DDX5 Rabbit Polyclonal Antibody
To Order Now: info@poweratlas.org
DDX5 Polyclonal Antibody |
ES11761-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against DDX5. This antibody is tested and validated for WB, ELISA, WB, ELISA |
DDX5 Polyclonal Antibody |
ES11761-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against DDX5. This antibody is tested and validated for WB, ELISA, WB, ELISA |
DDX5 Rabbit mAb |
A11339-100ul |
Abclonal |
100 ul |
EUR 410 |
DDX5 Rabbit mAb |
A11339-200ul |
Abclonal |
200 ul |
EUR 571 |
DDX5 Rabbit mAb |
A11339-20ul |
Abclonal |
20 ul |
EUR 221 |
DDX5 Rabbit mAb |
A11339-50ul |
Abclonal |
50 ul |
EUR 287 |
DDX5 Rabbit pAb |
A13294-100ul |
Abclonal |
100 ul |
EUR 308 |
DDX5 Rabbit pAb |
A13294-200ul |
Abclonal |
200 ul |
EUR 459 |
DDX5 Rabbit pAb |
A13294-20ul |
Abclonal |
20 ul |
EUR 183 |
DDX5 Rabbit pAb |
A13294-50ul |
Abclonal |
50 ul |
EUR 223 |
DDX5 Rabbit pAb |
A5296-100ul |
Abclonal |
100 ul |
EUR 308 |
DDX5 Rabbit pAb |
A5296-200ul |
Abclonal |
200 ul |
EUR 459 |
DDX5 Rabbit pAb |
A5296-20ul |
Abclonal |
20 ul |
EUR 183 |
DDX5 Rabbit pAb |
A5296-50ul |
Abclonal |
50 ul |
EUR 223 |
Human DEAD Box Polypeptide 5 (DDX5) ELISA Kit |
DLR-DDX5-Hu-48T |
DL Develop |
48T |
EUR 554 |
- Should the Human DEAD Box Polypeptide 5 (DDX5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human DEAD Box Polypeptide 5 (DDX5) in samples from tissue homogenates or other biological fluids. |
Human DEAD Box Polypeptide 5 (DDX5) ELISA Kit |
DLR-DDX5-Hu-96T |
DL Develop |
96T |
EUR 725 |
- Should the Human DEAD Box Polypeptide 5 (DDX5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human DEAD Box Polypeptide 5 (DDX5) in samples from tissue homogenates or other biological fluids. |
Human DEAD Box Polypeptide 5 (DDX5) ELISA Kit |
RDR-DDX5-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 589 |
Human DEAD Box Polypeptide 5 (DDX5) ELISA Kit |
RDR-DDX5-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 820 |
Human DEAD Box Polypeptide 5 (DDX5) ELISA Kit |
RD-DDX5-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 563 |
Human DEAD Box Polypeptide 5 (DDX5) ELISA Kit |
RD-DDX5-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 783 |
DDX5 antibody |
70R-21510 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal DDX5 antibody |
DDX5 antibody |
70R-1382 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal DDX5 antibody |
DDX5 antibody |
70R-1398 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal DDX5 antibody |
DDX5 Antibody |
32750-100ul |
SAB |
100ul |
EUR 252 |
DDX5 antibody |
10R-1420 |
Fitzgerald |
100 ug |
EUR 512 |
Description: Mouse monoclonal DDX5 antibody |
DDX5 Antibody |
49625-100ul |
SAB |
100ul |
EUR 333 |
DDX5 Antibody |
49625-50ul |
SAB |
50ul |
EUR 239 |
DDX5 Antibody |
1-CSB-PA003685 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against DDX5. Recognizes DDX5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/20000 |
DDX5 Antibody |
DF7258 |
Affbiotech |
200ul |
EUR 304 |
Description: DDX5 Antibody detects endogenous levels of total DDX5. |
DDX5 Antibody |
DF7539 |
Affbiotech |
200ul |
EUR 304 |
Description: DDX5 Antibody detects endogenous levels of total DDX5. |
DDX5 Antibody |
1-CSB-PA006630ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against DDX5. Recognizes DDX5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200 |
DDX5 Antibody |
1-CSB-PA006630GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against DDX5. Recognizes DDX5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA |
DDX5 antibody |
70R-33555 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal DDX5 antibody |
Rabbit Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit |
E04P0780-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit |
E04P0780-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit |
E04P0780-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Anti-DDX5 Antibody |
A00670 |
BosterBio |
100ug/vial |
EUR 334 |
DDX5 antibody (Tyr593) |
70R-33554 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal DDX5 antibody (Tyr593) |
DDX5 (pY593) Antibody |
20-abx133132 |
Abbexa |
-
EUR 314.00
-
EUR 467.00
-
EUR 203.00
|
|
- Shipped within 5-10 working days.
