DDX5 Rabbit Polyclonal Antibody

DDX5 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

DDX5 Polyclonal Antibody
ES11761-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against DDX5. This antibody is tested and validated for WB, ELISA, WB, ELISA

DDX5 Polyclonal Antibody
ES11761-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against DDX5. This antibody is tested and validated for WB, ELISA, WB, ELISA

DDX5 Rabbit mAb
A11339-100ul	Abclonal	100 ul	EUR 410

DDX5 Rabbit mAb
A11339-200ul	Abclonal	200 ul	EUR 571

DDX5 Rabbit mAb
A11339-20ul	Abclonal	20 ul	EUR 221

DDX5 Rabbit mAb
A11339-50ul	Abclonal	50 ul	EUR 287

DDX5 Rabbit pAb
A13294-100ul	Abclonal	100 ul	EUR 308

DDX5 Rabbit pAb
A13294-200ul	Abclonal	200 ul	EUR 459

DDX5 Rabbit pAb
A13294-20ul	Abclonal	20 ul	EUR 183

DDX5 Rabbit pAb
A13294-50ul	Abclonal	50 ul	EUR 223

DDX5 Rabbit pAb
A5296-100ul	Abclonal	100 ul	EUR 308

DDX5 Rabbit pAb
A5296-200ul	Abclonal	200 ul	EUR 459

DDX5 Rabbit pAb
A5296-20ul	Abclonal	20 ul	EUR 183

DDX5 Rabbit pAb
A5296-50ul	Abclonal	50 ul	EUR 223

Human DEAD Box Polypeptide 5 (DDX5) ELISA Kit
DLR-DDX5-Hu-48T	DL Develop	48T	EUR 554
Should the Human DEAD Box Polypeptide 5 (DDX5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human DEAD Box Polypeptide 5 (DDX5) in samples from tissue homogenates or other biological fluids.

Human DEAD Box Polypeptide 5 (DDX5) ELISA Kit
DLR-DDX5-Hu-96T	DL Develop	96T	EUR 725
Should the Human DEAD Box Polypeptide 5 (DDX5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human DEAD Box Polypeptide 5 (DDX5) in samples from tissue homogenates or other biological fluids.

Human DEAD Box Polypeptide 5 (DDX5) ELISA Kit
RDR-DDX5-Hu-48Tests	Reddot Biotech	48 Tests	EUR 589

Human DEAD Box Polypeptide 5 (DDX5) ELISA Kit
RDR-DDX5-Hu-96Tests	Reddot Biotech	96 Tests	EUR 820

Human DEAD Box Polypeptide 5 (DDX5) ELISA Kit
RD-DDX5-Hu-48Tests	Reddot Biotech	48 Tests	EUR 563

Human DEAD Box Polypeptide 5 (DDX5) ELISA Kit
RD-DDX5-Hu-96Tests	Reddot Biotech	96 Tests	EUR 783

DDX5 antibody
70R-21510	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal DDX5 antibody

DDX5 antibody
70R-1382	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal DDX5 antibody

DDX5 antibody
70R-1398	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal DDX5 antibody

DDX5 Antibody
32750-100ul	SAB	100ul	EUR 252

DDX5 antibody
10R-1420	Fitzgerald	100 ug	EUR 512
Description: Mouse monoclonal DDX5 antibody

DDX5 Antibody
49625-100ul	SAB	100ul	EUR 333

DDX5 Antibody
49625-50ul	SAB	50ul	EUR 239

DDX5 Antibody
1-CSB-PA003685	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against DDX5. Recognizes DDX5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/20000

DDX5 Antibody
DF7258	Affbiotech	200ul	EUR 304
Description: DDX5 Antibody detects endogenous levels of total DDX5.

DDX5 Antibody
DF7539	Affbiotech	200ul	EUR 304
Description: DDX5 Antibody detects endogenous levels of total DDX5.

