PMVK Rabbit Polyclonal Antibody

PMVK Rabbit Polyclonal Antibody

To Order Now:

PMVK Polyclonal Antibody

ABP59958-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PMVK protein
  • Applications tips:
Description: A polyclonal antibody for detection of PMVK from Human. This PMVK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PMVK protein

PMVK Polyclonal Antibody

ABP59958-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PMVK protein
  • Applications tips:
Description: A polyclonal antibody for detection of PMVK from Human. This PMVK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PMVK protein

PMVK Polyclonal Antibody

28386-100ul 100ul
EUR 252

PMVK Polyclonal Antibody

28386-50ul 50ul
EUR 187

PMVK Polyclonal Antibody

28387-100ul 100ul
EUR 252

PMVK Polyclonal Antibody

28387-50ul 50ul
EUR 187

PMVK Rabbit pAb

A13865-100ul 100 ul
EUR 308

PMVK Rabbit pAb

A13865-200ul 200 ul
EUR 459

PMVK Rabbit pAb

A13865-20ul 20 ul
EUR 183

PMVK Rabbit pAb

A13865-50ul 50 ul
EUR 223

PMVK Rabbit pAb

A13866-100ul 100 ul
EUR 308

PMVK Rabbit pAb

A13866-200ul 200 ul
EUR 459

PMVK Rabbit pAb

A13866-20ul 20 ul
EUR 183

PMVK Rabbit pAb

A13866-50ul 50 ul
EUR 223

PMVK Polyclonal Conjugated Antibody

C28386 100ul
EUR 397

PMVK Polyclonal Conjugated Antibody

C28387 100ul
EUR 397

PMVK Antibody

39840-100ul 100ul
EUR 390

PMVK antibody

10R-5327 100 ul
EUR 691
Description: Mouse monoclonal PMVK antibody

PMVK antibody

70R-19373 50 ul
EUR 435
Description: Rabbit polyclonal PMVK antibody

PMVK antibody

70R-13751 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal PMVK antibody

PMVK Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PMVK. Recognizes PMVK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

anti- PMVK antibody

FNab06580 100µg
EUR 548.75
  • Immunogen: phosphomevalonate kinase
  • Uniprot ID: Q15126
  • Gene ID: 10654
  • Research Area: Metabolism
Description: Antibody raised against PMVK

Human PMVK Antibody

33163-05111 150 ug
EUR 261

Anti-PMVK antibody

PAab06580 100 ug
EUR 386

Anti-PMVK Antibody

PA1067 100ug/vial
EUR 334

Anti-PMVK antibody

STJ192973 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PMVK

Anti-PMVK antibody

STJ115804 100 µl
EUR 277
Description: This gene encodes a peroxisomal enzyme that is a member of the galactokinase, homoserine kinase, mevalonate kinase, and phosphomevalonate kinase (GHMP) family of ATP-dependent enzymes. The encoded protein catalyzes the conversion of mevalonate 5-phosphate to mevalonate 5-diphosphate, which is the fifth step in the mevalonate pathway of isoprenoid biosynthesis. Mutations in this gene are linked to certain types of porokeratosis including disseminated superficial porokeratosis. Alternative splicing results in multiple transcript variants.

Anti-PMVK antibody

STJ115805 100 µl
EUR 277
Description: This gene encodes a peroxisomal enzyme that is a member of the galactokinase, homoserine kinase, mevalonate kinase, and phosphomevalonate kinase (GHMP) family of ATP-dependent enzymes. The encoded protein catalyzes the conversion of mevalonate 5-phosphate to mevalonate 5-diphosphate, which is the fifth step in the mevalonate pathway of isoprenoid biosynthesis. Mutations in this gene are linked to certain types of porokeratosis including disseminated superficial porokeratosis. Alternative splicing results in multiple transcript variants.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA17142 50 ul
EUR 363
Description: Mouse polyclonal to PMVK


