Kit (Human) (OKCD07192)

OKCD07192 96 Wells
EUR 936
Description: Description of target: TXLNA may be involved in intracellular vesicle traffic and potentially in calcium-dependent exocytosis in neuroendocrine cells.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 5.6pg/mL

TXLNA ELISA Kit (Mouse) (OKCD07193)

OKCD07193 96 Wells
EUR 1001
Description: Description of target: May be involved in intracellular vesicle traffic and potentially in calcium-dependent exocytosis in neuroendocrine cells.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 5.6pg/mL

TXLNA ELISA Kit (Human) (OKEH01894)

OKEH01894 96 Wells
EUR 727
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.065 ng/mL

TXLNA ELISA Kit (Mouse) (OKEH03566)

OKEH03566 96 Wells
EUR 727
Description: Description of target: May be involved in intracellular vesicle traffic and potentially in calcium-dependent exocytosis in neuroendocrine cells.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.081 ng/mL

TXLNA ELISA Kit (Mouse) (OKEI00566)

OKEI00566 96 Wells
EUR 767
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL

TXLNA ELISA Kit (Rat) (OKEI00851)

OKEI00851 96 Wells
EUR 767
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL

Human Alpha-taxilin(TXLNA) ELISA kit

E01A2018-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Alpha-taxilin(TXLNA) ELISA kit

E01A2018-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Alpha-taxilin(TXLNA) ELISA kit

E01A2018-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Alpha-taxilin(TXLNA) ELISA kit

E03A2018-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Alpha-taxilin(TXLNA) ELISA kit

E03A2018-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Alpha-taxilin(TXLNA) ELISA kit

E03A2018-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Alpha-taxilin(TXLNA) ELISA kit

E06A2018-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Alpha-taxilin(TXLNA) ELISA kit

E06A2018-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Alpha-taxilin(TXLNA) ELISA kit

E06A2018-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Alpha-taxilin(TXLNA) ELISA kit

E02A2018-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Alpha-taxilin(TXLNA) ELISA kit

E02A2018-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

TXLNA Rabbit Polyclonal Antibody