|
DDX5 Conjugated Antibody |
C49625 |
SAB |
100ul |
EUR 397 |
DDX5 Conjugated Antibody |
C32750 |
SAB |
100ul |
EUR 397 |
DDX5,p68 Antibody |
abx232312-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Anti-DDX5 Antibody |
PA1964 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-DDX5 antibody |
STJ27249 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a RNA-dependent ATPase, and also a proliferation-associated nuclear antigen, specifically reacting with the simian virus 40 tumor antigen. Alternative splicing results in multiple transcript variants. |
Anti-DDX5 antibody |
STJ115258 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a RNA-dependent ATPase, and also a proliferation-associated nuclear antigen, specifically reacting with the simian virus 40 tumor antigen. Alternative splicing results in multiple transcript variants. |
Anti-DDX5 antibody |
STJ192919 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to DDX5 |
DDX5 siRNA |
20-abx913835 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-DDX5 |
YF-PA11326 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to DDX5 |
Phospho-DDX5 (Y593) Antibody |
1-CSB-PA007714 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against Phospho-DDX5 (Y593). Recognizes Phospho-DDX5 (Y593) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000 |
DDX5 recombinant monoclonal antibody |
A5921 |
Bimake |
100ul X 3 |
EUR 595 |
- Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
- Show more
|
Description: A recombinant monoclonal antibody from rabbit against human DDX5 for WB, IHC, IF,ELISA |
anti- DDX5,p68 antibody |
FNab02312 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500-1:1000
- IHC: 1:20-1:200
- Immunogen: DEAD(Asp-Glu-Ala-Asp) box polypeptide 5
- Uniprot ID: P17844
- Research Area: Neuroscience, Metabolism, Developmental biology
|
Description: Antibody raised against DDX5,p68 |
Anti-DDX5 Monoclonal Antibody |
M00670 |
BosterBio |
100ug |
EUR 397 |
Description: Rabbit Monoclonal DDX5 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat. |
Human Probable ATP-dependent RNA helicase DDX5 (DDX5) |
1-CSB-EP006630HU |
Cusabio |
-
EUR 437.00
-
EUR 238.00
-
EUR 1544.00
-
EUR 653.00
-
EUR 1029.00
-
EUR 296.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 74.1 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Probable ATP-dependent RNA helicase DDX5(DDX5) expressed in E.coli |
DDX5 Blocking Peptide |
33R-7933 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DDX5 antibody, catalog no. 70R-1398 |
DDX5 Blocking Peptide |
33R-8427 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DDX5 antibody, catalog no. 70R-1382 |
DDX5 Blocking Peptide |
DF7258-BP |
Affbiotech |
1mg |
EUR 195 |
DDX5 Blocking Peptide |
DF7539-BP |
Affbiotech |
1mg |
EUR 195 |
DDX5 Blocking Peptide |
20-abx162388 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DDX5 cloning plasmid |
CSB-CL006630HU-10ug |
Cusabio |
10ug |
EUR 626 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1845
- Sequence: atgtcgggttattcgagtgaccgagaccgcggccgggaccgagggtttggtgcacctcgatttggaggaagtagggcagggcccttatctggaaagaagtttggaaaccctggggagaaattagttaaaaagaagtggaatcttgatgagctgcctaaatttgagaagaattttt
- Show more
|
Description: A cloning plasmid for the DDX5 gene. |
Recombinant human DDX5 |
P1933 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: P17844
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
Description: Recombinant protein for human DDX5 |
Rat Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit |
E02P0780-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit |
E02P0780-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit |
E02P0780-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit |
E03P0780-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit |
E03P0780-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit |
E03P0780-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit |
E01P0780-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit |
E01P0780-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit |
E01P0780-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit |
E06P0780-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit |
E06P0780-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit |
E06P0780-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit |
E08P0780-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit |
E08P0780-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit |
E08P0780-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
DDX5 Rabbit Polyclonal Antibody