SSR3 Rabbit Polyclonal Antibody

SSR3 Rabbit Polyclonal Antibody

To Order Now: info@poweratlas.org

SSR3 Polyclonal Antibody

ABP60521-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human SSR3 protein at amino acid sequence of 340-420
  • Applications tips:
Description: A polyclonal antibody for detection of SSR3 from Human. This SSR3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SSR3 protein at amino acid sequence of 340-420

SSR3 Polyclonal Antibody

ABP60521-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human SSR3 protein at amino acid sequence of 340-420
  • Applications tips:
Description: A polyclonal antibody for detection of SSR3 from Human. This SSR3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SSR3 protein at amino acid sequence of 340-420

SSR3 Polyclonal Antibody

ABP60521-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SSR3 protein at amino acid sequence of 340-420
  • Applications tips:
Description: A polyclonal antibody for detection of SSR3 from Human. This SSR3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SSR3 protein at amino acid sequence of 340-420

SSR3 Polyclonal Antibody

A61154 100 µg
EUR 570.55
Description: kits suitable for this type of research

SSR3 Polyclonal Antibody

30215-100ul 100ul
EUR 252

SSR3 Polyclonal Antibody

30215-50ul 50ul
EUR 187

SSR3 Rabbit pAb

A17873-100ul 100 ul
EUR 308

SSR3 Rabbit pAb

A17873-200ul 200 ul
EUR 459

SSR3 Rabbit pAb

A17873-20ul 20 ul
EUR 183

SSR3 Rabbit pAb

A17873-50ul 50 ul
EUR 223

SSR3 Polyclonal Conjugated Antibody

C30215 100ul
EUR 397

SSR3 antibody

70R-14333 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal SSR3 antibody

SSR3 Antibody

1-CSB-PA892358LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SSR3. Recognizes SSR3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

SSR3 Polyclonal Antibody, Biotin Conjugated

A61155 100 µg
EUR 570.55
Description: fast delivery possible

SSR3 Polyclonal Antibody, FITC Conjugated

A61156 100 µg
EUR 570.55
Description: reagents widely cited

SSR3 Polyclonal Antibody, HRP Conjugated

A61157 100 µg
EUR 570.55
Description: Ask the seller for details

Ssr3/ Rat Ssr3 ELISA Kit

ELI-52920r 96 Tests
EUR 886

Anti-SSR3 Antibody

PA1796 100ug/vial
EUR 334

Anti-SSR3 antibody

STJ119884 100 µl
EUR 277
Description: The signal sequence receptor (SSR) is a glycosylated endoplasmic reticulum (ER) membrane receptor associated with protein translocation across the ER membrane. The SSR is comprised of four membrane proteins/subunits: alpha, beta, gamma, and delta. The first two are glycosylated subunits and the latter two are non-glycosylated subunits. This gene encodes the gamma subunit, which is predicted to span the membrane four times.

Anti-SSR3 antibody

STJ192644 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SSR3

SSR3 siRNA

20-abx905293
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SSR3 siRNA

20-abx935268
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SSR3 siRNA

20-abx935269
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pENTR223- SSR3

PVT10076 2 ug
EUR 266

SSR3 Antibody, HRP conjugated

1-CSB-PA892358LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SSR3. Recognizes SSR3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SSR3 Antibody, FITC conjugated

1-CSB-PA892358LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SSR3. Recognizes SSR3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SSR3 Antibody, Biotin conjugated

1-CSB-PA892358LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SSR3. Recognizes SSR3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SSR3 cloning plasmid

CSB-CL892358HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 558
  • Sequence: atggctcctaaaggcagctccaaacagcagtctgaggaggacctgctcctgcaggatttcagccgcaatctctcggccaagtcctccgcgctcttcttcggaaacgcgttcatcgtgtctgccatccccatctggttatactggcgaatatggcatatggatcttattcagtctgc
  • Show more
Description: A cloning plasmid for the SSR3 gene.

Mouse SSR3 shRNA Plasmid

20-abx976140
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat SSR3 shRNA Plasmid

20-abx986715
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Bovine SSR3 ELISA KIT

ELI-18144b 96 Tests
EUR 928

SSR3 ELISA KIT|Human

EF005570 96 Tests
EUR 689

Human SSR3 ELISA KIT

ELI-29885h 96 Tests
EUR 824

Mouse Ssr3 ELISA KIT

ELI-29886m 96 Tests
EUR 865

Human SSR3 shRNA Plasmid

20-abx954610
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SSR3 Recombinant Protein (Human)

RP030172 100 ug Ask for price

SSR3 Recombinant Protein (Rat)

RP231188 100 ug Ask for price

SSR3 Rabbit Polyclonal Antibody