SSR3 Rabbit Polyclonal Antibody
To Order Now: info@poweratlas.org
SSR3 Polyclonal Antibody |
A61154 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
SSR3 Polyclonal Antibody |
ABP60521-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human SSR3 protein at amino acid sequence of 340-420
- Applications tips:
|
Description: A polyclonal antibody for detection of SSR3 from Human. This SSR3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SSR3 protein at amino acid sequence of 340-420 |
SSR3 Polyclonal Antibody |
ABP60521-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human SSR3 protein at amino acid sequence of 340-420
- Applications tips:
|
Description: A polyclonal antibody for detection of SSR3 from Human. This SSR3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SSR3 protein at amino acid sequence of 340-420 |
SSR3 Polyclonal Antibody |
ABP60521-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human SSR3 protein at amino acid sequence of 340-420
- Applications tips:
|
Description: A polyclonal antibody for detection of SSR3 from Human. This SSR3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SSR3 protein at amino acid sequence of 340-420 |
SSR3 Polyclonal Antibody |
ES11486-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against SSR3 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
SSR3 Polyclonal Antibody |
ES11486-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against SSR3 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
SSR3 Rabbit pAb |
A17873-100ul |
Abclonal |
100 ul |
EUR 308 |
SSR3 Rabbit pAb |
A17873-200ul |
Abclonal |
200 ul |
EUR 459 |
SSR3 Rabbit pAb |
A17873-20ul |
Abclonal |
20 ul |
EUR 183 |
SSR3 Rabbit pAb |
A17873-50ul |
Abclonal |
50 ul |
EUR 223 |
SSR3 Polyclonal Conjugated Antibody |
C30215 |
SAB |
100ul |
EUR 397 |
SSR3 antibody |
70R-14333 |
Fitzgerald |
100 ug |
EUR 322 |
Description: Affinity purified Rabbit polyclonal SSR3 antibody |
SSR3 Antibody |
1-CSB-PA892358LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SSR3. Recognizes SSR3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200 |
SSR3 Polyclonal Antibody, Biotin Conjugated |
A61155 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
SSR3 Polyclonal Antibody, FITC Conjugated |
A61156 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
SSR3 Polyclonal Antibody, HRP Conjugated |
A61157 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
Anti-SSR3 Antibody |
PA1796 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-SSR3 antibody |
STJ119884 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The signal sequence receptor (SSR) is a glycosylated endoplasmic reticulum (ER) membrane receptor associated with protein translocation across the ER membrane. The SSR is comprised of four membrane proteins/subunits: alpha, beta, gamma, and delta. The first two are glycosylated subunits and the latter two are non-glycosylated subunits. This gene encodes the gamma subunit, which is predicted to span the membrane four times. |
Anti-SSR3 antibody |
STJ192644 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to SSR3 |
SSR3 siRNA |
20-abx905293 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SSR3 siRNA |
20-abx935268 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SSR3 siRNA |
20-abx935269 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SSR3 Antibody, HRP conjugated |
1-CSB-PA892358LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SSR3. Recognizes SSR3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
SSR3 Antibody, FITC conjugated |
1-CSB-PA892358LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SSR3. Recognizes SSR3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
SSR3 Antibody, Biotin conjugated |
1-CSB-PA892358LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SSR3. Recognizes SSR3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
SSR3 cloning plasmid |
CSB-CL892358HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 558
- Sequence: atggctcctaaaggcagctccaaacagcagtctgaggaggacctgctcctgcaggatttcagccgcaatctctcggccaagtcctccgcgctcttcttcggaaacgcgttcatcgtgtctgccatccccatctggttatactggcgaatatggcatatggatcttattcagtctgc
- Show more
|
Description: A cloning plasmid for the SSR3 gene. |
Mouse SSR3 shRNA Plasmid |
20-abx976140 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat SSR3 shRNA Plasmid |
20-abx986715 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human SSR3 shRNA Plasmid |
20-abx954610 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SSR3 Recombinant Protein (Rat) |
RP231188 |
ABM |
100 ug |
Ask for price |
SSR3 Rabbit Polyclonal Antibody