YF-PA17143 50 ug
EUR 363
Description: Mouse polyclonal to PMVK


YF-PA17144 100 ul
EUR 403
Description: Rabbit polyclonal to PMVK


YF-PA17145 100 ug
EUR 403
Description: Rabbit polyclonal to PMVK

Rabbit Phosphomevalonate kinase(PMVK) ELISA kit

E04P0852-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Phosphomevalonate kinase(PMVK) ELISA kit

E04P0852-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Phosphomevalonate kinase(PMVK) ELISA kit

E04P0852-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Phosphomevalonate Kinase (PMVK) Antibody

abx036227-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Phosphomevalonate Kinase (PMVK) Antibody

abx236580-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

PMVK cloning plasmid

CSB-CL018258HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 579
  • Sequence: atggccccgctgggaggcgccccgcggctggtactgctgttcagcggcaagaggaaatccgggaaggacttcgtgaccgaggcgctgcagagcagacttggagctgatgtctgtgctgtcctccggctctctggtccactcaaggaacagtatgctcaggagcatggcttgaactt
  • Show more
Description: A cloning plasmid for the PMVK gene.

Anti-PMVK (2B8)

YF-MA17421 100 ug
EUR 363
Description: Mouse monoclonal to PMVK

Anti-PMVK (2B8)

YF-MA17422 200 ul
EUR 363
Description: Mouse monoclonal to PMVK

Human PMVK Antibody (Biotin Conjugate)

33163-05121 150 ug
EUR 369

Human PMVK AssayLite Antibody (FITC Conjugate)

33163-05141 150 ug
EUR 428

Human PMVK AssayLite Antibody (RPE Conjugate)

33163-05151 150 ug
EUR 428

Human PMVK AssayLite Antibody (APC Conjugate)

33163-05161 150 ug
EUR 428

Human PMVK AssayLite Antibody (PerCP Conjugate)

33163-05171 150 ug
EUR 471

Mouse PMVK shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF001891 96 Tests
EUR 689

Human PMVK shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PMVK protein (His tag)

80R-1495 100 ug
EUR 305
Description: Purified recombinant Human PMVK protein

PMVK Recombinant Protein (Human)

RP023917 100 ug Ask for price

PMVK Recombinant Protein (Rat)

RP221147 100 ug Ask for price

PMVK Recombinant Protein (Mouse)

RP163097 100 ug Ask for price

PMVK Recombinant Protein (Mouse)

RP163100 100 ug Ask for price

PMVK ORF Vector (Human) (pORF)

ORF007973 1.0 ug DNA
EUR 95

Pmvk ORF Vector (Rat) (pORF)

ORF073717 1.0 ug DNA
EUR 506

Pmvk ORF Vector (Mouse) (pORF)

ORF054367 1.0 ug DNA
EUR 506

Pmvk ORF Vector (Mouse) (pORF)

ORF054368 1.0 ug DNA
EUR 506

Rat Phosphomevalonate kinase(PMVK) ELISA kit

E02P0852-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Phosphomevalonate kinase(PMVK) ELISA kit

E02P0852-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Phosphomevalonate kinase(PMVK) ELISA kit

E02P0852-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Phosphomevalonate kinase(PMVK) ELISA kit

E03P0852-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Phosphomevalonate kinase(PMVK) ELISA kit

E03P0852-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Phosphomevalonate kinase(PMVK) ELISA kit

E03P0852-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphomevalonate kinase(PMVK) ELISA kit

E01P0852-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphomevalonate kinase(PMVK) ELISA kit

E01P0852-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphomevalonate kinase(PMVK) ELISA kit

E01P0852-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Phosphomevalonate kinase(PMVK) ELISA kit

E06P0852-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Phosphomevalonate kinase(PMVK) ELISA kit

E06P0852-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Phosphomevalonate kinase(PMVK) ELISA kit

E06P0852-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Phosphomevalonate kinase(PMVK) ELISA kit

E07P0852-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Phosphomevalonate kinase(PMVK) ELISA kit