DDX5 Antibody
1-CSB-PA006630ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against DDX5. Recognizes DDX5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

DDX5 Antibody
1-CSB-PA006630GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DDX5. Recognizes DDX5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA

DDX5 antibody
70R-33555	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal DDX5 antibody

DDX5 Antibody
ABD7258	Lifescience Market	100 ug	EUR 438

DDX5 Antibody
ABD7539	Lifescience Market	100 ug	EUR 438

Rabbit Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit
E04P0780-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit
E04P0780-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit
E04P0780-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Anti-DDX5 Antibody
A00670	BosterBio	100ug/vial	EUR 334

DDX5 antibody (Tyr593)
70R-33554	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal DDX5 antibody (Tyr593)

DDX5 (pY593) Antibody
20-abx133132	Abbexa	EUR 314.00 EUR 467.00 EUR 203.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

DDX5 Conjugated Antibody
C49625	SAB	100ul	EUR 397

DDX5 Conjugated Antibody
C32750	SAB	100ul	EUR 397

DDX5,p68 Antibody
abx232312-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Anti-DDX5 Antibody
PA1964	BosterBio	100ug/vial	EUR 334

Anti-DDX5 antibody
STJ27249	St John's Laboratory	100 µl	EUR 277
Description: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a RNA-dependent ATPase, and also a proliferation-associated nuclear antigen, specifically reacting with the simian virus 40 tumor antigen. Alternative splicing results in multiple transcript variants.

Anti-DDX5 antibody
STJ115258	St John's Laboratory	100 µl	EUR 277
Description: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a RNA-dependent ATPase, and also a proliferation-associated nuclear antigen, specifically reacting with the simian virus 40 tumor antigen. Alternative splicing results in multiple transcript variants.

Anti-DDX5 antibody
STJ192919	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to DDX5

DDX5 siRNA
20-abx913835	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-DDX5
YF-PA11326	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to DDX5

Phospho-DDX5 (Y593) Antibody
1-CSB-PA007714	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-DDX5 (Y593). Recognizes Phospho-DDX5 (Y593) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

DDX5 recombinant monoclonal antibody
A5921	Bimake	100ul X 3	EUR 595
Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however, Show more
Description: A recombinant monoclonal antibody from rabbit against human DDX5 for WB, IHC, IF,ELISA

anti- DDX5,p68 antibody
FNab02312	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:1000 IHC: 1:20-1:200 Immunogen: DEAD(Asp-Glu-Ala-Asp) box polypeptide 5 Uniprot ID: P17844 Research Area: Neuroscience, Metabolism, Developmental biology
Description: Antibody raised against DDX5,p68

Anti-DDX5 Monoclonal Antibody
M00670	BosterBio	100ug	EUR 397
Description: Rabbit Monoclonal DDX5 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

Anti-DDX5,p68 antibody
PAab02312	Lifescience Market	100 ug	EUR 355

Human Probable ATP-dependent RNA helicase DDX5 (DDX5)
1-CSB-EP006630HU	Cusabio	EUR 437.00 EUR 238.00 EUR 1544.00 EUR 653.00 EUR 1029.00 EUR 296.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 74.1 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Probable ATP-dependent RNA helicase DDX5(DDX5) expressed in E.coli

DDX5 Blocking Peptide
33R-7933	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DDX5 antibody, catalog no. 70R-1398

DDX5 Blocking Peptide
33R-8427	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DDX5 antibody, catalog no. 70R-1382

DDX5 Blocking Peptide
DF7258-BP	Affbiotech	1mg	EUR 195

DDX5 Blocking Peptide
DF7539-BP	Affbiotech	1mg	EUR 195

DDX5 Blocking Peptide
20-abx162388	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

DDX5 cloning plasmid
CSB-CL006630HU-10ug	Cusabio	10ug	EUR 626
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1845 Sequence: atgtcgggttattcgagtgaccgagaccgcggccgggaccgagggtttggtgcacctcgatttggaggaagtagggcagggcccttatctggaaagaagtttggaaaccctggggagaaattagttaaaaagaagtggaatcttgatgagctgcctaaatttgagaagaattttt Show more
Description: A cloning plasmid for the DDX5 gene.

Recombinant human DDX5
P1933	FN Test	100ug	Ask for price
Uniprot ID: P17844 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human DDX5

Rat Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit
E02P0780-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit
E02P0780-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit
E02P0780-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit
E03P0780-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit
E03P0780-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit
E03P0780-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit
E01P0780-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit
E01P0780-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit
E01P0780-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit
E06P0780-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit
E06P0780-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit
E06P0780-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit
E08P0780-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit
E08P0780-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Probable ATP dependent RNA helicase DDX5(DDX5) ELISA kit
E08P0780-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Probable ATP dependent RNA helicase DDX5(DDX5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

DDX5 Rabbit Polyclonal Antibody