E07P0852-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Phosphomevalonate kinase(PMVK) ELISA kit

E07P0852-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Phosphomevalonate kinase(PMVK) ELISA kit

E08P0852-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Phosphomevalonate kinase(PMVK) ELISA kit

E08P0852-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Phosphomevalonate kinase(PMVK) ELISA kit

E08P0852-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Phosphomevalonate kinase(PMVK) ELISA kit

E09P0852-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Phosphomevalonate kinase(PMVK) ELISA kit

E09P0852-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Phosphomevalonate kinase(PMVK) ELISA kit

E09P0852-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine Phosphomevalonate kinase, PMVK ELISA KIT

ELI-19695b 96 Tests
EUR 928

Human Phosphomevalonate kinase, PMVK ELISA KIT

ELI-19696h 96 Tests
EUR 824

Mouse Phosphomevalonate kinase, Pmvk ELISA KIT

ELI-21710m 96 Tests
EUR 865

Porcine Phosphomevalonate kinase, PMVK ELISA KIT

ELI-45542p 96 Tests
EUR 928

Human Phosphomevalonate kinase (PMVK) ELISA Kit

abx382319-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Phosphomevalonate kinase (PMVK) ELISA Kit

abx390228-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

PMVK sgRNA CRISPR Lentivector set (Human)

K1675701 3 x 1.0 ug
EUR 339

Pmvk sgRNA CRISPR Lentivector set (Mouse)

K3487601 3 x 1.0 ug
EUR 339

Pmvk sgRNA CRISPR Lentivector set (Rat)

K7264101 3 x 1.0 ug
EUR 339

PMVK Phosphomevalonate Kinase Human Recombinant Protein

PROTQ15126 Regular: 20ug
EUR 317
Description: PMVK Human Recombinant fused with a 20 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 212 amino acids (1-192 a.a.) and having a molecular mass of 24.1kDa. The PMVK is purified by proprietary chromatographic techniques.

Recombinant Human Phosphomevalonate Kinase/PMVK (N-6His)

C248-10ug 10ug
EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 100mM NaCl, 1mM DTT, 10% Glycerol, pH 7.5.

Recombinant Human Phosphomevalonate Kinase/PMVK (N-6His)

C248-1mg 1mg
EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 100mM NaCl, 1mM DTT, 10% Glycerol, pH 7.5.

Recombinant Human Phosphomevalonate Kinase/PMVK (N-6His)

C248-500ug 500ug
EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 100mM NaCl, 1mM DTT, 10% Glycerol, pH 7.5.

Recombinant Human Phosphomevalonate Kinase/PMVK (N-6His)

C248-50ug 50ug
EUR 496
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 100mM NaCl, 1mM DTT, 10% Glycerol, pH 7.5.

Guinea pig Phosphomevalonate kinase(PMVK) ELISA kit

E05P0852-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Phosphomevalonate kinase(PMVK) ELISA kit

E05P0852-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Phosphomevalonate kinase(PMVK) ELISA kit

E05P0852-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Phosphomevalonate kinase(PMVK) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

PMVK sgRNA CRISPR Lentivector (Human) (Target 1)

K1675702 1.0 ug DNA
EUR 154

PMVK sgRNA CRISPR Lentivector (Human) (Target 2)

K1675703 1.0 ug DNA
EUR 154

PMVK sgRNA CRISPR Lentivector (Human) (Target 3)

K1675704 1.0 ug DNA
EUR 154

Pmvk sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3487602 1.0 ug DNA
EUR 154

Pmvk sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3487603 1.0 ug DNA
EUR 154

Pmvk sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3487604 1.0 ug DNA
EUR 154

Pmvk sgRNA CRISPR Lentivector (Rat) (Target 1)

K7264102 1.0 ug DNA
EUR 154

Pmvk sgRNA CRISPR Lentivector (Rat) (Target 2)

K7264103 1.0 ug DNA
EUR 154

Pmvk sgRNA CRISPR Lentivector (Rat) (Target 3)

K7264104 1.0 ug DNA
EUR 154

ELISA kit for Bovine Phosphomevalonate kinase (PMVK)

KTE10200-48T 48T
EUR 354
  • PMVK (EC is a peroxisomal enzyme that catalyzes the conversion of mevalonate 5-phosphate into mevalonate 5-diphosphate as the fifth reaction of the cholesterol biosynthetic pathway. The deduced 192-amino acid PMVK protein has a calculated mo
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Phosphomevalonate kinase (PMVK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Phosphomevalonate kinase (PMVK)

KTE10200-5platesof96wells 5 plates of 96 wells
EUR 2252
  • PMVK (EC is a peroxisomal enzyme that catalyzes the conversion of mevalonate 5-phosphate into mevalonate 5-diphosphate as the fifth reaction of the cholesterol biosynthetic pathway. The deduced 192-amino acid PMVK protein has a calculated mo
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Phosphomevalonate kinase (PMVK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Phosphomevalonate kinase (PMVK)

KTE10200-96T 96T
EUR 572
  • PMVK (EC is a peroxisomal enzyme that catalyzes the conversion of mevalonate 5-phosphate into mevalonate 5-diphosphate as the fifth reaction of the cholesterol biosynthetic pathway. The deduced 192-amino acid PMVK protein has a calculated mo
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Phosphomevalonate kinase (PMVK) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Recombinant Human PMVK Protein, His, E.coli-1mg

QP13082-1mg 1mg
EUR 2757

Recombinant Human PMVK Protein, His, E.coli-20ug

QP13082-20ug 20ug
EUR 201

Recombinant Human PMVK Protein, His, E.coli-5ug

QP13082-5ug 5ug
EUR 155

PMVK Protein Vector (Human) (pPB-C-His)

PV031889 500 ng
EUR 329

PMVK Protein Vector (Human) (pPB-N-His)

PV031890 500 ng
EUR 329

PMVK Protein Vector (Human) (pPM-C-HA)

PV031891 500 ng
EUR 329

PMVK Protein Vector (Human) (pPM-C-His)

PV031892 500 ng
EUR 329

PMVK Protein Vector (Mouse) (pPB-C-His)

PV217466 500 ng
EUR 603

PMVK Protein Vector (Mouse) (pPB-N-His)

PV217467 500 ng
EUR 603

PMVK Protein Vector (Mouse) (pPM-C-HA)

PV217468 500 ng
EUR 603

PMVK Protein Vector (Mouse) (pPM-C-His)

PV217469 500 ng
EUR 603

PMVK Protein Vector (Mouse) (pPB-C-His)

PV217470 500 ng
EUR 603

PMVK Protein Vector (Mouse) (pPB-N-His)

PV217471 500 ng
EUR 603

PMVK Protein Vector (Mouse) (pPM-C-HA)

PV217472 500 ng
EUR 603

PMVK Protein Vector (Mouse) (pPM-C-His)

PV217473 500 ng
EUR 603

PMVK Protein Vector (Rat) (pPB-C-His)

PV294866 500 ng
EUR 603

PMVK Protein Vector (Rat) (pPB-N-His)

PV294867 500 ng
EUR 603

PMVK Protein Vector (Rat) (pPM-C-HA)

PV294868 500 ng
EUR 603

PMVK Protein Vector (Rat) (pPM-C-His)

PV294869 500 ng
EUR 603

Pmvk 3'UTR GFP Stable Cell Line

TU166609 1.0 ml Ask for price

PMVK 3'UTR Luciferase Stable Cell Line

TU018344 1.0 ml
EUR 1394

Pmvk 3'UTR Luciferase Stable Cell Line

TU116609 1.0 ml Ask for price

PMVK 3'UTR GFP Stable Cell Line

TU068344 1.0 ml
EUR 1394

PMVK Rabbit Polyclonal Antibody